Screening method of high-glycerol-yield saccharomyces cerevisiae

The high osmotic treatment method is used to screen brewer's yeast, which solves the problem of time-consuming and labor-intensive screening of high-yield glycerol brewer's yeast in the existing technology, and realizes the rapid screening of high-efficiency glycerol brewer's yeast, which is applied to rice wine brewing and food production to improve product quality.

CN120591118APending Publication Date: 2025-09-05KUAIJISHAN SHAOXING WINE CO LTD
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510609443.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-13
Publication Date
2025-09-05

AI Technical Summary

Technical Problem

Existing methods for screening high-glycerol-yielding brewer's yeast strains are time-consuming and labor-intensive, making it difficult to screen out strains that can efficiently synthesize glycerol in a short period of time. In addition, strains obtained by genetic modification methods have limited application in the traditional food industry.

Method used

Saccharomyces cerevisiae was screened using hypertonic treatment (glucose concentration exceeded 200 g/L). High-glycerol-yielding Saccharomyces cerevisiae was rapidly screened through gradient dilution of liquid and solid culture media, colony plating, liquid culture, and HPLC determination of glycerol content.

Benefits of technology

The screening time for high-yield glycerol strains is shortened, and the screened strains are used for rice wine brewing, improving the taste and aroma of the wine, enhancing the drinking experience, and can also be used in the production of other foods.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120591118A_ABST
    Figure CN120591118A_ABST
Patent Text Reader

Abstract

The invention discloses a screening method of high-yield glycerol saccharomyces cerevisiae, and belongs to the technical field of microorganisms. The screening method comprises the following steps: (1) respectively preparing a liquid culture medium containing 200-350g / L of glucose and a solid culture medium containing 200-350g / L of glucose; (2) inoculating fermented mash in a fermentation stage after yellow wine brewing into a liquid culture medium, and culturing; then carrying out gradient dilution on the culture solution to obtain a bacterial suspension; coating the bacterial suspension on a flat plate of a solid culture medium, and standing and culturing; (3) picking bacterial colonies from the solid culture medium, inoculating the bacterial colonies into a liquid culture medium, and culturing to complete strain activation; inoculating the activated strain into a new liquid culture medium for culturing and fermenting; taking fermentation liquor, determining the content of glycerol by adopting a high performance liquid chromatography, and screening to obtain the high-yield glycerol strain. According to the invention, strains for efficiently synthesizing glycerol can be screened in a short time, and the workload of screening high-yield glycerol strains is effectively reduced.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of microbial technology, and more particularly to a method for screening high-glycerol-yielding brewer's yeast. Background Art

[0002] Glycerol, also known as propanetriol, is widely used in industry, medicine, and daily life. Currently, common methods for producing glycerol include natural oil byproduct production and chemical synthesis. The former is obtained through the decomposition and concentration of oils, while the latter is synthesized through the alkaline hydrolysis reaction of propylene and epichlorohydrin. However, both methods are energy-intensive.

[0003] In contrast, the biosynthesis method synthesizes glycerol through microbial metabolism, among which the yeast fermentation method is particularly outstanding. At present, the screening of high-yield glycerol brewer's yeast is mainly carried out in two ways. One is the traditional plate screening method, which is identified by chromatography or colorimetry; the other is the molecular biology method, which is screened by traditional mutagenesis breeding or strengthening the glycerol synthesis metabolic pathway. However, both methods require facing a large number of screening processes (among which the mutagenesis breeding method has a large number of false positive strains), and verifying the ability of each strain to synthesize glycerol one by one, which is time-consuming and laborious, and it is difficult to screen out strains that efficiently synthesize glycerol in a short time. There is also a method to obtain high-yield glycerol strains through genetic modification, but the high-yield glycerol strains obtained by this method cannot be used in the traditional food industry. Summary of the Invention

[0004] The purpose of the present invention is to overcome the deficiencies of the above-mentioned prior art and provide a method for screening high-yield glycerol brewer's yeast, which can screen out strains that efficiently synthesize glycerol in a short period of time and effectively reduce the workload of screening high-yield glycerol strains.

