Construction of recombinant yarrowia lipolytica for efficiently synthesizing fructo-oligosaccharide

Abstract

The invention discloses construction of recombinant yarrowia lipolytica capable of efficiently synthesizing fructo-oligosaccharide, and belongs to the technical field of biological engineering. According to the recombinant yarrowia lipolytica disclosed by the invention, a fructosyl transferase mutant is over-expressed by using a high-copy free plasmid p-Sce-mtORI5-HygB constructed on the basis of a saccharomyces cerevisiae mitochondrial replication starting sequence Sc5 (the 66th valine residue of the fructosyl transferase derived from aspergillus oryzae is mutated into an asparagine residue). The invention provides the recombinant yarrowia lipolytica FT06 capable of efficiently synthesizing the fructo-oligosaccharide, the engineering strain is converted for 48 hours in a 5L fermentation tank, the titer of the fructo-oligosaccharide can reach 335g / L, and the yield is as high as 67%.

Description

Technical Field

[0001] The invention relates to the construction of a recombinant Yarrowia lipolytica for efficiently synthesizing oligofructose, and belongs to the technical field of bioengineering. Background Art

[0002] Oligofructose (fructooligosaccharides) are a highly effective and safe food additive with benefits such as enhancing immunity, promoting mineral absorption, improving lipid metabolism, and lowering blood sugar. Currently, the main chemical synthesis routes for glycosylated compounds are unattractive due to the high chemical sensitivity of sugars, necessitating the protection of both substrates and products, but lacking the necessary means. Furthermore, most chemical catalysts used are toxic and have low specificity, limiting their application in the pharmaceutical and food industries. The increasing use of biocatalysis in various chemical synthesis processes offers the potential for developing alternative processes that are selective, efficient, and less invasive. Oligofructose can be produced by enzymes with transfructosylation activity, namely fructosyltransferases (EC 2.4.1.9) and / or β-fructofuranosidases (EC 3.2.1.26), from plants and microorganisms. Most of these enzymes have been found in fungi, such as Aureobasidium spp., Aspergillus spp., Penicillium spp., and Fusarium spp. For example, Aspergillus niger ATCC 20611 is an industrially important oligofructose producer that produces β-fructofuranosidase with transglycosylation activity, which is responsible for converting sucrose into oligofructose. Wan et al. increased the yield of oligofructose to 71% by heterologously expressing glucose oxidase and peroxidase in Aspergillus niger ATCC 20611 (for details, see reference: Wan, X., Wang, L., Chang, J., Zhang, J., Zhang, Z., Li, K., Sun, G., Liu, C., Zhong, Y., 2024. Effective synthesis of high-content fructooligosaccharides in engineered Aspergillus niger. Microb. Cell. Fact. 23(1), 76.). However, although some of these processes have greatly improved the yield of oligofructose, the current strategy to increase the yield of oligofructose in industrial applications still depends on the development of production processes.

[0003] Yarrowia lipolytica is an unconventional yeast with a strong tolerance to high salt concentrations, extreme pH, and various organic compounds, which simplifies the optimization of bioprocesses. In addition, Yarrowia lipolytica has a clear genetic background and mature genetic manipulation tools, which allows for rational engineering design. In recent years, there has been an increasing number of studies and applications using Yarrowia lipolytica as a chassis cell to improve oligofructose synthesis. However, a large number of these studies mainly focus on enhancing oligofructose synthesis by integrating exogenous genes into the genome. However, there are still problems with low expression levels of key enzymes and low conversion rates, which seriously hinder the industrial synthesis of oligofructose. Summary of the Invention

[0004] In view of the shortcomings of the existing technology, the purpose is to improve the titer and yield of the synthetic strains of oligofructose in the existing technology. The present invention provides a construction method of recombinant Yarrowia lipolytica for efficiently synthesizing oligofructose and its application.

[0005] The first technical solution provided by the present invention is a method for reducing plasmid loss and / or improving plasmid transformation efficiency during the cultivation of Yarrowia lipolytica. The pINA1269 plasmid is used as a starting vector, and the replication initiation sequence Sce5 shown in SEQ ID No. 5 is connected to construct a free expression plasmid, and the free expression plasmid is transformed into Yarrowia lipolytica.

[0006] The second technical solution provided by the present invention is an episomal expression plasmid constructed by the method.

