Preparation method and application of fibronectin

Abstract

The invention provides a preparation method and application of fibronectin, and relates to the technical field of biology. The preparation method comprises the following steps: expressing fibronectin by using HEK-293T cells, and taking AGRN protein signal peptide as the signal peptide of the fibronectin. According to the preparation method, the HEK-293T cells can secrete and express fibronectin with high yield and high biological activity, and the application of the fibronectin in the aspects of tissue regeneration, wound healing and the like is facilitated.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a preparation method of fibronectin and application thereof. Background Art

[0002] The following statements merely provide background information related to the present disclosure and do not necessarily constitute prior art.

[0003] Fibronectin 1 (FN1) is an important extracellular matrix glycoprotein that mediates multiple cellular interactions with the extracellular matrix (ECM) and is widely involved in physiological processes such as cell adhesion, migration, proliferation, and tissue repair. Its molecular structure comprises multiple functional domains, such as the RGD (arginine-glycine-aspartic acid) sequence, the heparin-binding domain, and the fibrin-binding domain. Fibronectin participates in a wide range of physiological processes, including cell adhesion, migration, and differentiation and growth. It plays a role in tissue regeneration, wound healing, and promoting cell proliferation and differentiation. It currently has broad application prospects in medicine, cosmetics, skincare, and scientific research, and can be used to prepare products for tissue engineering, wound repair, drug delivery, and stem cell culture.

[0004] There are currently two main sources of fibronectin: (1) Traditional animal blood extraction. On the one hand, the purification of natural fibronectin from human plasma is limited by the supply of plasma, is costly, has large batch-to-batch variability, and carries the risk of pathogen contamination. On the other hand, fibronectin isolated from animal tissues (such as bovine plasma) is immunogenic and may trigger host immune responses. Therefore, traditional animal-derived fibronectin is difficult to meet the needs of large-scale production applications.

[0005] (2) Recombinant expression source. Using genetic engineering technology to express recombinant fibronectin in host cells is an important way to solve the shortcomings of natural sources. Although recombinant DNA technology has made large-scale production of fibronectin possible, the current recombinant expression system still faces many technical bottlenecks. The current expression systems mainly include prokaryotic expression systems and eukaryotic expression systems. Prokaryotic expression systems, such as Escherichia coli, have low cost, short cycle and high yield, but it is difficult to achieve the correct folding and post-translational modification of fibronectin. It is prone to domain folding errors or glycosylation abnormalities, resulting in damage to the key functions of the produced fibronectin, such as cell adhesion and matrix assembly. It is also easy to form inclusion bodies, resulting in low protein activity after renaturation, and there may be risks of immunogenicity and endotoxins, leading to safety issues. Additional steps are required to remove endotoxins, increasing production costs. Eukaryotic expression systems typically use mammalian cells, such as CHO and HEK-293T, to express fibronectin, which can complete complex folding and modification. The product is close to natural fibronectin, but its expression level is low (usually <1g / L) and requires purification steps such as affinity chromatography and ion exchange, which greatly increases production costs.

[0006] Therefore, developing a method for preparing recombinant human fibronectin with high efficiency, high activity, low immunogenicity and low cost, and expanding its application in the biomedical field, has important scientific value and market prospects. Summary of the Invention

[0007] The object of the present invention is to provide a method for preparing fibronectin, so as to alleviate the problem of low efficiency of expressing fibronectin using mammalian cells in the prior art.

[0008] In order to solve the above technical problems, the present invention adopts the following technical solutions: In a first aspect, a method for preparing fibronectin is provided, comprising expressing fibronectin using HEK-293T cells and using AGRN protein signal peptide as the signal peptide of fibronectin.

[0009] In a second aspect, a polynucleotide is provided, wherein the polynucleotide contains, from the 5' end to the 3' end, a sequence encoding an AGRN protein signal peptide and a sequence encoding fibronectin.

[0010] In a third aspect, a vector is provided, wherein the vector carries the polynucleotide described in the second aspect.

[0011] In a fourth aspect, a recombinant HEK-293T cell is provided, wherein the recombinant HEK-293T cell carries the polynucleotide of the second aspect, or contains the vector of the third aspect.