[0005] In order to achieve the above object, the present invention adopts the following technical solutions:

[0006] A method for screening high-yield glycerol brewer's yeast comprises the following steps:

[0007] (1) preparing a liquid culture medium containing 200-350 g / L glucose and a solid culture medium containing 200-350 g / L glucose respectively;

[0008] (2) taking fermented mash from the post-fermentation stage of rice wine brewing and inoculating it into a liquid culture medium for cultivation; then gradiently diluting the culture medium to obtain a bacterial suspension; spreading the bacterial suspension on a plate of solid culture medium and culturing it statically;

[0009] (3) Picking colonies from the solid culture medium and inoculating them into the liquid culture medium for cultivation to complete the activation of the strain; inoculating the activated strain into a new liquid culture medium for cultivation and fermentation; taking the fermentation liquid, and determining the glycerol content by high performance liquid chromatography to screen out high glycerol-yielding strains.

[0010] The present invention is further configured as follows: in step (1), the composition of the liquid culture medium is: glucose 200-350g / L, 20

[0011] g / L peptone, 5g / L yeast powder, and the balance is distilled water.

[0012] The present invention is further configured such that, in step (1), the solid culture medium is composed of: 200-350 g / L glucose, 20 g / L peptone, 5 g / L yeast powder, and the balance is distilled water.

[0013] The present invention is further configured such that, in step (2), the fermentation mash is inoculated at a ratio of 100 mL of liquid culture medium to 1 mL of fermentation mash, and after inoculation, the fermentation mash is statically cultured at 28° C. for 24 hours.

[0014] The present invention is further configured as follows: in step (2), the culture fluid is diluted 10 times with sterile saline having a concentration of 0.9 wt%, and the sample is diluted 10 times in a gradient manner. -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -5 , 10 -7 , 10 -8 , 10 -9 times.

[0015] The present invention is further configured such that, in step (2), the bacterial suspension is spread on a plate of solid culture medium and then cultured at 28° C. for 24 hours.

[0016] The present invention is further configured such that, in step (3), colonies are picked from the solid culture medium and inoculated into the liquid culture medium, and then cultured at a constant temperature of 28° C. for 24 hours.

[0017] The present invention is further configured such that, in step (3), the inoculation amount of the activated bacteria in the liquid culture medium is 1%.

[0018] The present invention is further configured such that, in step (3), the activated bacteria are inoculated and then cultured and fermented at a constant temperature of 28° C. for 5 days.

[0019] In summary, the present invention has the following beneficial effects:

[0020] Through the hypertonic treatment method (glucose concentration in the culture medium exceeds 200g / L), high-glycerol brewing yeast is quickly screened out, which reduces the heavy workload in the existing high-glycerol strain screening process and shortens the screening time of high-glycerol strains; the high-glycerol strains obtained by screening are used in rice wine brewing, which can improve the taste, stability and aroma of the wine and enhance the overall drinking experience. It can also be used in the production of other foods to improve food flavor. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is the colony map of the four strains of Saccharomyces cerevisiae screened in Example 1;

[0022] Figure 2 This is a transmission electron micrograph of the Saccharomyces cerevisiae KJS-G2 screened in Example 1;

[0023] Figure 3 This is the evolutionary tree constructed in Example 1. DETAILED DESCRIPTION

[0024] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0025] The screening method for high-yield glycerol brewer's yeast of the present invention comprises the following steps:

[0026] (1) Prepare liquid culture medium (the composition of liquid culture medium is: 200-350 g / L glucose, 20 g / L peptone, 5 g / L yeast powder, and the balance is distilled water), and sterilize it at 105°C with high pressure steam for 30 min; prepare solid culture medium (the composition of solid culture medium is: 200-350 g / L glucose, 20 g / L peptone, 5 g / L yeast powder, 20 g / L agar, and the balance is distilled water), and sterilize it at 105°C with high pressure steam for 30 min.

[0027] (2) Take 1 mL of fermented mash (taken from the fermentation stage after rice wine brewing, the abundance of brewer's yeast in the fermented mash is more than 90%) and inoculate it into 100 mL of liquid culture medium, and culture it at 28°C overnight (24 h); take the culture medium and dilute it with 0.9 wt% sterile saline in 10-fold gradients, and the sample is diluted 10 times in a gradient. -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -5 , 10 -7 , 10-8 , 10 -9 times to obtain a bacterial suspension; 0.1 mL of the bacterial suspension was spread on a plate of solid culture medium, incubated at 28°C for 24 h, and the growth of the colonies was observed.