[0007] The third technical solution provided by the present invention is a recombinant Yarrowia lipolytica, which uses Yarrowia lipolytica PO1f as the starting bacterium, constructs a free plasmid with the Saccharomyces cerevisiae mitochondrial replication start sequence Sce5 as the autonomous replication start site, and uses surface display technology to overexpress a fructosyltransferase mutant; the free plasmid is the above-mentioned free expression plasmid.

[0008] In certain embodiments, the fructosyltransferase mutant is obtained by mutating the 66th residue of the fructosyltransferase to an asparagine residue; the amino acid sequence of the fructosyltransferase mutant is shown in SEQ ID NO.1.

[0009] In certain embodiments, the overexpression using surface display technology is performed using the cell wall protein Pir1 derived from Yarrowia lipolytica.

[0010] In certain embodiments, the episomal expression vector uses HygB as a selection marker.

[0011] In certain embodiments, the recombinant Yarrowia lipolytica uses the p-Sce-mtORI5-HygB plasmid as an expression vector, and the p-Sce-mtORI5-HygB plasmid is constructed based on the pINA1269 plasmid by connecting the replication initiation sequence Sce5 shown in SEQ ID No. 5 and the Pir1 gene shown in SEQ ID NO. 4.

[0012] The fourth technical solution provided by the present invention is a method for constructing the recombinant Yarrowia lipolytica, which comprises the following steps:

[0013] (1) A fructosyltransferase mutant derived from Aspergillus oryzae was obtained by mutating the valine residue at position 66 into an asparagine residue, the amino acid sequence of which is shown in SEQ ID NO. 1;

[0014] (2) Using the pINA1269 plasmid as the base plasmid, the Saccharomyces cerevisiae mitochondrial replication initiation sequence Sce5 was connected to construct the autonomously replicating free plasmid p-Sce-mtORI5-HygB;

[0015] (3) Using the p-Sce-mtORI5-HygB plasmid as an expression vector, the fructosyltransferase mutant was overexpressed to obtain the plasmid p-Sce5-Pir1-FTase V66N -HygB;

[0016] (3) p-Sce5-Pir1-FTase obtained in step (3) V66N The -HygB plasmid was transformed into the starting strain Yarrowia lipolytica PO1f using the lithium acetate method to obtain the engineered strain.

[0017] The fifth technical solution provided by the present invention is a method for culturing the recombinant Yarrowia lipolytica, wherein the recombinant Yarrowia lipolytica is inoculated into a culture medium and fermented at 28-30°C, 800-1000 rpm, 20-30% dissolved oxygen, and pH 5.8-6.0.

[0018] In certain embodiments, the culture medium includes but is not limited to YPD medium.

[0019] The sixth technical solution provided by the present invention is a method for converting and synthesizing fructo-oligosaccharides, wherein the method comprises using the recombinant Yarrowia lipolytica cells as whole-cell catalysts to convert and synthesize fructo-oligosaccharides.

[0020] In certain embodiments, the recombinant Yarrowia lipolytica seed solution is added to a reaction system containing YPD medium for fermentation, yeast cells are recovered from the fermentation solution, washed twice with PBS buffer, and sucrose is used as a substrate to catalyze the synthesis of oligofructose by the whole cells.

[0021] In certain embodiments, the fermentation is performed using a 5L fermentor tank to ferment the recombinant strain, and the method is: inoculating the recombinant Yarrowia lipolytica into a seed culture medium for culturing to obtain a seed liquid; and inoculating the prepared seed liquid into a YPD culture medium at an inoculation rate of 20% (v / v) for fermentation to obtain yeast cells.

[0022] In certain embodiments, the seed liquid is inoculated into YPD medium, and the fermentation conditions are: 30° C., 800 rpm, 20-30% dissolved oxygen, pH 6.0, and culture time 48 h.

[0023] In certain embodiments, during the fermentation process in a 5 L fermentor, the stirring speed is set to 800 rpm, the temperature is set to 30° C., the dissolved oxygen is controlled at 20-30%, the pH is controlled at 6.0 using 3 M NaOH, and the fermentation time is 48 h.

[0024] In certain embodiments, the whole-cell catalytic synthesis of oligofructose is performed using a 5L fermentation tank, wherein the yeast cells obtained above are subjected to whole-cell conversion in a system with a final sucrose concentration of 400-600 g / L, a temperature of 55-60° C., and a pH of 5.8-6.0 to synthesize oligofructose.