[0012] In a fifth aspect, a method for preparing the fibronectin described in the first aspect, or the fibronectin prepared by the preparation method of the first aspect, or the polynucleotide described in the second aspect, or the vector described in the third aspect, or the recombinant HEK-293T cells described in the fourth aspect, for use in any one of (i) to (iii) is provided: (i) Use in promoting fibroblast adhesion, proliferation and / or migration for non-diagnostic and therapeutic purposes; (ii) use in the preparation of a product for promoting fibroblast adhesion, proliferation and / or migration; (iii) Use in the preparation of products for tissue regeneration or wound healing.

[0013] In the sixth aspect, a method for preparing the fibronectin described in the first aspect, or the fibronectin prepared by the preparation method described in the first aspect, or the polynucleotide described in the second aspect, or the vector described in the third aspect, or the recombinant HEK-293T cells described in the fourth aspect are provided for preparing tissue engineering materials, wound repair materials, drug delivery preparations or stem cell culture preparations.

[0014] Compared with the prior art, the present invention has the following beneficial effects: The present invention uses HEK-293T cells to express fibronectin, and replaces the traditional signal peptide with AGRN protein signal peptide, thereby successfully achieving the preparation of high-yield, highly bioactive fibronectin. Experiments have confirmed that there is a synergistic effect between the AGRN protein signal peptide and HEK-293T cells. Compared with CHO cells, the AGRN protein signal peptide can make the fibronectin protein have a higher expression level in HEK-293T cells. In addition, the fibronectin prepared by the present invention has good biological activity, and experiments have shown that it can effectively promote the proliferation, adhesion and migration of fibroblasts. Based on these excellent properties, this preparation method has huge application potential and broad market prospects in multiple fields such as tissue regeneration, wound healing, regenerative medicine product development, gene therapy product development, biomaterial preparation and beauty product production. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] In order to more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the specific embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0016] Figure 1 The plasmid map of the expression plasmid constructed in Example 1; Figure 2The results of immunoblotting in Example 3 are as follows: Figure 3 The results of immunoblotting in Example 4 are as follows: Figure 4 is the relative adhesion rate of the negative control and the fibroblasts after fibronectin coating in Example 5; Figure 5 is the relative proliferation rate of fibroblasts treated with various concentrations of fibronectin in Example 6; Figure 6 These are photos of fibroblasts at 0 h, 6 h, and 24 h in the cell scratch experiment in Example 7. DETAILED DESCRIPTION

[0017] The technical solutions of the present invention are described clearly and completely below with reference to the embodiments. It is obvious that the embodiments described are only a portion of the embodiments of the present invention, not all of them. All other embodiments derived by persons of ordinary skill in the art based on the embodiments of the present invention without creative effort are also within the scope of protection of the present invention.

[0018] As used herein, "and / or" is used to indicate that either or both of the stated situations may occur, for example, A and / or B includes (A and B) and (A or B).

[0019] In this document, unless otherwise stated, arbitrary numbering is used to distinguish one entity or action from another entity or action, and does not necessarily require or imply any actual relationship, order, or importance between these entities or actions, such as numbering first, second, etc.

[0020] As used herein, unless otherwise stated, "optionally," "optional," "optional," or "optional" means that the subsequently described event or circumstance may but need not occur, and that the description includes instances where the event or circumstance occurs and instances where it does not.

[0021] Herein, the terms "comprise" or "comprising" are intended to imply the inclusion of stated elements, integers or steps, but not the exclusion of any other elements, integers or steps.

[0022] In this article, peptides, polypeptides, and proteins are not strictly distinguished and can be used interchangeably in some cases. They generally refer to polymers composed of amino acids connected by peptide bonds, whether naturally occurring or synthetic.

[0023] As used herein, the term "polynucleotide" refers to a polymeric form of nucleotides of any length, including ribonucleotides and / or deoxyribonucleotides. Examples of polynucleotides include, but are not limited to, single-stranded, double-stranded, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or polymers comprising purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural, or derived nucleotide bases. When a polynucleotide encodes a protein or polypeptide, the encoding may optionally encode a sense strand or an antisense strand. A polynucleotide may be naturally occurring, synthetic, recombinant, or any combination thereof. "Nucleic acid molecule," "nucleic acid," and "polynucleotide" may be used interchangeably. In an optional embodiment, the polynucleotide is DNA.

