Application of HAX1 inhibitor in preparation of medicine for treating TSCC and application of HAX1 as target gene in treatment of TSCC
By screening HAX1 as a target for TSCC, constructing differentially expressed cell lines and verifying its role in TSCC, the problem of lack of effective targets in existing treatments was solved, more efficient TSCC treatment and diagnosis were achieved, and drug resistance and adverse reactions were reduced.
Patent Information
- Application Number
- CN202510680818.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-26
- Publication Date
- 2025-09-05
AI Technical Summary
The lack of effective molecular targets in existing TSCC treatments has resulted in limited therapeutic effects. In addition, existing targeted drugs such as cetuximab and immunotherapy have drug resistance and adverse reactions, which limit their clinical efficacy.
HAX1 was screened as a potential target through bioinformatics, and a TSCC cell line with differential HAX1 expression was constructed to verify its role in promoting TSCC cell proliferation, migration, invasion and apoptosis inhibition. Its role in the malignant progression of TSCC was also verified through animal experiments, and the RAF/MEK/ERK pathway was regulated by combining with the MAPK/ERK signaling pathway.
HAX1 is provided as a new target gene for TSCC for the preparation of therapeutic drugs, improving treatment efficacy, early diagnosis and prognosis assessment, reducing drug resistance and adverse reactions, and enhancing the precision and effectiveness of treatment.
Smart Images

Figure CN120591402A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of bioengineering, and specifically relates to the use of a HAX1 inhibitor in the preparation of a drug for treating TSCC and the use of HAX1 as a target gene in the treatment of TSCC. Background Art
[0002] Tongue squamous cell carcinoma (TSCC) is the most common pathological type of oral cancer. It is highly invasive and has a strong metastatic potential. Clinically, it often presents with local lymph node metastasis, high recurrence rates, and low long-term survival rates. According to the "Global Cancer Statistics 2020," oral cancer ranks among the most common cancers globally, and the incidence of TSCC is increasing annually, particularly among younger patients. Despite the availability of treatment options, the five-year overall survival rate remains less than 50%.
[0003] Treatment for TSCC typically depends on the tumor stage and the patient's specific condition, and includes a combination of surgical resection, radiotherapy, chemotherapy, targeted therapy, and immunotherapy. Early-stage TSCC patients can achieve a good prognosis with local resection, while advanced-stage TSCC, often accompanied by cervical lymph node metastasis and distant metastasis, carries a very poor prognosis.
[0004] In terms of molecular mechanisms, the RAF / MEK / ERK (also known as MAPK / ERK) signaling pathway is an important pathway that regulates cell proliferation, differentiation, migration, and apoptosis. It is highly active in a variety of malignant tumors and is considered to be one of the core driving mechanisms of tumor development. This pathway usually activates RAF family members (including ARAF, BRAF, and CRAF) through RAS, which in turn activates MEK1 / 2 and ERK1 / 2 in a cascade, ultimately affecting the transcriptional program in the cell nucleus. Studies have shown that the RAF / MEK / ERK pathway is also involved in the maintenance of tumor stemness, the epithelial-mesenchymal transition (EMT) process, and the regulation of the immune microenvironment in TSCC. Although MEK inhibitors targeting the MAPK pathway (such as PD98059 and Trametinib) have been used clinically to explore certain aspects, their efficacy is limited. The main reason is that the upstream regulatory mechanism is still unclear and there is a lack of suitable targets for effective blockade.
[0005] Current research on molecularly targeted therapies for TSCC primarily focuses on signaling pathways such as EGFR, PI3K / AKT / mTOR, and vascular endothelial growth factor (VEGF). Cetuximab, an EGFR inhibitor, is the first targeted drug approved by the US Food and Drug Administration (FDA) for the treatment of head and neck squamous cell carcinoma, including TSCC. Although cetuximab can delay tumor progression in some patients, the high frequency of EGFR gene mutations makes it highly likely that patients will develop primary or acquired drug resistance during treatment, limiting its clinical efficacy. Furthermore, common adverse reactions during treatment, such as rash and paronychia, also limit its use to some extent. Immunotherapy, particularly programmed death receptor-1 (PD-1) or programmed death ligand-1 (PD-L1) inhibitors such as pembrolizumab and nivolumab, has also shown the potential to prolong survival in patients with recurrent or metastatic TSCC. However, the overall response rate of this type of therapy is still unsatisfactory, the treatment cost is high, and it is easy to cause immune-related adverse reactions (such as hepatitis, pneumonia, etc.), which seriously restricts its large-scale application in clinical practice.
[0006] Clinically, there is still a lack of effective molecular classification indicators and precise treatment targets for this type of malignant solid tumors. Therefore, there is an urgent need to find new molecular targets to optimize the treatment effect of TSCC. Summary of the Invention
[0007] In order to overcome the problems existing in the background technology, the present invention uses bioinformatics to screen out a potential target of TSCC - HAX1; by constructing TSCC cell lines with differential expression of HAX1 and studying TSCC cell lines with differential expression of HAX1, it is proved that HAX1 promotes TSCC cell proliferation, promotes TSCC cell migration and invasion, inhibits TSCC cell apoptosis, enhances TSCC cell stemness and promotes TSCC-related angiogenesis; animal experiments verify that HAX1 will accelerate the malignant progression of TSCC; transcriptome sequencing is used to discover the molecular mechanism of HAX1 regulating TSCC. Based on the above research, the present invention provides the use of HAX1 as a target gene in the treatment of tongue squamous cell carcinoma.