[0028] (3) Pick colonies from the solid culture medium and inoculate them into liquid culture medium, and culture them at a constant temperature of 28°C for 24 hours to activate the strain; then fill 200 mL of liquid culture medium into a 500 mL conical flask, sterilize it and inoculate the activated strain (inoculation amount is 1%), and culture and ferment it at a constant temperature of 28°C for 5 days (to ensure the stability of the strain, the fermentation culture was repeated three times according to this method); take the fermentation broth and determine its glycerol content by high performance liquid chromatography (the processing method of the fermentation broth sample to be tested is: centrifuge 40 g of the fermentation broth sample at 8000 rpm for 10 minutes, take 2 mL of the supernatant and filter it through a 0.45 μm filter membrane for later use. The chromatographic conditions are: analytical column: Hypersil NH2 column, 250 mm×4.6 mm, particle size 5 μm; flow rate: 1.0 mL / min; eluent: acetonitrile-water solution (acetonitrile: water = 70:30, V / V); column temperature: 40°C) to obtain a high-yield glycerol strain.

[0029] Example 1

[0030] Taking the fermentation mash on the 20th day of the post-fermentation stage of rice wine brewing as an example (tests showed that the abundance of cerevisiae in the fermentation mash fungi reached 92.52%), the fermentation mash on the 20th day of the handmade wine jar was taken and strain screening was carried out according to the above method (both the liquid culture medium and the solid culture medium contained 350 g / L of glucose). Finally, four high-yield glycerol strains were screened out, which were named KJS-G1, KJS-G2, KJS-G3, and KJS-G4 respectively; the colony growth of the four strains is shown in Figure 2. Figure 1 , transmission electron microscopy of strain KJS-G2 Figure 2 .

[0031] The fermented mash of this embodiment was taken from the following existing yellow rice wine brewing process:

[0032] (a) soaking rice, steaming rice, and cooling rice: Weigh rice and soak it in water at room temperature for 48 hours, with the water exceeding the rice surface by 5 to 6 cm; drain the rice and steam the rice; during the steaming process, check the quality of the rice and adjust the steam volume as needed to ensure that the rice grains are soft, cooked but not mushy, and have no white core; then cool the steamed rice to 28° C.

[0033] (b) Blanking: Mix the cooked rice, yeast, malt koji, and water evenly (the mass ratio of cooked rice to yeast, malt koji, and water is 150:8.5:15:120). The blanking temperature is controlled at 28°C.

[0034] (c) Fermentation: Pre-fermentation is carried out at 28°C for 48 hours. During the pre-fermentation period, the fermentation product is stirred 2-3 times a day with an interval of 8-10 hours between each fermentation. The fermentation product temperature is controlled not to exceed 32°C.

[0035] (d) Post-fermentation: After the pre-fermentation, the temperature was lowered to 15° C., and the pre-fermentation mash was pumped into a fermentation tank and post-fermented at 15° C. for 90 days (the fermentation mash used in Example 1 was taken from the 20th day of the post-fermentation stage).

[0036] The glycerol content in the fermentation broth of the four strains was determined by high-performance liquid chromatography, as shown in Table 1. (The wine sample reference in Table 1 is the finished rice wine brewed using the above-mentioned existing rice wine brewing method. The wine sample processing method for testing is as follows: the wine sample is first filtered through filter paper, and then the clear liquid is filtered through a 0.45μm filter membrane. If the wine sample is clear and not turbid, it can be directly filtered through a 0.45μm filter membrane.) As shown in Table 1, among the four strains screened from the rice wine fermentation mash, the glycerol content of three of the Saccharomyces cerevisiae strains exceeded 3.9g / L, with the highest reaching 4.69g / L.

[0037] Table 1 Glycerol yield of screened strains in rice wine fermentation mash

[0038] Test samples Glycerol content (g / L) Strain KJS-G1 fermentation broth 3.6 Strain KJS-G2 fermentation broth 4.69 Strain KJS-G3 fermentation broth 4.40 Strain KJS-G4 fermentation broth 3.96 Wine sample reference 1.43

[0039] The four selected strains were sent to Hefei Baiteng Biotechnology Co., Ltd. for fungal ITS sequence sequencing. Subsequently, the sequencing results were compared with the ITS sequences of Saccharomyces cerevisiae CBS1171 and Saccharomyces cerevisiae CJZ127, Candida parachauliodes CBS, Saccharomycopsis fibuligera, Wickerhamomyces anomalus CICC33314, Yarrowia lipolytica CBS 6124, and Clavispora lusitaniae CBS 6936 in the NCBI database, and the phylogenetic tree was constructed using the evolutionary analysis software Mega11 (the constructed phylogenetic tree is shown in Figure 5). Figure 3 As shown in the figure, it was confirmed that the four strains (KJS-G1, KJS-G2, KJS-G3, and KJS-G4) were all Saccharomyces cerevisiae.