[0024] As used herein, the term "vector" refers to a vehicle into which a genetic element (e.g., the aforementioned polynucleotide) can be operatively inserted and used to express the genetic element, for example, to produce the protein, RNA, or DNA encoded by the genetic element, or to replicate the genetic element. Vectors can be used to transform, transduce, or transfect host cells, enabling expression of the genetic element carried by the vector within the host cell. For example, vectors include plasmids, episomal plasmids, minicircle DNA, phagemids, cosmids, artificial chromosomes such as yeast artificial chromosomes (YACs), bacterial artificial chromosomes (BACs), or P1-derived artificial chromosomes (PACs), bacteriophages such as lambda phage or M13 phage, and animal viruses. Vectors may contain a variety of elements that control expression, including promoter sequences, transcription initiation sequences, enhancer sequences, selection elements, and reporter genes. Vectors may also contain a replication initiation site. Vectors may also include components that facilitate entry into cells, including, but not limited to, viral particles, liposomes, or protein coats. Vectors may be expression vectors or cloning vectors. The vector may also include a selectable marker, such as, but not limited to, a resistance gene and / or a fluorescent protein gene.

[0025] In a first aspect, a method for preparing fibronectin is provided, comprising expressing fibronectin using HEK-293T cells and using AGRN protein signal peptide as the signal peptide of fibronectin.

[0026] AGRN, as used herein, refers to recombinant protein. AGRN is a multidomain protein that can be expressed as a membrane protein or secreted within the ECM. AGRN contains several laminin G, Kazal-type serine protease inhibitor, and epidermal growth factor domains, with a core protein size of approximately 220 kDa.

[0027] HEK-293T cells (Human Embryonic Kidney 293T cells) are derived from human embryonic kidney cells and are often used as host cells for exogenous expression of target proteins. They have the advantages of stable and high in vitro proliferation capacity and high transfection efficiency. The present invention discovered that using the AGRN protein signal peptide as the signal peptide for fibronectin can significantly improve the expression of fibronectin in HEK-293T cells.

[0028] In an optional embodiment, the original signal peptide of fibronectin is replaced by the AGRN protein signal peptide.

[0029] In an alternative embodiment, fibronectin is secreted and expressed in HEK-293T cells.

[0030] In an optional embodiment, the amino acid sequence of the AGRN protein signal peptide is shown as SEQ ID NO.1.

[0031] SEQ ID NO. 1: MAGRSHPGPLRPLLPLLVVAACVLPGAGG.

[0032] In an optional embodiment, the nucleotide sequence encoding the AGRN protein signal peptide is shown as SEQ ID NO.2.

[0033] SEQ ID NO.2: atggccggccggtcccacccgggcccgctgcggccgctgctgccgctccttgtggtggccgcgtgcgtcctgcccggagccggcggg.

[0034] In an optional embodiment, the preparation method comprises allowing HEK-293T cells to express a polynucleotide, wherein the polynucleotide sequentially contains a sequence encoding an AGRN protein signal peptide and a sequence encoding fibronectin from the 5' end to the 3' end.

[0035] The sequence encoding the AGRN protein signal peptide and the sequence encoding fibronectin may or may not be integrated into the genome of the HEK-293T cells.

[0036] In an optional embodiment, the preparation method comprises: introducing the polynucleotide into HEK-293T cells, culturing the HEK-293T cells, and allowing the HEK-293T cells to express fibronectin.

[0037] In an optional embodiment, those skilled in the art can introduce the polynucleotide encoding the AGRN protein signal peptide and the polynucleotide encoding the fibronectin into HEK-293T cells by any known method for introducing exogenous nucleic acids into cells, such as but not limited to liposome transfection, cationic polymer transfection, electroporation, microinjection, gene gun or viral vector-mediated transfection.

[0038] It is understood that those skilled in the art can culture the HEK-293T cells using any method known in the art, including any known culture medium, culture environment, culture container, and culture equipment.

[0039] In an optional embodiment, the preparation method further comprises isolating, enriching and / or purifying recombinant HEK-293T cell-expressed fibronectin.

[0040] In an optional embodiment, the fibronectin carries a His tag, and the preparation method further comprises purifying the fibronectin using a filler modified with nickel ions.

[0041] The fibronectin prepared by the preparation method of the first aspect includes wild-type fibronectin or artificially modified fibronectin, and the artificially modified fibronectin includes but is not limited to a polypeptide or protein that is mutated, truncated, or fused with other domains.