[0008] The first object of the present invention is to provide the use of HAX1 as a target gene in the treatment of tongue squamous cell carcinoma.
[0009] The second object of the present invention is to provide use of HAX1 as a marker in the diagnosis, treatment or prognosis of tongue squamous cell carcinoma.
[0010] The third object of the present invention is to provide use of a HAX1 inhibitor in the preparation of a drug for treating tongue squamous cell carcinoma.
[0011] The fourth object of the present invention is to provide a drug for treating tongue squamous cell carcinoma, wherein the drug comprises a HAX1 inhibitor.
[0012] A fifth object of the present invention is to provide the use of HAX1 as a biomarker in the preparation of an early diagnosis kit, a prognostic risk assessment system or a molecular typing auxiliary tool for tongue squamous cell carcinoma.
[0013] The sixth object of the present invention is to provide a use of a HAX1 expression level kit in diagnosing or evaluating tongue squamous cell carcinoma.
[0014] Beneficial effects of the present invention:
[0015] This study screened differentially expressed genes associated with tongue squamous cell carcinoma from the GEO database and correlated these genes with patient survival data. Key prognostic genes were identified using the COX and LASSO regression algorithms. The expression of eight identified DEGs in patients with TSCC of varying clinical grades was visualized and analyzed, confirming a significant correlation between HAX1 and TSCC. By constructing TSCC cell lines with differential HAX1 expression, the authors demonstrated the effects of HAX1 on TSCC, including promoting cell proliferation, enhancing cell migration and invasion, inhibiting cell apoptosis, enhancing cell stemness, and promoting TSCC-related angiogenesis. This study further demonstrated the role of HAX1 inhibition in the treatment of TSCC. Animal experiments further confirmed that high HAX1 expression accelerates the malignant progression of TSCC. Studies on the molecular mechanisms of HAX1 regulation of TSCC demonstrated that HAX1 significantly regulates downstream gene expression in TSCC cells. HAX1 is closely associated with the MAPK / ERK signaling pathway, regulating the RAF / MEK / ERK pathway through interactions with the RAF family.
[0016] This study is the first to investigate the biological function of HAX1 (HS1-associated protein X-1) in TSCC, providing a reliable basis for using HAX1 as a molecular target for early diagnosis, prognosis assessment, or targeted intervention in TSCC, and represents a new breakthrough in the treatment of TSCC. BRIEF DESCRIPTION OF THE DRAWINGS
[0017] Figure 1 This is the volcano plot of gene chips GSE34105, GSE34106, and GSE83519 in Example 1;
[0018] Figure 2 is a Venn diagram of gene chips GSE34105, GSE34106, and GSE83519 in Example 1;
[0019] Figure 3is a Kaplan-Meier curve diagram of the risk assessment model of Example 1;
[0020] Figure 4 is the ROC curve diagram of the 1-year, 3-year and 5-year survival rates of the evaluation model in Example 1;
[0021] Figure 5 This is the GEPIA analysis of the expression of the 8 DEGs in TSCC patients with different clinical grades in Example 1;
[0022] Figure 6 Figure 2 is the validation result of HAX1 overexpression in HSC4 cells in Example 2, Figure A is the qPCR validation result, and Figure B is the Western blot validation result;
[0023] Figure 7 Figure 2 shows the effective knockdown of HAX1 in HSC4 cells. Figure A shows the qPCR results, and Figure B shows the Western blot results.
[0024] Figure 8 is the CCK-8 experimental result of HSC4 cells after exogenous regulation of HAX1 expression in Example 3;
[0025] Figure 9 This is the result of the clone formation experiment of HSC4 cells after exogenous regulation of HAX1 expression in Example 3;
[0026] Figure 10 The scratch test results in Example 3, scale bar: 100 μm;
[0027] Figure 11 The results of the Transwell assay in Example 3 are migration (top) and invasion (bottom), 48 hours;
[0028] Figure 12 is the flow cytometry result in Example 3;
[0029] Figure 13 This is the Western blot verification result in Example 3;
[0030] Figure 14 The results of the ball formation experiment in Example 3 are shown. Scale bar: 100 μm.
[0031] Figure 15 This is the angiogenesis experiment in Example 3;
[0032] Figure 16 Figure 4 shows the weight and tumor growth of nude mice. Figure A shows the weight changes of nude mice, and Figure B shows the tumor growth monitoring results.