[0040] The nucleotide sequences of the four screened strains, Saccharomyces cerevisiae CBS1171, Saccharomyces cerevisiae CJZ127, Candida parachauliodes CBS, Saccharomycopsis fibuligera, Wickerhamomyces anomalus CI CC33314, Yarrowia lipolytica CBS 6124, and Clavispo ra lusitaniae CBS 6936, are shown in SEQ ID NOs. 1 to 11:

[0041] (1)SEQ ID NO.1 (Saccharomyces cerevisiae KJS-G1):

[0042] CGGAAGGATCATTAAAGAAATTTAATAATTTTGAAATGGATTTTTTTGTTTTGGCA

[0043] AGAGCATGAGAGCTTTTACTGGGCAAGAAGACAAGAGATGGAGAGTCCAGCCGGG

[0044] CCTGCGCTTAAGTGCGCGGTCTTGCTAGGCTTGTAAGTTTCTTTCTTGCTATTCCAAA

[0045] CGGTGAGAGATTTCTGTGCTTTTGTTATAGGACAATTAAAACCGTTTCAATACAACA

[0046] CACTGTGGAGTTTCATATCTTTGCAACTTTTTCTTTGGGCATTCGAGCAATCGGGG

[0047] CCCAGAGGTAACAAACACAAACAATTTTATTTATTCATTAAATTTTTGTCAAAAACA

[0048] AGAATTTTCGTAACTGGAAATTTTAAAATATTAAAAACTTTCAACAACGGATCTCTT

[0049] GGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGA

[0050] ATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCAGGGGG

[0051] CATGCCTGTTTGAGCGTCATTTCCTTCTCAAACATTCTGTTTGGTAGTGAGTGATACT

[0052] CTTTGGAGTTAACTTGAAATTGCTGGCCTTTTCATTGGATGTTTTTTTTCCAAAGAGA

[0053] GGTTTCTCTGCGTGCTTGAGGTATAATGCAAGTACGGTCGTTTTAGGTTTTACCAAC

[0054] TGCGGCTAATCTTTTTTATACTGAGCGTATTGGAACGTTATCGATAAGAAGAGAGCG

[0055] TCTAGGCGAACAATGTTC

[0056] (2)SEQ ID NO.2(Saccharomyces cerevisiae KJS-G2):

[0057] GGAAGGATCATTAAAGAAATTTAATAATTTTGAAAATGGATTTTTTTGTTTTGGCAA

[0058] GAGCATGAGAGCTTTTACTGGGCAAGAAGACAAGAGATGGAGAGTCCAGCCGGGC

[0059] CTGCGCTTAAGTGCGCGGTCTTGCTAGGCTTGTAAGTTTCTTTCTTGCTATTCCAAAC

[0060] GGTGAGAGATTTCTGTGCTTTTGTTATAGGACAATTAAAACCGTTTCAATACAACAC

[0061] ACTGTGGAGTTTTCATATCTTTGCAACTTTTTCTTTGGGCATTCGAGCAATCGGGGC

[0062] CCAGAGGTAACAAACACAAACAATTTTATCTATTCATTAAATTTTTGTCAAAAACAA

[0063] GAATTTTCGTAACTGGAAATTTTAAAATATTAAAAACTTTCAACAACGGATCTCTTG

[0064] GTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAA

[0065] TTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCAGGGGGC

[0066] ATGCCTGTTTGAGCGTCATTTCCTTCTCAAACATTCTGTTTGGTAGTGAGTGATACTC

[0067] TTTGGAGTTAACTTGAAATTGCTGGCCTTTTCATTGGATGTTTTTTTTCCAAAGAGAG

[0068] GTTTCTCTGCGTGCTTGAGGTATAATGCAAGTACGGTCGTTTTAGGTTTTACCAACT

[0069] GCGGCTAATCTTTTTTTATACTGAGCGTATTGGAACGTTATCGATAAGAAGAGAGCG

[0070] TCTAGGCGAACAATGTTCTTAAAGTTGACCTCAAATCAGGTAGGAGTACCCGCTGA

[0071] ACTTAAGCATAT

[0072] (3)SEQ ID NO.3(Saccharomyces cerevisiae KJS-G3):

