An indel molecular marker related to peach single fruit weight traits and application thereof

By developing InDel molecular markers and specific primer pairs, the problem of difficulty in efficiently identifying the single fruit weight trait of peaches in existing technologies has been solved, realizing an efficient and rapid peach breeding method and improving breeding efficiency and accuracy.

CN120591437BActive Publication Date: 2026-04-21ZHENGZHOU FRUIT RES INST CHINESE ACADEMY OF AGRI SCI
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
ZHENGZHOU FRUIT RES INST CHINESE ACADEMY OF AGRI SCI
Filing Date
2025-05-26
Publication Date
2026-04-21

AI Technical Summary

Technical Problem

Existing technologies are insufficient for efficiently and quickly identifying and selecting single-fruit weight traits in peaches. Traditional breeding methods are time-consuming and labor-intensive. Existing molecular markers are either not closely linked to the target genes, making it difficult to meet breeding needs.

Method used

A new InDel molecular marker associated with single-fruit weight in peaches was developed, located 1486 bp upstream of the start codon of PpOFP17. Specific primer pairs were designed for PCR amplification and electrophoresis detection to achieve high-precision and convenient genotyping.

Benefits of technology

It enables simple, rapid, and high-throughput identification of single peach fruit weight traits, improves breeding efficiency, shortens breeding time, reduces costs, and promotes the transformation of peach breeding towards precision design.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120591437B_ABST
    Figure CN120591437B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of molecular markers and assisted breeding, and discloses an InDel molecular marker related to a peach single fruit heavy trait and application. The InDel molecular marker related to the peach single fruit heavy trait is located at a position of 1486bp upstream of a start codon of PpOFP17, and an allele is an insertion / deletion of 5167bp. The application provides a basis for establishment of a peach single fruit heavy trait molecular marker assisted breeding system. The molecular marker can be simply, rapidly and high-throughput applied to peach breeding practice, can break through a bottleneck of traditional technology, can accelerate excellent allele aggregation, can promote transformation of peach breeding from "empirical screening" to "precise design", and can provide a core driving force for peach industry variety improvement.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular markers and assisted breeding technology, specifically to an InDel molecular marker related to the single fruit weight trait of peaches and its application. Background Technology

[0002] The peach (Prunus persica) belongs to the genus Prunus, subgenus Prunus, family Rosaceae. Its fruit is soft, juicy, and flavorful, making it an important fresh fruit. Single fruit weight is a crucial breeding objective, a primary component of germplasm resource description, and an important commercial trait. Peach single fruit weights range from 10-500g, covering a wide range, each with its own utilization value and corresponding consumer group. Studies have found that peach single fruit weight is a quantitative trait controlled by multiple genes, exhibiting continuous variation in hybrid offspring. Furthermore, the variation in fruit size in offspring tends towards smaller fruit types, indicating a decline in economic traits. Therefore, breeding peaches with large single fruit weights is a primary goal for peach breeding in the future. Meanwhile, the peach is a diploid plant (2n=16) with a genome of approximately 230Mb. Due to its small genome size and low heterozygosity, it is often considered a model species for functional genomics research in Rosaceae plants. However, traditional methods of hybridization for breeding new varieties are still widely used by peach breeders in the process of developing new varieties. This method is time-consuming, labor-intensive, and costly due to the long juvenile stage, the large size of the trees, and the fact that single-fruit weight traits can only be observed after the fruit has matured. These factors hinder the development of new varieties. Developing molecular markers closely linked to single-fruit weight traits would allow for the early elimination of unplanned plants in the breeding process, reducing workload, shortening breeding time, and improving breeding efficiency. This would be crucial for developing new large-fruited peach varieties, enriching the fruit market, and enhancing the market competitiveness of the peach industry.

[0003] Over the past two decades, marker-assisted selection (MAS) technology has significantly improved breeding efficiency by analyzing molecular marker genotypes linked to target traits. Early studies relied heavily on markers such as RFLP, RAPD, AFLP, and SSR, but these techniques depend on enzyme digestion or electrophoresis detection, which are cumbersome and difficult to automate. Meanwhile, existing SSR markers have low accuracy in early offspring identification due to their large linkage distance to target genes; and SNP markers developed based on low-density microarrays have insufficient site coverage, making it difficult to pinpoint key causal sites, and the complex SSR marker genotyping process fails to meet the needs of large-scale breeding.

[0004] Current single-fruit regeneration breeding of peaches faces a dual dilemma: existing markers (such as SSRs) are either loosely linked to the target gene or, although tightly linked, are not functional sites, making it difficult to support efficient selection. Furthermore, consumers' evolving quality demands require the rapid development of superior peach varieties. Therefore, resolving this contradiction urgently necessitates the development of high-precision, easily operable molecular markers. Summary of the Invention

[0005] The purpose of this invention is to overcome the shortcomings of the prior art and provide an InDel molecular marker related to the single fruit weight trait of peaches and its application.

[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0007] In a first aspect, the present invention provides an InDel molecular marker associated with the single fruit weight trait of peaches, wherein the InDel molecular marker is located 1486 bp upstream of the start codon of PpOFP17 and has an allele of 5167 bp insertion / deletion.

[0008] As a preferred embodiment of the InDel molecular marker related to the single fruit weight trait of peach as described in this invention, the 5167bp nucleotide sequence is shown in SEQ ID NO: 1.

[0009] Secondly, the present invention provides a specific primer pair for detecting the InDel molecular marker, the nucleotide sequences of which are TTTCATTTGGGATTTCCGTGGG and GCCGGGCGGATACTCTTATAC.