[0042] The fibronectin produced by the preparation method of the first aspect can be fibronectin derived from any species in the art, such as fibronectin from mammals, including but not limited to humans, monkeys, dogs, cats, mice, rats, cattle, horses, camels, alpacas, poultry, goats, and sheep. In an alternative embodiment, the fibronectin produced by the preparation method of the first aspect is human fibronectin. In an alternative embodiment, the fibronectin expressed by the preparation method is the fibronectin encoded by the nucleotide sequence shown in SEQ ID NO. 7.

[0043] In a second aspect, a polynucleotide is provided, wherein the polynucleotide contains, from the 5' end to the 3' end, a sequence encoding an AGRN protein signal peptide and a sequence encoding fibronectin.

[0044] In an optional embodiment, the amino acid sequence of the AGRN protein signal peptide is shown as SEQ ID NO.1.

[0045] In an optional embodiment, the polynucleotide sequence encoding the AGRN protein signal peptide is shown as SEQ ID NO.2.

[0046] In a third aspect, a vector is provided, wherein the vector carries the polynucleotide described in the second aspect.

[0047] In an optional embodiment, the vector is a plasmid.

[0048] In an optional embodiment, the vector is an expression plasmid.

[0049] In a fourth aspect, a recombinant HEK-293T cell is provided, wherein the recombinant HEK-293T cell carries the polynucleotide described in the second aspect, or contains the vector described in the third aspect.

[0050] In an optional embodiment, the polynucleotide described in the second aspect may or may not be integrated into the genome of the recombinant HEK-293T cells.

[0051] In an optional embodiment, the recombinant HEK-293T cells contain a plasmid carrying the polynucleotide described in the second aspect.

[0052] In a fifth aspect, a method for preparing the fibronectin described in the first aspect, or the fibronectin prepared by the preparation method of the first aspect, or the polynucleotide described in the second aspect, or the vector described in the third aspect, or the recombinant HEK-293T cells described in the fourth aspect, for use in any one of (i) to (iii) is provided: (i) Use in promoting fibroblast adhesion, proliferation and / or migration for non-diagnostic and therapeutic purposes; (ii) use in the preparation of a product for promoting fibroblast adhesion, proliferation and / or migration; (iii) Use in the preparation of products for tissue regeneration or wound healing.

[0053] In an optional embodiment, the (i) is an application in promoting fibroblast adhesion, proliferation and / or migration in vitro.

[0054] In the sixth aspect, provided is a method for preparing the fibronectin described in the first aspect, or the fibronectin prepared by the method for preparing the fibronectin described in the first aspect, or the polynucleotide described in the second aspect, or the vector described in the third aspect, or the recombinant HEK-293T cells described in the fourth aspect in the preparation of tissue engineering materials, wound repair materials, drug delivery preparations or stem cell culture preparations.

[0055] The present invention is further described below by way of specific examples. However, it should be understood that these examples are merely provided for more detailed description and are not to be construed as limiting the present invention in any form.

[0056] Example 1 1. Connect the target gene to the pCDNA3.1 expression vector by seamless cloning to obtain different signal peptide-linked fibronectin (FN1) gene expression plasmids. The plasmid maps are as follows: Figure 1As shown, the nucleotide sequence encoding the signal peptide is connected to the 5' end of the fibronectin gene. The nucleotide sequence of the fibronectin gene is shown in SEQ ID NO. 7. The fibronectin is connected to a 6×His tag.

[0057] The signal peptide sequences are: Signal peptide A (fibronectin signal peptide): Amino acid sequence, SEQ ID NO. 3: MLRGPGPGLLLLAVQCLGTAVPSTG Nucleotide sequence, SEQ ID NO.4: atgcttaggggtccggggcccgggctgctgctgctggccgtccagtgcctggggacagcggtgccctccacggga Signal peptide B (FBLN2 protein signal peptide): Amino acid sequence, SEQ ID NO.5: MVLLWEPAGAWLALGLALALGPSVAAA Nucleotide sequence, SEQ ID NO.6: atggtgctgctctgggagcctgcaggagcctggcttgctctgggcctggccctggccctgggccccagcgtggccgcagct Signal peptide C (AGRN protein signal peptide): Amino acid sequence, SEQ ID NO.1: MAGRSHPGPLRPLLPLLVVAACVLPGAGG Nucleotide sequence, SEQ ID NO.2: atggccggccggtcccacccgggcccgctgcggccgctgctgccgctccttgtggtggccgcgtgcgtcctgcccggagccggcggg Three expression plasmids were obtained, each containing a signal peptide and a fibronectin encoding protein, and were named pA-FN1, pB-FN1, and pC-FN1, respectively. Figure 1 shown.