[0025] In certain embodiments, during the conversion process in a 5 L fermenter, the stirring speed is set to 200 rpm, the temperature is set to 60° C., the pH is set to 6.0, the final sucrose concentration is adjusted to 500 g / L, and the conversion time is 48 h.

[0026] The seventh technical solution provided by the present invention is the use of the recombinant Yarrowia lipolytica or the method in preparing a product containing oligofructose.

[0027] Beneficial effects:

[0028] (1) The present invention uses the mitochondrial replication initiation sequence of Saccharomyces cerevisiae to construct a high-copy free plasmid that can replicate autonomously in the Yarrowia lipolytica strain, solving the problems of low efficiency, low copy number and easy loss of traditional free plasmids, and promoting the development of Yarrowia lipolytica as a microbial cell factory.

[0029] (2) The present invention uses sucrose as a substrate for oligofructose conversion and provides a recombinant Yarrowia lipolytica strain that can efficiently synthesize oligofructose. Whole-cell conversion of this recombinant Yarrowia lipolytica in a 5L fermenter for 48 hours yielded a 67% yield of oligofructose, with a titer of 335g / L. This invention provides an excellent strain for the industrial production of high-level oligofructose and offers a viable strategy for the further development of other prebiotics. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 It is the characterization of free plasmids; a, plasmid map; b, plasmid loss; c, plasmid transformation efficiency.

[0031] Figure 2 It is a map of the free plasmid.

[0032] Figure 3 Optimization of conversion conditions and conversion results of fructosyltransferase mutants; a, temperature optimization; b, pH optimization; c, time optimization; d, substrate concentration optimization.

[0033] Figure 4 This is the result of transformation of the engineered strain in a 5L bioreactor. DETAILED DESCRIPTION

[0034] The present invention discloses a recombinant Yarrowia lipolytica and its application in the synthesis of oligofructose in a preferred embodiment. Those skilled in the art can refer to the contents of this article and appropriately improve the process parameters to achieve the desired effect. It is particularly important to note that all similar replacements and modifications are obvious to those skilled in the art and are considered to be included in the present invention. The present invention has been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods described herein without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0035] In order to further understand the present invention, the present invention is described in detail below with reference to specific examples. Unless otherwise specified, the reagents involved in the examples of the present invention are all commercially available products and can be purchased through commercial channels.

[0036] The "pINA1269 plasmid" involved in the following examples was donated by Professor Madzak Catherine of France and can also be purchased from the NTCC Type Culture Collection.

[0037] The culture medium involved in the following examples is as follows:

[0038] 1. YPD liquid medium (g / L): glucose 20, yeast extract 10, peptone 20;

[0039] 2. YPD solid medium (g / L): glucose 20, yeast extract 10, peptone 20, agar powder 20.

[0040] The detection methods involved in the following embodiments are as follows:

[0041] 1. Measure cell density OD using UV spectrophotometer 600 ;

[0042] 2. Detection of oligofructose content:

[0043] High-performance liquid chromatography (Agilent 1200 series; Agilent Technologies) was used for detection.

[0044] The sample volume was 10 μl, the amino column was Platisil NH2 (250×4.6 mm; 5 μm), the mobile phase was 70% acetonitrile, the flow rate was 1.0 mL / min, the detector was a RID detector, the detector temperature was 40°C, and the column temperature was 40°C.

[0045] The fructooligosaccharide yield or conversion rate involved in the following examples is calculated as follows: fructooligosaccharide yield = final fructooligosaccharide concentration / initial added sucrose concentration.

[0046] The mitochondrial replication initiation sequence, gene, plasmid, strain and primer information involved in the following examples are as follows:

[0047] 1. The mitochondrial replication initiation sequences of different yeasts are shown in Table 1.

[0048] Table 1 Mitochondrial replication initiation sequence

[0049]

[0050]

[0051]

[0052] 2. Gene information is shown in Table 2.

[0053] Table 2 Genes

[0054]

[0055] 3. Plasmid information is shown in Table 3.

[0056] Table 3 Plasmids

[0057]

[0058] 4. The strain information is shown in Table 4.

[0059] Table 4 Strains

[0060]

[0061] 5. Primer information is shown in Table 5.