[0073] AACCTGCGGAAGGATCATTAAAGAAATTTAATAATTTTGAAAATGGATTTTTTTGTT

[0074] TTGGCAAGAGCATGAGAGCTTTTACTGGGCAAGAAGACAAGAGATGGAGAGTCCA

[0075] GCCGGGCCTGCGCTTAAGTGCGCGGTCTTGCTAGGCTTGTAAGTTTCTTTCTTGCTA

[0076] TTCCAAACGGTGAGAGATTTCTGTGCTTTTGTTATAGGACAATTAAAACCGTTTCAA

[0077] TACAACACACTGTGGAGTTTTCATATCTTTGCAACTTTTTCTTTGGGCATTCGAGCA

[0078] ATCGGGGCCCAGAGGTAACAAACACAAACAATTTTATTTATTCATTAAATTTTTGTC

[0079] AAAAACAAGAATTTTCGTAACTGGAAATTTTAAAATATTAAAAACTTTCAACAACG

[0080] GATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGA

[0081] ATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATT

[0082] CCAGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACATTCTGTTTGGTAGTG

[0083] AGTGATACTCTTTGGAGTTAACTTGAAATTGCTGGCCTTTTCATTGGATGTTTTTTTT

[0084] CCAAAGAGAGGTTTCTCTGCGTGCTTGAGGTATAATGCAAGTACGGTCGTTTTAGGT

[0085] TTTACCAACTGCGGCTAATCTTTTTTATACTGAGCGTATTGGAACGTTATCGATAAG

[0086] AAGAGAGCGTCTAGGCGAACAATGTTCTTAAAGTTTGACCTCAAATCAGGTAGGAG

[0087] TACCCGCTGAACTTAAG

[0088] (4)SEQ ID NO.4(Saccharomyces cerevisiae KJS-G4):

[0089] AAGAATTTTAATTTGAAAATGGATTTTTTTGTTTTGGCAAGAGCATGAGAGCT

[0090] TTTACTGGGCAAGAAGACAAGAGATGGAGAGTCCAGCCGGGCCTGCGCTTAAGTGC

[0091] GCGGTCTTGCTAGGCTTGTAAGTTTCTTTCTTGCTATTCCAAACGGTGAGAGATTTCT

[0092] GTGCTTTTGTTATAGGACAATTAAACCGTTTCAATACAACACACTGTGGAGTTTTC

[0093] ATATCTTTGCAACTTTTTCTTTGGGCATTCGAGCAATCGGGGCCCAGAGGTAACAAA

[0094] CACAAACAATTTTATTCATTAAATTTGTCAAAAACAAGAATTTTCGTAACT

[0095] GGAAATTTTAAAATTAAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGAT

[0096] GAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATC

[0097] GAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCAGGGGGCATGCCTGTTTGAGC

[0098] GTCATTTCCTTCTCAAACATTCTGTTTGGTAGTGAGTGATACTCTTTGGAGTTAACTT

[0099] GAAATTGCTGGCCTTTTCATTGGATGTTTTTTTTCCAAAGAGAGGTTTCTCTGCGTGC

[0100] TTGAGGTATAATGCAAGTACGGTCGTTTTAGGTTTTACCAACTGCGGCTAATCTTTT

[0101] TTATACTGAGCGTATTGGAACGTTATCGATAAGAAGAGAGCGTCTAGGCGAACAAT

[0102] GTTCTTAAAG

[0103] (5)SEQ ID NO.5(Saccharomyces cerevisiae CBS 1171):AAAGAAATTTAATAATTTTGAAAATGGATTTTTTTGTTTTGGCAAGAGCATGAGAGCTTTTACTGGGCAAGAAGACAAGAGATGGAGAGTCCAGCCGGGCCTGCGCTTAAGTGCGCGGTCTTGCTAGGCTTGTAAGTTTCTTTCTTGCTATTCCAAACGGTGAGAGATTTCTGTGCTTTTGTTATAGGACAATTAAAACCGTTTCAATACAACACACTGTGGAGTTTTCATATCTTTGCAACTTTTTCTTTGGGCATTCGAGCAATCGGGGCCCAGAGGTAACAAACACAAACAATTTTATCTATTCATTAAATTTTTGTCAAAAACAAGAATTTTCGTAACTGGAAATTTTAAAAATATTAAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCCCCCTTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACATTCTGTTTGGTAGTGAGTGATACTCTTTGGAGTTAACTTGAAATTGCTGGCCTTTTCATTGGATGTTTTTTTTCCAAAGAGAGGTTTCTCTGCGTGCTTGAGGTATAATGCAAGTACGGTCGTTTTAGGTTTTACCAACTGCGGCTAATCTTTTTTATACTGAGCGTATTGGAACGTTATCGATAAGAAGAGAGCGTCTAGGCAACAATGTTCTTAAAGT