[0033] Figure 17 The nude mice and their tumors after being sacrificed in Example 4;
[0034] Figure 18 The histopathological features of H&E staining at 200× (panoramic view) and 400× (details) in Example 4 are shown;
[0035] Figure 19 In Example 4, HAX1 enhances the expression of the stem cell marker CD44 (F);
[0036] Figure 20 is that HAX1 enhances the expression of the proliferation marker Ki67 (G) in Example 4;
[0037] Figure 21 is the gene expression level of each group of samples in Example 5 under FPKM normalization;
[0038] Figure 22 This is the volcano plot of differentially expressed genes in the OE-HAX1 group (left) and the sh-HAX1#1 group (right) compared with the HSC4-WT group in Example 5;
[0039] Figure 23 GO enrichment analysis of differentially expressed genes in the OE-HAX1 group (left) and the sh-HAX1#1 group (right) compared with the HSC4-WT group in Example 5;
[0040] Figure 24 KEGG enrichment analysis of differentially expressed genes in the OE-HAX1 group (left) and the sh-HAX1#1 group (right) compared with the HSC4-WT group in Example 5
[0041] Figure 25 Western Blot analysis of PI3K-AKT in HSC4 cells regulated by HAX1 in Example 5
[0042] Figure 26 Western Blot analysis of the MAPK pathway in HSC4 cells regulated by HAX1 in Example 5
[0043] Figure 27 is the immunoprecipitation result in Example 5;
[0044] Figure 28 is the Western Blot result in Example 5;
[0045] Figure 29 is the Western blot analysis result of the overexpressed HSC4 cells in Example 5;
[0046] Figure 30 is the CCK-8 test result in Example 5;
[0047] Figure 31 is the scratch test result in Example 5;
[0048] Figure 32 is the Transwell assay result in Example 5;
[0049] Figure 33 This is the tumor stemness analysis in Example 5. DETAILED DESCRIPTION
[0050] In order to make the purpose, technical solution and beneficial effects of the present invention more clear, the technical solution of the present invention will be described in detail below. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without making creative efforts shall fall within the scope of protection of the present invention.
[0051] Example 1 Screening of TSCC Targeting Genes
[0052] (1) Screening of differentially expressed genes and association with patient survival data
[0053] Three gene chip datasets related to tongue squamous cell carcinoma were retrieved and selected from the GEO (Gene Expression Omnibus) database, namely GSE34105, GSE34106, and GSE83519. The GEO2R differential analysis tool provided by the GEO database was used to set the statistical significance threshold at P < 0.05 to screen out genes (DEGs) with significant differences in expression between cancer tissues and adjacent tissues ( Figure 1 After intersection analysis, 2703 intersection DEGs were obtained ( Figure 2 To further clarify the role of these DEGs in clinical prognosis, the present invention downloaded the expression profiles of the above 2703 DEGs in TSCC patients and their corresponding clinical survival information (gender, age, clinical stage, survival status and survival time) from the TCGA (The Cancer Genome Atlas) database for subsequent R language analysis.
[0054] (2) Screening key prognostic genes using COX and LASSO regression algorithms
[0055] The relationship between the single gene expression levels of the above 2703 DEGs and the patient survival time was analyzed by Cox univariate regression in R language. It was found that the single gene expression levels of 1352 DEGs had a significant statistical correlation with the patient survival time (Table 1).
[0056] Table 1 Results of Cox univariate regression analysis
[0057]
[0058] Table 1 Results analysis explanation: The analysis results of some 1352 DEGs significantly associated with survival are listed. It is worth noting that HAX1 is also among them. Its high expression is significantly associated with poor prognosis, suggesting that it has research value as a potential prognostic indicator or therapeutic target.
[0059] Table 2 Results of Cox multivariate regression analysis
[0060]
[0061]
[0062] Table 2 Results analysis: Through LASSO regression and COX multivariate analysis, a total of 8 key DEGs significantly associated with patient survival were screened out, among which HAX1 was one of the final selected characteristic genes, suggesting that it may play an important role in the prognosis evaluation of tongue squamous cell carcinoma.
[0063] To improve the accuracy and simplicity of the prediction model, the present invention first used the LASSO (Least Absolute Shrinkage and Selection Operator) regression algorithm to perform feature screening on 1352 prognostic-related DEGs obtained from the previous Cox univariate analysis to remove redundant variables and retain a gene set with strong predictive ability for survival. Subsequently, based on the candidate genes screened by LASSO, Cox multivariate regression analysis was further performed to evaluate the independent prognostic value of each gene after controlling for the influence of other variables, thereby constructing a more robust survival prediction model with clinical application potential. Ultimately, eight key DEGs significantly associated with patient survival were identified (Table 2): C8orf33, GRAP, GUCY1A3, HAX1, MAPK11, OSR2, PLAU, and SLC11A1.
[0064] (3) Construction and validation of risk scoring model:
[0065] Combined with the results of COX multivariate analysis, the following risk score calculation formula was established: Risk score = (C8orf33×0.32012)-(GUCY1A3×0.1357)-(GRAP×0.2513)-(MAPK11×0.3019)+(HAX1×0.42418)-(OSR2×0.186)+(PLAU×0.24072)+(SLC11A1×0.20633) Patients were divided into high-risk group and low-risk group according to the median of their risk score, and survival difference analysis was performed. Kaplan-Meier survival curve results ( Figure 3 ) showed that the overall survival of patients in the low-risk group was significantly better than that in the high-risk group, verifying the effectiveness of the constructed model. The model's ability to predict 1-year, 3-year, and 5-year survival rates was further evaluated by calculating the AUC (Area Under the Curve) value, which was 0.72, 0.75, and 0.70, respectively, indicating that the model has good predictive accuracy and clinical application potential ( Figure 4 ).
[0066] (4) Basis for determining HAX1 as a core research target:
[0067] With the help of GEPIA (Gene Expression Profiling Interactive Analysis) online analysis platform, the expression of the 8 DEGs screened out in TSCC patients of different clinical grades (Stage) was visualized and analyzed. Figure 5 ) showed that the expression levels of HAX1 and SLC11A1 were significantly correlated with the clinical grade of the tumor (P<0.05), suggesting that they may be involved in the progression of TSCC.