[0062] Table 5 Primers

[0063]

[0064]

[0065] Example 1: Construction of engineered strains FT01-FT05

[0066] (1) Construction of free plasmids p-Sce-mtORI2-HygB, p-Sce-mtORI3-HygB, p-Sce-mtORI5-HygB, p-Ppa-mtORI-HygB, and p-Yli-mtORI-HygB

[0067] First, the mitochondrial replication origin sequences Sce2, Sce3, Sce5, Ppa, and Yli from Saccharomyces cerevisiae, Pichia pastoris, and Yarrowia lipolytica were obtained with reference to Cui et al. (Table 1, see reference: Cui, Z., Zheng, H., Jiang, Z., Wang, Z., Hou, J., Wang, Q., Liang, Q., Qi, Q., 2021. Identification and characterization of the mitochondrial replication origin for stable and episomal expression in Yarrowia lipolytica. ACS. Synth. Biol. 10(4), 826-835.). The sequences Sce2, Sce3, Sce5, Ppa, and Yli were ligated to the pINA1269 plasmid using inverse PCR, using primers F: gaattcCGTCGTCGCCTGAG; R: atcgatGATAAGCTGTCAAACATGAgaattcG. Free plasmids p-Sce-mtORI2, p-Sce-mtORI3, p-Sce-mtORI5, p-Ppa-mtORI and p-Yli-mtORI were obtained.

[0068] Next, the LEU2 selection marker in the episomal plasmids p-Sce-mtORI2, p-Sce-mtORI3, p-Sce-mtORI5, p-Ppa-mtORI, and p-Yli-mtORI obtained above was replaced with the HygB selection marker to generate the episomal expression vectors p-Sce-mtORI2-HygB, p-Sce-mtORI3-HygB, p-Sce-mtORI5-HygB, p-Ppa-mtORI-HygB, and p-Yli-mtORI-HygB. The PCR program was as follows: 95°C for 10 min; 95°C for 30 s; 58°C for 30 s; 72°C for 1 min; and 72°C for 10 min, for 30 cycles. For mitochondrial replication initiation sequences from different sources, primer pairs (Sce-mtORI2F / R, Sce-mtORI3F / R, Sce-mtORI5 F / R, Pa-mtORI F / R and Yli-mtORI F / R) were designed for amplification. The primer sequences involved are shown in Table 5.

[0069] The p-Sce-mtORI2-HygB, p-Sce-mtORI3-HygB, p-Sce-mtORI5-HygB, p-Ppa-mtORI-HygB and p-Yli-mtORI-HygB plasmids obtained above were transformed into E. coli JM109 competent cells to obtain transformants.

[0070] After the transformant colonies were picked for PCR verification of the correct band size, the plasmids were extracted and sent to GeneWeichi for sequencing. If the sequencing was correct, the episomal expression vectors p-Sce-mtORI2-HygB, p-Sce-mtORI3-HygB, p-Sce-mtORI5-HygB, p-Ppa-mtORI-HygB, and p-Yli-mtORI-HygB were successfully constructed.

[0071] (2) Preparation of Yarrowia lipolytica competent cells

[0072] Y. lipolytica PO1f was picked from a -80°C glycerol tube using an inoculating loop, streaked three times onto YPD solid medium, and incubated at 30°C in a humidified incubator for 48 hours. A single colony was picked from the plate and inoculated into a 50mL vial containing 10mL of YPD liquid medium. The cells were incubated at 30°C at 220 rpm for 20 hours. The cells were collected in a clean hood and transferred to a 50mL centrifuge tube. The tubes were centrifuged at 6000 rpm for 5 minutes at 4°C, and the supernatant was discarded. The cells were resuspended in 20mL of sterile water and washed. The tubes were centrifuged at 6000 rpm for 5 minutes at 4°C, and the supernatant was discarded. The cells were then resuspended in 1mL of 0.1mol / L lithium acetate (pH 6.0) and incubated at room temperature for 10 minutes. A 100μL aliquot of the competent cells was transferred to a sterile 2mL centrifuge tube for transformation to prepare Y. lipolytica PO1f competent cells.

[0073] (3) Preparation of FT01-FT05

[0074] Add 10 μL of p-Sce-mtORI2-HygB, p-Sce-mtORI3-HygB, p-Sce-mtORI5-HygB, p-Ppa-mtORI-HygB, p-Yli-mtORI-HygB and 10 μL of salmon sperm DNA (10 mg / mL) to Y.lipolyticaPO1f competent cells, mix well by pipetting, and incubate at 30°C for 15 minutes; add 600 μL of 50% PEG4000 to the above mixture, mix well, and incubate at 30°C and 220 rpm for 1 hour.