[0104] (6)SEQ ID NO.6(Saccharomyces cerevisiae CJZ127):

[0105] CAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAAAGAAATTTAATAATTTTG

[0106] AAAATGGATTTTTTTTGTTTTGGCAAGAGCATGAGAGCTTTTACTGGGCAAGAAGAC

[0107] AAGAGATGGAGAGTCCAGCCGGGCCTGCGCTTAAGTGCGCGGTCTTGCTAGGCTTG

[0108] TAAGTTTCTTTCTTGCTATTCCAAACGGTGAGAGATTTCTGTGCTTTTGTTATAGGAC

[0109] AATTAAACCGTTTCAATACAACACACTGTGGAGTTTTCATATCTTTGCAACTTTTT

[0110] CTTTGGGCATTCGAGCAATCGGGGCCCAGAGGTAACAAACACAAACAATTTTATTT

[0111] ATTCATTAAATTTTTGTCAAAAACAAGAATTTTCGTAACTGGAAATTTTAAAATATT

[0112] AAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAA

[0113] TGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCAC

[0114] ATTGCGCCCCTTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAA

[0115] ACATTCTGTTTGGTAGTGAGTGATACTCTTTGGAGTTAACTTGAAATTGCTGGCCTT

[0116] TTCATTGGATGTTTTTTTTCCAAAGAGAGGTTTCTCTGCGTGCTTGAGGTATAATGC

[0117] AAGTACGGTCGTTTTAGGTTTTACCAACTGCGGCTAATCTTTTTTACTGAGCGTA

[0118] TTGGAACGTTATCGATAAGAAGAGAGCGTCTAGGCGAACAATGTTCTTAAAGTTTG

[0119] ACCTCAAATCAGGTAGGAGTACCCGCTGAACTTAA

[0120] (7)SEQ ID NO.7(Candidaparachauliodes CBS):

[0121] AAGGATCATTACAGATTAGAGAAGCTTAACTGCTTTTTCTTACACATGTGTTTTTTCT

[0122] TTTTGAAAAATTACTTTGGTAGTGAAGCTAAACACTTTGCTGCCAGAGACTAAACTT

[0123] AACCAAACTTTTTATTAATAGTCAACAAGAAATCTAATAGTTAAAACTTTCAACAAC

[0124] GGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATGCGATAAGTAATATG

[0125] AATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCTTTTGGTAT

[0126] TCCAGAAGGCATGCCTGTTTGAGCGTCATTTCTCCTTCAAACCCTTGGGTTTGGTGT

[0127] TGAGCAAGACCTCGAGTTTGCTTGAAAGATAATTAGTTTTTACAAAGGATAGGTGT

[0128] AACCAAATCTTTGATACAAAGACTATTTGAATTTCCAAATTCGACCTCAAATCAGGT

[0129] AGGACTACCCGCTGAACTTAA

[0130] (8)SEQ ID NO.8(Wickerhamomyces anomalus CICC33314):ATTTGAAATCTAGCACCTTCGGTGTTCGAGTTGTAATTTGAAGATGGTAACCTTGGGTTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTGATGAGATGCCCATTCCTATGTAAGGTGCTATCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAA AGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTAGATCAGACTTGGTGTTTTACGATTATCTTCTCTTCTTGAGTTGTGCACTCGTATTTCACTGGGCCAGCATCGATTCGGATGGCAAGATAATGGCAGTTGAATGTGGCTTCACTTCGGTGGAGTGTTATAGCTTCTGCTGATATTGCCTGTCTGGATCGAGGGCTGCGTCTTTTGACTAGGATGCTGGCGTAATGATCTAATGCCGCCCGTCTT

[0131] (9)SEQ ID NO.9(Saccharomycopsisfibuligera):