[0068] Example 2 Components of HAX1 Differentially Expressed TSCC Cell Lines
[0069] (1) Construction of HAX1 overexpression vector and establishment of stable cell line
[0070] ①RNA extraction and cDNA synthesis:
[0071] HSC4 cells in good condition were taken, washed twice with 1× PBS buffer, and digested with 2 mL of trypsin. The number of cells collected was no less than 5×10 6After treatment with lysis buffer (600 μL RLA + 10 μL Proteinase K), the cell lysate was separated by centrifugation (12,000 rpm, 2–5 min). 70% ethanol (1:1 volume ratio) was added, and RNA was purified stepwise using an RNA extraction kit (Tiangen) and finally dissolved in 60 μL RNase-free ddH2O. RNA concentration was determined using a Nanodrop 2000. The extracted RNA was used as a template for reverse transcription to cDNA using a commercial reverse transcription kit (Takara).
[0072] ②PCR amplification of HAX1 gene and construction of overexpression vector
[0073] Primers containing KpnI and NotI restriction sites were designed based on the HAX1 gene sequence.
[0074] HAX1-F:CGGGGTACCCGGACCATGTACACCGATATAGAGATGAACCGCCTTGGAAAGAGCCTCTTTGATCTCT (SEQ ID No.: SEQ ID No 1);
[0075] HAX1-R:TAAAGCGGCCGCCTACCGGGACCGGAACCAAC (SEQ ID No. 2)
[0076] PCR system:
[0077] Reagents Usage cDNA template 1ug Forward Primer 0.6 μl Reverse Primer 0.6 μl High-fidelity DNA polymerase (GXL) 0.8 μl 5X GXL buffer 4ul dNTP 1.6ul 40% glycerin 2.5ul <![CDATA[ddH2O]]> Make up to a total reaction volume of 20ul
[0078] Perform high-fidelity amplification, and the amplified product is detected and recovered by 1% agarose gel electrophoresis. Use KpnI and NotI to double-digest the PCR product and the pcDNA5 vector:
[0079] Reagents Usage Vector DNA (pcDNA5 plasmid) 1ug KpN 0.5 μl NotI 0.5 μl 10X FD buffer 1 μl <![CDATA[ddH2O]]> Make up to a total reaction volume of 10ul
[0080] Incubate at 37 °C for 1-2 hours.
[0081] The PCR products were double-digested using the same enzymes. The enzyme digestion system is as follows:
[0082] Reagents Usage Recover target fragments 1ug KpN 0.5 μl NotI 0.5 μl 10X FD buffer 1 μl <![CDATA[ddH2O]]> Make up to a total reaction volume of 10ul
[0083] Incubate at 37 °C for 1-2 hours.
[0084] After double enzyme digestion, T4 ligase is used for ligation. The ligation system is as follows:
[0085]
[0086]
[0087] ③Transformation and screening
[0088] The ligation product was transformed into DH5α competent cells, heat-shocked at 42°C for 90 seconds, and then recovered for 1 hour before being plated onto LB plates containing ampicillin and incubated at 37°C for 12–16 hours. Single colonies were selected for colony PCR verification. The recombinant vector was successfully constructed by gel electrophoresis and sequencing.
[0089] ④Cell transfection and screening
[0090] The constructed pcDNA5-HAX1 plasmid was transfected into HSC4 cells (50–70% confluence) using Lipofectamine 3000. After 12 hours, the culture medium was replaced with complete culture medium (89% DMEM + 10% FBS + 1% P / S). Hygromycin B was added 48 hours after transfection for resistance selection. The culture medium was changed every 2–3 days until the cells in the untransfected control group completely died (7–10 days).
[0091] ⑤ Overexpression efficiency verification
[0092] qPCR and Western Blot were used to detect the mRNA and protein expression levels of HAX1 in transfected cells (key antibody information is shown in the table below).
[0093] Supplementary Table 1.Information on the antibodies applied inwestern blotting assay
[0094]
[0095]
[0096] qPCR validation and Western blot validation results ( Figure 6 Figure A is the qPCR verification result, and Figure B is the Western blot verification result) showed that the HAX1 expression level was significantly upregulated compared with the control group, confirming that HAX1 overexpressing HSC4 cells were successfully constructed.
[0097] (2) Construction of HAX1 knockdown plasmid and establishment of stable cell lines
[0098] ① Interference sequence design and annealing
[0099] Four pairs of shRNA sequences targeting the HAX1 CDS sequence were designed using the Dharmacon online platform, and AgeI and EcoRI restriction sites were introduced. The sequences are as follows:
[0100] shRNA1-F: CCGGACAGACACTTCGGGACTCAATCTCGAG (SEQ ID No 3)
[0101] shRNA1-R: ATTGAGTCCCGAAGTGTCTGTTTTTTT (SEQ ID No 4)
[0102] shRNA2-F: CCGGTGGACTTATTCCTGGGACGTTCTCGAG (SEQ ID No 5)
[0103] shRNA2-R: AACGTCCCCAGGAATAAGTCCATTTTTT (SEQ ID No 6)
[0104] shRNA3-F: CCGGCCAGAGGCCATTTCATAGGTTCTCGAG (SEQ ID No 7)
[0105] shRNA3-R: AACCTATGAAATGGCCTCTGGTTTTTT (SEQ ID No 8)
[0106] shRNA4-F: CCGGCCAGCCCAAATCCTATTTCAACTCGAG (SEQ ID No 9)
[0107] shRNA4-R: TTGAAATAGGATTTGGGCTGGTTTTTT (SEQ ID No 10)
[0108] After synthesizing the primers, configure the annealing reaction system.