[0075] Place the centrifuge tube containing the above mixture in a 39℃ water bath for 1 hour; add 1ml YPD medium and activate the culture at 30℃ and 220rpm for 2 hours; centrifuge at 9000rpm for 1 minute, remove the supernatant and suspend the bacteria with 1ml sterile water; centrifuge at 9000rpm for 1 minute, collect the bacteria, spread the bacteria on YPD solid medium supplemented with 400μg / mL hygromycin, and culture in a constant temperature incubator at 30℃ for 3-4 days; pick single colonies from the plate and verify the single colonies by colony PCR using Taq DNA polymerase using Sce-mtORI2 F / R, Sce-mtORI3 F / R, Sce-mtORI5 F / R, Pa-mtORI F / R and Yli-mtORI F / R as primers; inoculate the positive single colony containing the target band into YPD liquid medium, culture at 30℃ and 220rpm for 24 hours, and extract the plasmid using Sce-mtORI2 The primers p-Sce-mtORI2-HygB, p-Sce-mtORI3-HygB, p-Sce-mtORI5-HygB, p-Ppa-mtORI-HygB and p-Yli-mtORI-HygB were used as the primers and sent to GeneWeiZ for sequencing and verification again, thus obtaining Y.lipolytica PO1f strains containing the free plasmids p-Sce-mtORI2-HygB, p-Sce-mtORI3-HygB, p-Sce-mtORI5-HygB, p-Ppa-mtORI-HygB and p-Yli-mtORI-HygB, which were named FT01-FT05 respectively.

[0076] (4) Characterization of FT01-FT05

[0077] First, it was necessary to verify whether the episomal plasmids p-Sce-mtORI2-HygB, p-Sce-mtORI3-HygB, p-Sce-mtORI5-HygB, p-Ppa-mtORI-HygB, and p-Yli-mtORI-HygB in FT01-FT05 strains were present in circular form. Therefore, PCR was performed using two pairs of directly adjacent reverse primers. One pair of primers targeted the mitochondrial replication origin region of the plasmid, and the other pair targeted the hygromycin selection marker. The primer sequences involved (Sce-mtORI2 F / R; Sce-mtORI3 F / R; Sce-mtORI5 F / R; Pa-mtORI F / R; Yli-mtORI F / R; HygB F / R) are shown in Table 5 ( Figure 1 The results showed that strains FT01-FT05 all contained intact circular plasmids, indicating that replication origin sequences derived from different yeast mitochondria can promote the replication and retention of free plasmids in Yarrowia lipolytica.

[0078] Subsequently, the genetic stability and replication performance levels of the free plasmids p-Sce-mtORI2-HygB, p-Sce-mtORI3-HygB, p-Sce-mtORI5-HygB, p-Ppa-mtORI-HygB and p-Yli-mtORI-HygB in continuous cell culture were evaluated. The FT01-FT05 strains were inoculated into YPD and YPD+HygB medium (with hygromycin added at 400 μg / mL) and cultured in shake flasks for 200 hours. Samples were taken every 20 hours to determine the plasmid loss rate. The results showed that, in YPD and YPD+HygB medium, except for p-Ppa-mtORI-HygB, the other free plasmids showed significant stability, and the plasmid loss rate was always maintained at about 5% ( Figure 1 , b).

[0079] Finally, the transformation efficiency of the episomal plasmids p-Sce-mtORI2-HygB, p-Sce-mtORI3-HygB, p-Sce-mtORI5-HygB, p-Ppa-mtORI-HygB, and p-Yli-mtORI-HygB was determined. The results showed that the plasmid p-Sce-mtORI5-HygB exhibited the highest transformation efficiency, approximately 130 colonies / μg DNA; followed by p-Yli-mtORI-HygB, with a transformation efficiency of 121 colonies / μg DNA ( Figure 1 , c). Therefore, the free plasmid p-Sce-mtORI5-HygB was subsequently used to overexpress the fructosyltransferase gene.