[0132] CGCAGGTCTAAACAAATAACATTAATGATCCTTCCGTAGGGTGAACCTGCGGAA

[0133] GGATCATTAATGTTATTTGTTTTTAGACCTGCGCTTAACTGCGCGGTTTAATAAACT

[0134] CTTATACACAGTGTTTTTGTTTGCGAATTTGGTTTAGTTTGTTGGTTTTCATTCGAAA

[0135] GGATGAAGATTGATTGCTAAATCTTATTCAGCTTTTTAAACTCAGATCTCTTTTTAA

[0136] GAGAAATGTATTTTTTTAATTCAACTAGTCGATTTTACAAACTAAAAGTTTAAAAC

[0137] TTTCAGCAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGAT

[0138] AAGTAATGTGAATTGCAGATTTTCGTGAATCATCGAATCTTTGAACGCATATTGCGC

[0139] TCTATAGTATTCTATAGAGCATGCCTGTTTGAGCGTCATTTCTCTCTTAAACCTTTGG

[0140] GTTTAGTATTGAAGGTTGTGTTTAGCTTCTGCTAACTCCTTTGAAATGACTTGGCAAT

[0141] TGATTGAGTTTTCCATATATTTGCTTAAGGATTTAATATTAGGTTCTACCACTTATT

[0142] AAATACCCTTTTGCGAAGGACTTACTCGTGTATCAAGGCCTTATAACTTTGTCATTA

[0143] ATTTTGACCTCCAAATCAGGTAAGGATACCCGCTGAACTTAAGCATATCAATAA

[0144] (10)SEQ ID NO.10(Yarrowia lipolytica CBS 6124):

[0145] GATCATTATTGATTTTATCTATTCTGTGGATTTCTGGTATATTACAGCGTCATTTTTA

[0146] TCTCAATTATAACTATCAACAACGGATCTCTTGGCTCTCACATCGATGAAGAACGCA

[0147] GCGAACCGCGATATTTTTTGTGACTTGGCAGATGTGAATCATCAATCTTTGAACGCAC

[0148] ATTGCGCGGTATGGTATTCCGTACCGCACGGATGGAGGAGCGTGTTCCCTCTGGGA

[0149] TCGCATTGCTTTCTTGAAATGGATTTTTTTAAACTCTCAATTATTACGTCATTTCACC

[0150] TCCTTCATCCGAGATTACCCGCTGAACTTAA

[0151] (11)SEQ ID NO.11(Clavispora lusitaniae CBS 6936):

[0152] GATCATTAAAAAAAATTATACACACTGTTTTTGCGAACAAAAAAATAAATCTTTTAT

[0153] TCGAATTTCTTAATATCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATG

[0154] AAGAACGCAGCGAATTGCGATACGTAGTATGACTTGCAGACGTGAATCATCGAATC

[0155] TTTGAACGCACATTGCGCCTCGAGGCATTCCTCGAGGCATGCCTGTTTGAGCGTCGC

[0156] ATCCCCTCTAACCCCCGGTTAGGCGTTGCTCCGAAATATCAACCGCGCTGTCAAACA

[0157] CGTTTACAGCACGACATTTCGCCCTCAAATCAGGTAGGACTACCCGCTGAACTTAA

[0158] For Comparative Example 1, screening was carried out using an existing yeast isolation medium.

[0159] A liquid culture medium was prepared (the composition of the liquid culture medium was: 20 g / L glucose, 20 g / L peptone, 5 g / L yeast powder, and the balance was distilled water), and sterilized by high-pressure steam at 105°C for 30 min. A solid culture medium was prepared (the composition of the solid culture medium was: 20 g / L glucose, 20 g / L peptone, 5 g / L yeast powder, 20 g / L agar, and the balance was distilled water), and sterilized by high-pressure steam at 105°C for 30 min. Strain screening was then performed according to the method of Example 1.

[0160] After testing, 6 strains were screened out in this comparative example, which were respectively recorded as KJS-G01, KJS-G02, KJS-G03, KJS-G04, KJS-G05, and KJS-G06. The glycerol content in the fermentation broth of the 6 strains is shown in Table 2. By comparing the glycerol content of Example 1 and Comparative Example 1, it can be seen that the screening method of the present invention successfully screened out high-glycerol-yielding Saccharomyces cerevisiae.

[0161] Table 2

[0162] sample Glycerol (g / L) KJS-G01 fermentation broth 0 KJS-G02 fermentation broth 1.09 KJS-G03 fermentation broth 0.56 KJS-G04 fermentation broth 0.58 KJS-G05 fermentation broth 0.96 KJS-G06 fermentation broth 0.71