[0109] Reagents Usage Forward Primer 1 μl Reverse Primer 1 μl T4 ligase (10×) 1 μl T4 PNK 1 μl <![CDATA[ddH2O]]> Make up to a total reaction volume of 10ul
[0110] The temperature program reaction (95°C 30s→72°C 2min→37°C 2min→25°C 2min) was performed in sequence in a PCR instrument to form a double-stranded oligo.
[0111] ② shRNA plasmid construction
[0112] The PLKO.1 plasmid was double-digested with AgeI and EcoRI and ligated with the annealed oligo primers. The ligation system was incubated at 25°C for 30 minutes. The ligation product was transformed into DH5α competent cells, and positive clones were screened and sequenced to verify the correct construction.
[0113] ③ Lentiviral packaging and cell infection
[0114] 293T cells were co-transfected with the pSPAX2 and pMD2.G packaging plasmids and the PLKO.1-shRNA constructed above. The viral supernatant was collected and the viral fluid was used to infect HSC4 cells. After infection, Puromycin resistance was selected to establish an HSC4 cell line with stable HAX1 knockdown.
[0115] ④ Knockdown efficiency verification
[0116] qPCR and Western Blot were used to detect the mRNA and protein expression levels of HAX1 in transfected cells. The results showed that shRNA1 and shRNA3 had significantly higher interference efficiency, and the expression level of HAX1 was significantly downregulated compared with the control group ( Figure 7 , Figure A is the qPCR result, and Figure B is the Western blot result), confirming that it is an effective knockdown sequence.
[0117] Example 3
[0118] HAX1 accelerates the malignant progression of TSCC in cell (in vitro) experiments
[0119] Following the successful construction of a TSCC cell line model with differential HAX1 expression (Example 2), this example conducted a series of in vitro cell-based experiments to verify whether differential HAX1 expression significantly impacts the malignant biological behavior of TSCC. These experiments primarily assessed the role of HAX1 in key cell characteristics, including cell proliferation, migration and invasion, epithelial-mesenchymal transition, apoptosis, cell cycle progression, spheroid formation, and angiogenesis, to explore its function in TSCC.
[0120] (1) HAX1 promotes TSCC cell proliferation
[0121] ①CCK-8 cell proliferation assay
[0122] Wild-type HSC4 cells (HSC4-WT), HAX1 overexpressing cells (OE-HAX1) and HAX1 knockdown cells (sh-HAX1#1 and sh-HAX1#3) were seeded in 96-well plates (1×10 3 ~2×10 3 Cells / well) were plated, with three or more replicate wells per group. PBS was added to the edge wells to reduce evaporation interference. The cells were incubated at 37°C and 5% CO2. After 24 hours, 10 μl of CCK-8 reagent was added to each well. After 1 to 2 hours of incubation, the absorbance (OD value) was measured at 450 nm, and 630 nm was used as the background correction wavelength. This process was continued for 4 days, with daily monitoring to reflect the cell proliferation rate. CCK-8 test results ( Figure 8) showed that HAX1 overexpression significantly enhanced the proliferation ability of HSC4 cells, and the OD value increased rapidly; while HAX1 knockdown significantly inhibited cell growth.
[0123] ② Clone formation experiment
[0124] The above cell lines were seeded at a density of 1000 cells / well in 6-well plates and cultured at 37°C for 10–14 days, with the culture medium changed every 2–3 days. Once colonies were visible to the naked eye, they were fixed with anhydrous methanol for 20 minutes, stained with crystal violet for 10–15 minutes, and washed and air-dried. The number of colonies was counted using ImageJ software. Results ( Figure 9 ) showed that the number of clones formed by OE-HAX1 cells increased significantly, while that in the sh-HAX1 group decreased significantly, suggesting that HAX1 promotes the proliferation and clone-forming ability of TSCC cells.
[0125] (2) HAX1 enhances the migration and invasion ability of TSCC cells
[0126] ① Scratch test
[0127] Cells from each experimental group were seeded in a 6-well plate. After the cell monolayer was confluent, a standard scratch was formed using the ibidi plug. After the plug was removed, the cells were washed three times with PBS and replaced with serum-free medium. The scratch area was recorded at 0, 6, 12, 24, and 48 hours, and the scratch closure rate was measured and calculated using ImageJ. Results ( Figure 10 ) showed that the wound healing was accelerated in the OE-HAX1 group, while the migration ability was decreased in the sh-HAX1 group.
[0128] ②Transwell migration / invasion assay
[0129] The cells in the logarithmic growth phase were resuspended in serum-free medium (5 × 10 4 ~1×10 5 cells / ml), 200 μl of cell suspension was added to the upper chamber of the Transwell, and 600 μl of complete medium containing 20% FBS was added to the lower chamber. In the invasion assay, the upper chamber membrane was pre-coated with Matrigel (1:9 dilution, pre-incubated at 37°C for 1 hour), but this step was omitted in the migration assay. After incubation for 48 hours, the cells were fixed and stained, and the number of cells transmembrane in 5 fields of view per well was counted. Results ( Figure 11 ) showed that the number of transmembrane cells in the HAX1 overexpression group increased significantly, while that in the sh-HAX1 group decreased significantly, suggesting its promoting effect on migration and invasion ability.