[0080] Example 2: Construction of recombinant Yarrowia lipolytica for efficient synthesis of fructooligosaccharides

[0081] The specific steps are as follows:

[0082] (1) Overexpression plasmid p-Sce5-Pir1-FTase V66N -Construction of HygB

[0083] According to the Pir1 sequence published in Genbank (AF336989) in NCBI, primers Pir1-F / R (Table 5) were designed to amplify the Pir1 gene from the Y.lipolytica PO1f genome (the nucleotide sequence is shown in SEQ ID NO.4, and the encoded amino acid sequence is shown in SEQ ID NO.3). The anchor protein gene Pir1 was connected to the free plasmid p-Sce-mtORI5-HygB digested with KpnI by the homologous recombinase ClonExpress II One Step Cloning Kit (Novozymes) to construct the plasmid p-Sce5-Pir1-HygB. The fructosyltransferase gene FTase from Aspergillus oryzae was codon-optimized and synthesized by Jinweizhi Company. The valine residue at position 66 of the codon-optimized fructosyltransferase was mutated into an asparagine residue to obtain a fructosyltransferase mutant, the nucleotide sequence of which is shown in SEQ ID NO.2. Reverse PCR was performed using primers F: ggtaccTCCATGGCCTGTCCC; R: ttaaattgaagatatgacaatgctgaaaactcgag, and the gene encoding the fructosyltransferase mutant was ligated with the plasmid p-Sce5-Pir1-HygB using the homologous recombination enzyme ClonExpress II One Step Cloning Kit (Novozymes) to construct the final overexpression plasmid p-Sce5-Pir1-FTase. V66N -HygB (specific map see Figure 2 ), the sequences of the primers involved (Sce-mtORI5 F / R; Pir1 F / R; FTase F / R; HygB F / R) are shown in Table 5.

[0084] (2) Overexpression plasmid p-Sce5-Pir1-FTase V66N -Conversion of HygB

[0085] Prepare competent cells of Y.lipolytica PO1f and add 10 μL p-Sce5-Pir1-FTase V66N The -HygB plasmid and 10 μL of salmon sperm DNA (10 mg / mL) were added to competent cells of the Y. lipolytica PO1f strain. The cells were spread on YPD solid medium containing 400 μg / mL hygromycin and cultured in a 30°C constant temperature incubator for 3-4 days. Single colonies were picked from the plates for colony PCR verification. Positive transformants were inoculated into 10 mL YPD vials, named FT06, and stored in glycerol tubes.

[0086] Example 3: Whole-cell conversion of genetically engineered bacteria FT06 into oligofructose in a 5 L fermenter

[0087] (1) Recombinant Yarrowia lipolytica FT06 was picked from a -80°C glycerol tube using an inoculation loop, streaked onto YPD solid medium, and cultured in a 30°C incubator for 48 h.

[0088] (2) Preparation of culture medium

[0089] 1) Preparation of seed culture medium: glucose 10 g / L, yeast extract 10 g / L, peptone 20 g / L, natural pH.

[0090] 2) Preparation of YPD medium: 20 g / L glucose, 10 g / L yeast extract, 20 g / L peptone, pH 6.0.

[0091] (3) Pick a single activated colony from the plate and inoculate it into the seed culture medium. After culturing at 30°C and 220 rpm for 24 h, a seed solution was prepared.

[0092] (4) The seed solution was transferred to a 5 L fermenter containing 2LYPD medium at a volume ratio of 20% (v / v) and fermented. The fermentation parameters were as follows: stirring speed of 800 rpm, temperature of 30°C, dissolved oxygen of 20% to 30%, pH of 6.0, and fermentation time of 48 h.

[0093] (5) Yeast cells were recovered from the fermentation broth and washed twice with PBS buffer. Then 500 mL of PBS buffer was added to the fermenter to raise the final cell density (OD 600 ) was diluted to 25 and sucrose was used as the substrate for whole-cell conversion to oligofructose. The main conversion parameters for the whole-cell conversion included: stirring speed of 200 rpm, temperature controlled at 60°C, pH maintained at 6.0, final sucrose concentration adjusted to 500 g / L, and a conversion cycle of 48 hours.

[0094] (6) The supernatant of the sample centrifuged 48 hours after transformation was tested by HPLC. The results showed that the engineered strain FT06 finally converted 335 g / L of oligofructose, and the yield was increased to 67%. This is the highest oligofructose yield reported so far in Yarrowia lipolytica using surface display technology. Therefore, the recombinant strain of the present invention can efficiently synthesize oligofructose and can be used in industrial production.

[0095] Comparative Example 1: Optimization of FT06 conversion conditions

[0096] Specific implementation method: Refer to Example 3, except that, in order to maintain better fructosyltransferase activity during fermentation and conversion, the whole-cell conversion conditions (pH value, temperature, conversion time and substrate concentration) of the fructosyltransferase mutant displayed on the surface of the FT06 strain were optimized.