[0163] The high-yield glycerol brewer's yeast KJS-G1, KJS-G2, KJS-G3, and KJS-G4 screened in this example were expanded [the expansion method was as follows: a single clone of the high-yield glycerol brewer's yeast strain was selected and transferred to a test tube containing 200 mL of saccharification liquid for overnight culture, and then 200 mL of the first-stage expansion culture liquid was transferred to 10 L of saccharification liquid and cultured at 28°C for 24 h. The saccharification liquid preparation method is as follows: rice: water = 1:4 (m / v) ratio is mixed, liquefaction enzyme accounting for 1‰ of the mass of rice and saccharification enzyme accounting for 1‰ of the mass of rice are added, saccharification is carried out at 60°C until the apparent sugar content is 12°Brix, filtering through gauze, and sterilizing at 115°C for 20 min. The expansion liquid is used as the yeast and the rice wine is brewed according to the existing rice wine brewing method described in Example 1 (that is, the existing yeast is replaced with the expansion liquid of the high-yield glycerol brewing yeast screened in this example). The glycerol content in the four finished rice wines is measured to be 4.30g / L, 6.08g / L, 5.74g / L, and 5.75g / L, respectively, which are all greater than the wine sample control (glycerol content is 1.43g / L), which can improve the taste, stability and aroma of the wine and enhance the overall drinking experience.

[0164] Experimental verification shows that the fermented mash used in the present invention is not limited to the brewing method described in Example 1. The fermented mash in the post-fermentation stage of other existing brewing methods (such as the method described in the patent with publication number CN105754794A, etc.) can also be used to screen out high-glycerol brewing yeast according to the screening method of the present invention.

[0165] The above description is merely a preferred embodiment of the present invention. The scope of protection of the present invention is not limited to the above embodiment. All technical solutions based on the concept of the present invention are within the scope of protection of the present invention. It should be noted that for those skilled in the art, various improvements and modifications that do not depart from the principles of the present invention should also be considered within the scope of protection of the present invention.

Claims

1. A method for screening high-yield glycerol brewer's yeast, characterized in that: The following steps are involved: (1) preparing a liquid culture medium containing 200-350 g / L glucose and a solid culture medium containing 200-350 g / L glucose respectively; (2) taking fermented mash from the post-fermentation stage of rice wine brewing and inoculating it into a liquid culture medium for cultivation; then gradiently diluting the culture medium to obtain a bacterial suspension; spreading the bacterial suspension on a plate of solid culture medium and culturing it statically; (3) Picking colonies from the solid culture medium and inoculating them into the liquid culture medium for cultivation to complete the activation of the strain; inoculating the activated strain into a new liquid culture medium for cultivation and fermentation; taking the fermentation liquid, and determining the glycerol content by high performance liquid chromatography to screen out high glycerol-yielding strains.

2. The method for screening a high-yield glycerol brewer's yeast according to claim 1, characterized in that: In step (1), the composition of the liquid culture medium is: 200-350 g / L glucose, 20 g / L peptone, 5 g / L yeast powder, and the balance is distilled water.

3. The method for screening a high-yield glycerol brewer's yeast according to claim 1, characterized in that: In step (1), the composition of the solid culture medium is: 200-350 g / L glucose, 20 g / L peptone, 5 g / L yeast powder, and the balance is distilled water.

4. The method for screening a high-yield glycerol brewer's yeast according to claim 1, characterized in that: In step (2), the fermentation mash is inoculated at a ratio of 100 mL of liquid culture medium to 1 mL of fermentation mash, and after inoculation, the mixture is statically cultured at 28° C. for 24 h.

5. The method for screening a high-yield glycerol brewer's yeast according to claim 1, characterized in that: In step (2), the culture medium was diluted 10 times with sterile saline at a concentration of 0.9 wt%, and the sample was diluted 10 times in a gradient manner. -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -5 , 10 -7 , 10 -8 , 10 -9 times.

6. The method for screening a high-yield glycerol brewer's yeast according to claim 1, characterized in that: In step (2), the bacterial suspension is spread on a plate of solid culture medium and then incubated at 28° C. for 24 h.

7. The method for screening a high-yield glycerol brewer's yeast according to claim 1, characterized in that: In step (3), colonies were picked from the solid culture medium and inoculated into the liquid culture medium, and then cultured at a constant temperature of 28° C. for 24 h.

8. The method for screening a high-yield glycerol brewer's yeast according to claim 1, characterized in that: In step (3), the inoculation amount of the activated bacteria in the liquid culture medium is 1%.

9. The method for screening a high-yield glycerol brewer's yeast according to claim 1, characterized in that: In step (3), the activated strain is inoculated and cultured and fermented at a constant temperature of 28° C. for 5 days.

Citation Information

Patent Citations

  • Method for brewing rice wine

    CN105754794A