[0130] (3) HAX1 inhibits TSCC cell apoptosis
[0131] ①Annexin V / PI double staining flow cytometry
[0132] After the cells in each treatment group were collected, they were stained with Annexin V-APC / PI, and the proportion of early and late apoptotic cells was detected by flow cytometry. Figure 12 ) showed that the apoptosis rate of OE-HAX1 cells was significantly reduced, the apoptosis rate of sh-HAX1 cells was increased, and HAX1 inhibited the apoptosis of HSC4 cells.
[0133] ② Western Blot detection of apoptosis-related proteins
[0134] After extracting total cell protein, the expression levels of pro-apoptotic protein BAX and anti-apoptotic protein BCL-2 were detected. Figure 13 ) found that BAX expression was decreased in the OE-HAX1 group and significantly increased in the sh-HAX1 group, suggesting that HAX1 may exert its anti-apoptotic effect by inhibiting BAX expression.
[0135] (4) HAX1 enhances TSCC cell stemness (cell sphere formation assay)
[0136] The cells were seeded in a low-adhesion 6-well plate (1000–2000 cells per well) and cultured in a serum-free medium for cancer stem cells containing B27, EGF, bFGF, and other factors for 7–10 days. The number and size of spheres were recorded using a microscope, and the area and number of spheres were measured using Image J software. The results showed that ( Figure 14 ) Effect of HAX1 expression on the area and number of spheres formed by HSC4 cells. The number and diameter of spheres in the OE-HAX1 group were significantly increased, while the sphere-forming ability in the sh-HAX1 group was weakened, suggesting that HAX1 enhances the stemness of TSCC cells.
[0137] (5) HAX1 promotes TSCC-related angiogenesis (angiogenesis assay)
[0138] The PCDH-HAX1 (overexpression) and shRNA#1, shRNA#3 (knockdown) vectors were used to infect human umbilical vein endothelial cells (HUVEC) within 3 generations by lentiviral infection, respectively, to establish HAX1 overexpression and HAX1 knockdown HUVEC cell lines. The lentiviral preparation and infection process were carried out according to the above method. After cell infection, they were cultured normally in HUVEC-specific culture medium, and some cells were collected for Western Blot verification of HAX1 expression levels to confirm the effect of constructing the differential expression model. Pre-cooled Matrigel was melted on ice, and after diluting it with DMEM basal culture medium at a ratio of 1:1, 50 μL was evenly spread on the bottom of a 96-well plate and incubated at 37°C for 30 minutes to promote Matrigel solidification. Subsequently, each group of HUVEC cells was digested and counted, resuspended in DMEM basal culture medium, and plated at 3×10 4The cells were seeded at a density of cells / well into a 96-well plate pre-coated with Matrigel. The cells were cultured at 37°C and 5% CO2 for 6–12 hours. The tubular structure formation process was observed under an inverted microscope and photographed. Image analysis of the formed vascular structures was performed using ImageJ software, and the total length of the tubes and the number of branch nodes were measured. Figure 15 ) showed that in HAX1-overexpressing HUVEC cells, the ability to form vascular tube structures was significantly enhanced, as manifested by a significant increase in the total length of the tubes and the number of branches; while in the HAX1 knockdown group, vascular tube formation was inhibited, and the length of the tubes and the number of branches were significantly decreased, suggesting that HAX1 plays a promoting role in regulating the angiogenesis ability of endothelial cells.
[0139] Example 4
[0140] HAX1 accelerates the malignant progression of TSCC in animal (in vivo) experiments
[0141] After initially validating the effect of HAX1 differential expression on TSCC malignant behavior in cellular experiments, the present invention conducted in vivo animal studies to further clarify the in vivo mechanism of action of HAX1 and its regulation of tumor biological behavior. By establishing a mouse model to simulate the effects of HAX1 on TSCC growth, invasion, and metastasis in vivo, the authors further validated its influence on tumor behavior and its feasibility as a potential tumor target.
[0142] (1) Construction and observation of tumor formation model in nude mice:
[0143] The present invention uses BALB / c-nu immunodeficient nude mice (male, 6-8 weeks old, weighing 18-22 grams) and is housed in a SPF-grade animal room with constant temperature and humidity and allowed to acclimate for at least 7 days. The experiment uses HSC4 cells in the logarithmic growth phase, including an empty control group (HSC4-WT), a HAX1 overexpression group (OE-HAX1), and a HAX1 interference group (sh-HAX1#1). After trypsinization and counting, the cells in each group are counted at 5×10 6 The cells were suspended in a 1:1 mixture of PBS and Matrigel at a concentration of 100 cells / 120 μL. 100 μL of the cell suspension was then injected into the subcutaneous tissue of the axilla of nude mice. The tumor growth of the nude mice was recorded every 3 days after injection. When the tumor volume approached the maximum allowable value (1000 mm) stipulated by ethical regulations, the tumor was re-injected. 3 ), the nude mice were killed and the tumor tissues were removed for subsequent analysis. The experimental results showed that the tumor growth rate of the nude mice in the OE-HAX1 group was significantly faster than that in the other groups ( Figure 16 Figure A shows the changes in nude mouse body weight, and Figure B shows the monitoring results of tumor growth). The tumor volume and weight increased significantly ( Figure 17), while tumor growth was significantly inhibited in the sh-HAX1#1 group. This phenomenon indicates that HAX1 overexpression promotes the tumorigenicity of TSCC cells in vivo, while low expression has an inhibitory effect.