[0097] 1) Optimization of conversion temperature: In order to determine the optimal temperature for oligofructose conversion, the final sucrose concentration in the buffer (50 mM, pH 6.0) was adjusted to 300 g / L, and the final cell density (OD 600 ) was diluted to 25, the temperature was controlled in the range of 20-80℃, and the transformation was carried out in a constant temperature shaker at 200rpm for 48h. The results showed that the optimal reaction temperature of the fructosyltransferase mutant was 60℃, and 90% of the activity was maintained at 45-65℃ ( Figure 3 , a).

[0098] 2) Optimization of conversion pH: To determine the optimal pH for oligofructose conversion, different pH values ​​were set using 50 mM sodium acetate buffer (pH 4.0-5.5) and 100 mM sodium phosphate buffer (pH 6.0-8.5) at the optimal conversion temperature. The final sucrose concentration in the buffer was adjusted to 300 g / L, and the final cell density (OD 600 ) was diluted to 25, and transformed in a constant temperature shaker at 200 rpm for 48 h. Figure 3 As can be seen from Figure b, the yield of oligofructose reached the highest when the pH was 6.0.

[0099] 3) Optimization of conversion time: In order to determine the optimal time for oligofructose conversion, the final sucrose concentration in the buffer was adjusted to 300 g / L at the optimal conversion temperature and pH, and the final cell density (OD 600 ) was diluted to 25,200rpm constant temperature shaker and transformed for 12-72h. The results showed that the optimal reaction conversion time of the fructosyltransferase mutant was 48h ( Figure 3 , c).

[0100] 4) Optimization of conversion substrate concentration: In order to determine the optimal substrate concentration for oligofructose conversion, the final sucrose concentration in the buffer was adjusted to 100-800 g / L at the optimal conversion temperature, pH and time, and the final cell density (OD 600 ) was diluted to 25,200rpm in a constant temperature shaker for whole cell transformation. The results showed that under the optimal transformation conditions (temperature 60℃, pH 6.0 and substrate concentration 500g / L), the FT06 strain achieved a maximum conversion rate of 67% of oligofructose after 48 hours of transformation, with a titer of approximately 335g / L ( Figure 3 , d).

[0101] The above are only preferred embodiments of the present invention and are not intended to limit the present invention. The present invention is not limited to the above examples. Any changes, modifications, additions or substitutions made by those skilled in the art within the essential scope of the present invention should also fall within the scope of protection of the present invention.

Claims

1. A method for reducing plasmid loss and / or improving plasmid transformation efficiency during the cultivation of Yarrowia lipolytica, characterized in that: Using the pINA1269 plasmid as a starting vector, the replication initiation sequence Sce5 shown in SEQ ID No. 5 was connected to construct an episomal expression plasmid, and the episomal expression plasmid was transformed into Yarrowia lipolytica.

2. The episomal expression plasmid prepared by the method of claim 1.

3. A recombinant Yarrowia lipolytica, characterized in that The Yarrowia lipolytica PO1f is used as the starting strain and the free expression plasmid according to claim 2 is used as the expression vector to express the fructosyltransferase mutant with the amino acid sequence shown in SEQ ID NO.

1.

4. The recombinant Yarrowia lipolytica according to claim 1, characterized in that The episomal expression plasmid is also connected to the Pir1 gene shown in SEQ ID NO.

4.

5. A method for culturing the recombinant Yarrowia lipolytica according to claim 3 or 4, characterized in that: The recombinant Yarrowia lipolytica is inoculated into a culture medium, and fermentation is carried out under the conditions of 28-30° C., 800-1000 rpm, 20-30% dissolved oxygen, and pH 5.8-6.

0.

6. The method according to claim 5, characterized in that The culture medium includes but is not limited to YPD medium.

7. A method for synthesizing oligofructose, characterized in that: The recombinant Yarrowia lipolytica according to claim 3 or 4 is added to a reaction system containing sucrose, and the reaction is carried out at 55-60° C. for at least 48 hours.

8. The method according to claim 7, characterized in that The reaction system contains 400-600 g / L sucrose and the recombinant Yarrowia lipolytica with an OD value of 25-30.

9. The method according to claim 8, characterized in that The pH of the reaction system is 5.8-6.

0.

10. Use of the recombinant Yarrowia lipolytica according to claim 3 or 4 or the method according to any one of claims 7 to 9 in the preparation of a product containing fructooligosaccharides.

Images