[0058] Example 2 Production and preparation of human fibronectin secreted efficiently by HEK-293T cells: HEK-293T cells were plated one day in advance to a confluency of 80% before transfection. During transfection, 20 μg of the recombinant expression plasmids pA-FN1, pB-FN1, and pC-FN1 prepared in Example 1 were incubated with PEI transfection reagent to form a transfection complex. After incubation, the transfection complex was added dropwise to the supernatant of the HEK-293T cell culture medium. The supernatant of the post-transfection HEK-293T culture medium was collected and eluted using a nickel ion affinity chromatography column. The fibronectin corresponding to the elution peak was collected to obtain recombinant human fibronectin.

[0059] Example 3 Comparison of expression levels of fibronectin linked to different signal peptides: The recombinant expression plasmids pA-FN1, pB-FN1, and pC-FN1 prepared in Example 1 were transfected into HEK-293T cells, and the cell culture supernatant was collected 72 hours after transfection. The expression levels of fibronectin were compared by immunoblotting. Figure 2 As shown in the figure, when the total protein loading amount per well is the same, the expression level of fibronectin linked to signal peptide A, signal peptide B, and signal peptide C is higher than that of fibronectin linked to signal peptide C. Therefore, using signal peptide C to link fibronectin for expression can achieve the maximum expression level of fibronectin.

[0060] Example 4 Comparison of signal peptide C-linked fibronectin expression in different mammalian cells: The recombinant expression plasmid pC-FN1 constructed in Example 1 was transfected into HEK-293T and CHO cells, respectively, to compare the expression differences in different mammalian cells. One day before transfection, HEK-293T and CHO cells were seeded into 6-well plates, respectively, so that the confluence reached 80% before transfection. During transfection, 2 μg of recombinant expression plasmid pC-FN1 was incubated with PEI transfection reagent to form a transfection complex. After incubation, the transfection complex was added dropwise to the culture supernatant of HEK 293T and CHO cells, respectively, using the same amount of plasmid for transfection. After transfection, the culture supernatant of HEK-293T and CHO cells was collected 72 hours after transfection, and the expression level of fibronectin was compared by immunoblotting. The results are shown in Figure 2. Figure 3 As shown in the figure, when the total protein loading amount per well is consistent, the expression level of the recombinant expression plasmid pC-FN1 in HEK 293T cells is significantly better than that in CHO cells. Therefore, using HEK-293T cells to express the recombinant plasmid containing signal peptide C linked to fibronectin can efficiently secrete human fibronectin.

[0061] Example 5 Fibronectin promotes fibroblast adhesion: For the cell adhesion assay, the 96-well plate was first coated at 37°C with 10μg / mL, 5μg / mL, 2.5μg / mL, 1μg / mL, 0.5μg / mL and 0μg / mL of the fibronectin solution prepared in Example 2. The plates were then incubated with 1% denatured BSA for 1 hour, and then the plates were washed 3 times with serum-free culture medium to remove excess glue for later use. Fibroblasts were digested, 5000 cells were inoculated into each well, and a blank control with no cells but only culture medium was set up, and the plates were incubated in a 37°C incubator for 1 hour. After 1 hour, the culture medium of each well was removed, and the cells that did not adhere to the wall were gently washed 3 times with PBS. 100μL of culture medium containing 10% CCK-8 was added, and the plates were incubated in a 37°C cell incubator for another 2 hours. The absorbance at 450nm was detected using an enzyme reader to calculate the cell adhesion rate. The results are as follows: Figure 4 As shown, as the concentration of fibronectin increased, the adhesion of fibroblasts gradually increased.

[0062] Example 6 Fibronectin promotes fibroblast proliferation: The fibronectin obtained in Example 2 was diluted to an appropriate concentration using DMEM basal medium, i.e., 0.4 μg / mL, 0.2 μg / mL, 0.1 μg / mL, 0.05 μg / mL, 0.025 μg / mL, 0.0125 μg / mL, 0.063 μg / mL, and 0.032 μg / mL. The sample group was the above-mentioned diluted fibronectin, and the blank control group used DMEM basal medium, with 3 replicates per group. Fibroblasts were seeded in 96-well plates one day in advance, with 2000 cells seeded per well. The outer circle wells were not seeded with cells, and PBS was added to prevent the internal culture medium from drying out. After inoculation, the cells were incubated in a 37°C incubator overnight. Each group of cells was added with a series of diluted fibronectin and DMEM basal medium and cultured for 48 hours. After 48 hours, the culture medium of each well was removed, and the cells were washed three times with PBS. The culture medium containing 10% CCK-8 was added and the cells were incubated in a 37°C cell culture incubator for another 2 hours. The absorbance at 450 nm was measured using a microplate reader. Figure 5 As shown, with the increase of fibronectin concentration, the proliferation activity of fibroblasts gradually increased.