[0144] (2) Morphological analysis of tumor tissue (HE staining):
[0145] The present invention further performs a histological evaluation on the removed tumor tissue. After the tissue samples were fixed with 4% paraformaldehyde for 24 hours, they were dehydrated, transparent, paraffin-embedded according to conventional procedures, and sliced to a thickness of 3-5 μm. Morphological observation was performed after hematoxylin-eosin (H&E) staining. The results showed that the cell density of the tumor tissue in the OE-HAX1 group was significantly increased, the cells were disordered, the nuclear atypia was enhanced, and the nuclear chromatin was unevenly distributed, indicating that it had a higher degree of malignancy, and there was less lymphocyte infiltration in this group of tissues. In contrast, the cells of the tumor tissue in the sh-HAX1#1 group were arranged more regularly, the cell morphology was more consistent, and there was more obvious lymphocyte infiltration and immune response ( Figure 18 ).
[0146] (3) Immunohistochemical detection of key protein expression in tumor tissues:
[0147] To further clarify the effect of HAX1 on tumor stemness and proliferation activity, the present invention uses immunohistochemistry to detect the expression of CD44 and Ki67 proteins in tumor tissues (both are conventional methods, and the specific steps are not described in detail in this example). Tissue sections were processed by standard immunohistochemistry staining procedures, including dewaxing, hydration, antigen retrieval, blocking, primary antibody incubation, secondary antibody incubation, and color development. Images were collected using a digital scanner and quantitatively analyzed. Experimental results ( Figure 19 and Figure 20 ) showed that CD44 expression levels were significantly upregulated in tumor tissues of the OE-HAX1 group, suggesting that HAX1 may enhance the stemness of tumor cells. Ki67 expression was also significantly increased in the OE-HAX1 group, indicating that HAX1 has the ability to promote tumor cell proliferation. In contrast, in the sh-HAX1#1 group, both CD44 and Ki67 expression levels were significantly decreased, further supporting the important tumor-promoting role of HAX1 in the development and progression of TSCC.
[0148] Example 5
[0149] Exploring the molecular mechanism of HAX1 regulating TSCC based on transcriptome sequencing
[0150] In vitro and in vivo experiments have demonstrated that differential expression of HAX1 significantly impacts TSCC malignant behaviors such as proliferation, migration, invasion, and metastasis. However, the specific molecular mechanisms by which HAX1 achieves these functions remain unclear. To further elucidate the mechanism of action of HAX1, the present invention combined high-throughput transcriptome sequencing (RNA-seq) technology to screen for relevant molecular pathways and validated this mechanism using Western blot and co-immunoprecipitation (Co-IP) assays.
[0151] (1) Effects of HAX1 expression regulation on the transcriptome of TSCC cells
[0152] The present invention performed transcriptome sequencing on three groups of HSC4 cells: OE-HAX1, sh-HAX1#1, and HSC4-WT. The effective alignment rates of the sequencing raw data were significantly higher than 70%, meeting high-quality standards (Table 3).
[0153] Table 3. Overview of read alignment with reference genome
[0154]
[0155]
[0156] This indicates that the samples were not contaminated by foreign sources and the data reliability was good. In order to ensure the comparability of expression levels between different samples, the sequencing data were standardized using FPKM and TPM methods, and their expression distribution was displayed using box plots ( Figure 21 ). DEGs were then screened using DESeq2 software, with P value < 0.05 and |log2Fold Change| ≥ 1 as the threshold. The volcano plot of differentially expressed genes was shown ( Figure 22 ), there were 641 upregulated and 635 downregulated genes in the OE-HAX1 group compared with the HSC4-WT group, and 1088 upregulated and 1138 downregulated genes in the sh-HAX1#1 group, respectively, suggesting that HAX1 significantly regulates downstream gene expression in TSCC cells.
[0157] Further functional enrichment analysis was performed using the GO database, and it was found that DEGs were significantly enriched in GO terms related to the positive regulation of apoptosis process. Compared with the HSC4-WT group, the OE-HAX1 group and the sh-HAX1#1 group had a significantly higher expression of DEGs than the HSC4-WT group. Figure 23) showed that HAX1 may participate in tumor progression by regulating cell apoptosis. This conclusion is consistent with the experimental results of flow cytometry detection of TSCC cell apoptosis rate, forming the internal consistency of the experiment. To further explore the potential signaling pathway mechanism, the present invention performed KEGG pathway enrichment analysis on the DEGs of OE-HAX1 and sh-HAX1#1 groups. The results showed that DEGs were significantly enriched in PI3K-AKT and MAPK signaling pathways ( Figure 24 ), suggesting that HAX1 may affect the occurrence and development of TSCC by regulating the activity of these signaling pathways. These findings provide clues for further research on the mechanism of action of HAX1 in TSCC.
[0158] (2) HAX1 is closely related to the MAPK / ERK signaling pathway
[0159] To verify the conclusion of transcriptome analysis, the present invention detected the expression of key proteins of PI3K-AKT and MAPK pathways by Western Blot. The results showed that HAX1 expression level had no significant effect on p-AKT expression ( Figure 25 ), suggesting that it has limited regulatory effect on the PI3K-AKT pathway. Further analysis of the activation status of ERK, JNK, and p38 subpathways in the MAPK pathway revealed that HAX1 expression was significantly positively correlated with p-ERK1 / 2 levels. Overexpression of HAX1 significantly increased p-ERK1 / 2 levels, while knockdown of HAX1 significantly reduced its phosphorylation level ( Figure 26 ); in contrast, p-JNK and p-p38 levels did not change significantly, indicating that HAX1 primarily affects the ERK branch of the MAPK pathway. In summary, HAX1 can activate the ERK pathway, thereby regulating tumor-related biological processes such as TSCC cell proliferation, migration, and apoptosis.