[0063] Example 7 Fibronectin promotes fibroblast migration: In a 24-well plate, the experimental group used 10 μg / mL fibronectin prepared in Example 2 to coat the plate for 2 hours, and the negative control group used DMEM without fibronectin to coat the plate. After coating each well, a marker was used to draw even horizontal lines on the back of the 12-well plate with a ruler. Fibroblasts in the logarithmic growth phase were digested and counted, and 3×10 cells were plated in each well. 5After the cells were adhered to the plate and the confluence reached 100%, the next day, a 200 μl pipette tip was used to scratch the cells straight along the horizontal line at the bottom of the plate. After scratching, the cells were cleared three times with PBS, 1 ml of complete culture medium was added, and the cells were cultured at 37°C. The cells were observed and photographed at 0 h, 6 h, and 24 h. Figure 6 As shown, the area of ​​the middle scratch of fibroblasts added with fibronectin-coated well plates was significantly reduced over time, and their wound healing speed was faster than that of fibroblasts added with no fibronectin-coated well plates.

[0064] The nucleotide sequence of SEQ ID NO.7 is as follows: Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the above embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the above embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A method for preparing fibronectin, characterized in that: The method comprises using HEK-293T cells to express fibronectin, and using AGRN protein signal peptide as the signal peptide of fibronectin.

2. The preparation method according to claim 1, wherein The amino acid sequence of the AGRN protein signal peptide is shown in SEQ ID NO.

1.

3. The preparation method according to claim 2, wherein The nucleotide sequence encoding the AGRN protein signal peptide is shown in SEQ ID NO.

2.

4. The preparation method according to any one of claims 1 to 3, characterized in that The preparation method comprises allowing HEK-293T cells to express a polynucleotide, wherein the polynucleotide sequentially contains a sequence encoding an AGRN protein signal peptide and a sequence encoding fibronectin from the 5' end to the 3' end; Optionally, the preparation method comprises: introducing the polynucleotide into HEK-293T cells, culturing the HEK-293T cells, and allowing the HEK-293T cells to express fibronectin.

5. A polynucleotide, characterized in that The polynucleotide sequentially contains a sequence encoding an AGRN protein signal peptide and a sequence encoding fibronectin from the 5' end to the 3' end.

6. The polynucleotide according to claim 5, wherein The amino acid sequence of the AGRN protein signal peptide is shown in SEQ ID NO.1; Alternatively, the polynucleotide sequence encoding the AGRN protein signal peptide is shown in SEQ ID NO.2; Optionally, the nucleotide sequence encoding fibronectin is shown as SEQ ID NO.

7.

7. A carrier, characterized in that The vector carries the polynucleotide according to claim 5 or 6.

8. Recombinant HEK-293T cells, characterized in that The recombinant HEK-293T cells carry the polynucleotide of claim 5 or 6, or contain the vector of claim 7.

9. Use of the method for preparing fibronectin according to any one of claims 1 to 4, or the fibronectin prepared by the method according to any one of claims 1 to 4, or the polynucleotide according to claim 5 or 6, or the vector according to claim 7, or the recombinant HEK-293T cells according to claim 8 in any one of (i) to (iii): (i) Use in promoting fibroblast adhesion, proliferation and / or migration for non-diagnostic and therapeutic purposes; (ii) use in the preparation of a product for promoting fibroblast adhesion, proliferation and / or migration; (iii) use in the preparation of products for tissue regeneration or wound healing; Optionally, the (i) is an application in promoting fibroblast adhesion, proliferation and / or migration in vitro.

10. Use of the method for preparing fibronectin according to any one of claims 1 to 4, or the fibronectin prepared by the method according to any one of claims 1 to 4, or the polynucleotide according to claim 5 or 6, or the vector according to claim 7, or the recombinant HEK-293T cells according to claim 8 in preparing tissue engineering materials, wound repair materials, drug delivery preparations, or stem cell culture preparations.

Images