[0160] (3) HAX1 can interact with RAF kinase family members to exert its effects
[0161] To explore the upstream mechanism of HAX1 regulating the ERK pathway, further Co-IP experiments were conducted. The results showed that HAX1 does not directly bind to downstream factors such as MEK, ERK, and p38, but can specifically bind to RAF family members (A-RAF, B-RAF, and C-RAF) ( Figure 27 ), suggesting that HAX1 regulates the RAF / MEK / ERK pathway through interaction with the RAF family. HAX1 was confirmed to interact with all RAF isoforms (A-RAF / B-RAF / C-RAF), upstream regulators of the RAF / MEK / ERK pathway. Given that RAF kinases are key activators of the RAF / MEK / ERK pathway, their interaction with HAX1 provides important clues for subsequent mechanistic studies.
[0162] (4) HAX1 regulates the phosphorylation of C-RAF (S259)
[0163] To explore the molecular mechanism of HAX1 regulating RAF kinase activity, the present invention detected the status of different phosphorylation sites of RAF protein. Western Blot results ( Figure 28 ) showed that the phosphorylation levels of B-RAF (S445) and C-RAF (S289 / 296) were not significantly different between the different HAX1 expression groups, while the phosphorylation level of C-RAF (S259) was significantly regulated by HAX1 expression, indicating that HAX1 activates the RAF / MEK / ERK signaling pathway by inhibiting the phosphorylation of the C-RAF S259 site. Specifically, HAX1 overexpression significantly reduced C-RAF (S259) phosphorylation, while knocking down HAX1 significantly increased it. The S259 site is an inhibitory phosphorylation site of C-RAF, and its phosphorylation can inhibit C-RAF activation and function. HAX1 enhances C-RAF activity by reducing S259 phosphorylation, thereby activating the downstream MEK / ERK pathway. This molecular mechanism clarifies how HAX1 regulates the RAF / MEK / ERK pathway.
[0164] (5) PD98059 inhibited the phosphorylation of MEK / ERK and the malignant behavior of TSCC
[0165] To verify the functional relationship between HAX1 and the malignant behavior of TSCC cells through the MEK / ERK pathway, the present invention used the MEK-specific inhibitor PD98059 for a reversion experiment. PD98059 was applied to HSC4 cells overexpressing HAX1, and samples were collected 48 hours later for Western Blot analysis. The results showed that PD98059 significantly reduced the elevated MEK / ERK phosphorylation levels in HSC4 cells induced by HAX1 overexpression, and significantly inhibited the phosphorylation of MEK and ERK ( Figure 29 ), proving that it can effectively block the activation of this signaling pathway. The effects of PD98059 on cell phenotypes were further evaluated by CCK8, scratch assay, Transwell migration / invasion and sphere formation assays (all conventional methods, not described in detail in this example). Results ( Figures 30 to 33 ) showed that PD98059 significantly inhibited the proliferation, migration, and invasion of HAX1-overexpressing cells and reduced their tumor stemness, which in turn verified the function of HAX1 in promoting the occurrence and development of TSCC through the RAF / MEK / ERK pathway ( Figure 30 This showed that PD98059 treatment significantly inhibited the proliferation of HAX1-overexpressing HSC4 cells. Figure 31 This indicates that PD98059 can effectively reverse the enhanced migration ability of HSC4 cells caused by HAX1 overexpression; Figure 32This indicated that PD98059 treatment simultaneously inhibited the migration and invasion abilities of HAX1-overexpressing HSC4 cells; Figure 33 This showed that PD98059 significantly reduced the tumor sphere-forming ability of HAX1-overexpressing HSC4 cells.
[0166] In summary, the present invention systematically illustrates through multiple experimental methods that HAX1 regulates C-RAF (S259) phosphorylation and activates the RAF / MEK / ERK signaling pathway, thereby promoting the proliferation, migration, invasion, and stemness maintenance of TSCC cells, clarifying its application prospect as a potential therapeutic target for TSCC.
[0167] Finally, it should be noted that the above preferred embodiments are only used to illustrate the technical solutions of the present invention and are not limiting. Although the present invention has been described in detail through the above preferred embodiments, those skilled in the art should understand that various changes can be made in form and details without departing from the scope defined by the claims of the present invention.
Claims
1. Application of HAX1 as a target gene in the treatment of tongue squamous cell carcinoma.
2. Application of HAX1 as a marker in the diagnosis, treatment, or prognosis of tongue squamous cell carcinoma.
3. Application of HAX1 inhibitors in the preparation of drugs for the treatment of tongue squamous cell carcinoma.
4. A drug for treating tongue squamous cell carcinoma, characterized in that: The drugs include HAX1 inhibitors.
5. Application of HAX1 as a biomarker in the preparation of early diagnosis kits, prognostic risk assessment systems, or molecular typing auxiliary tools for tongue squamous cell carcinoma.
6. Application of the HAX1 expression level kit in the diagnosis or evaluation of tongue squamous cell carcinoma.