[0010] Thirdly, the present invention provides a kit for detecting the InDel molecular markers associated with the single fruit weight trait of peaches, including the specific primer pair.

[0011] Fourthly, the present invention provides a method for identifying the single fruit weight trait of peaches, comprising: extracting genomic DNA from the young leaves of peaches to be identified; performing PCR amplification on the extracted DNA sample using the specific primers; performing electrophoresis detection on the amplification products; and determining the genotype based on the band size and positional relationship of the amplification products.

[0012] In a preferred embodiment of the identification method described in this invention, when the length of the amplification product is 6170 bp, it indicates that the peach sample is a small-fruited type; when the length of the amplification product is 6170 bp and 1003 bp or the length of the amplification product is 1003 bp, it indicates that the peach sample is a large-fruited type.

[0013] Fifthly, the present invention applies the InDel molecular marker, the specific primer pair, or the kit to the identification or auxiliary identification of single peach fruit weight traits.

[0014] In a sixth aspect, the present invention applies the InDel molecular marker, the specific primer pair, or the kit to the detection of heavy trait genes in single peach fruits.

[0015] In a seventh aspect, the present invention applies the InDel molecular marker, the specific primer pair, or the kit to peach breeding.

[0016] Eighthly, the present invention applies the InDel molecular marker, the specific primer pair, or the kit to the identification or screening of germplasm resources of large single-fruited peaches.

[0017] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0018] This invention uses 'Zhongyoutao 13' and 'Zheng 2007-4-28' as research parents to construct an F1 hybrid with extreme traits. Using BSA-Seq technology and RNA-seq sequencing for gene localization and functional annotation analysis, a 5167bp deletion was identified 1486bp upstream of the PpOFP17 start codon. Specific primers for the InDel functional marker were developed, providing a foundation for establishing a marker-assisted breeding system for single-fruit-specific key traits in peaches. The molecular markers of this invention can be applied simply, rapidly, and with high throughput in peach breeding practices, breaking through traditional technical bottlenecks, accelerating the aggregation of superior alleles, and promoting the transformation of peach breeding from "experience-based screening" to "precision design," providing a core driving force for variety improvement in the peach industry. Attached Figure Description

[0019] Figure 1 The figure shows the distribution of candidate intervals for single-fruit weight traits in peaches on chromosomes. In the figure, a, b, and c are the distributions of ΔSNP-index, G'value, and ED on chromosomes, respectively. The red and blue dashed lines represent confidence intervals of 99% and 95%, respectively. The red boxes represent the intervals for repeated localization by the three methods.

[0020] Figure 2 This analysis examines the expression patterns of candidate genes during peach fruit development. The figures show: a) 52 genes showing a continuous decrease in large fruits; b) 27 genes showing a high-low-high trend in large fruits; c) 9 genes showing a high-low-high-low trend in large fruits; d) 57 genes showing a continuous increase in large fruits; e) 50 genes showing a continuous decrease in small fruits; f) 34 genes showing a high-low-high trend in small fruits; g) 10 genes showing a high-low-high-low trend in small fruits; and h) 53 genes showing a continuous increase in small fruits.

[0021] Figure 3 This is an electrophoresis image of an agarose gel (1%).

[0022] Figure 4 This is an example of the association between genotyping and single-fruit weight trait of peaches, which was analyzed by PCR amplification using primer pairs in Example 4. Detailed Implementation

[0023] To better illustrate the objectives, technical solutions, and advantages of this invention, the invention will be further described below with reference to specific embodiments. Those skilled in the art should understand that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.

[0024] Unless otherwise specified, the experimental methods used in the examples are conventional methods; the materials and reagents used are commercially available unless otherwise specified.

[0025] Example 1: BSA-seq localization of single-fruit weight traits

[0026] To locate candidate genes associated with the single-fruit weight trait in peaches, a BSA-seq study included two parental pools ('Zhongyoutao 13' and 'Zheng 2007-4-28') and two F1 hybrid pools of extreme traits (small-fruited and large-fruited). The latter consisted of a mixed DNA library of 31 small-fruited and 26 large-fruited individuals from the F1 hybrid population. DNA samples from the parents and the two F1 hybrid pools were sequenced, yielding 44.38 Gb of raw data and 37.56 Gb of clean data. The sequencing quality was Q20 ≥ 97.45% and Q30 ≥ 93.02%, meeting the standards for subsequent research. GC content ranged from 39.95% to 44.82%, indicating a normal GC distribution. Using the peach 'Lovel' genome version 2.0 as the reference genome, the alignment rates of all samples were between 96.22% and 97.21%, while the effective sequencing depths were between 39.63× and 42.33×, meaning that both the sequencing quality and quantity were sufficient for subsequent analysis.

[0027] Single-fruit weight trait localization was performed by calculating the SNP-index values ​​of the progeny pools. After merging the SNP frequencies of the two progeny pools, the distribution of ΔSNP-index on each chromosome was calculated and plotted. Figure 1 a). The results show that nine QTL intervals were located at a confidence level of 95%-99%. Simultaneously, the ED method was used ( Figure 1 c) and G'value ( Figure 1 b) Locating the data using the same confidence interval yielded two QTL intervals. Combining the locating results from the three methods and taking the intersection, a single interval associated with peach single fruit weight was finally identified, located on chromosome 6 from 2,191,165 bp to 3,794,466 bp, with an interval length of 1.6 Mb. Genome annotation indicated that this interval contains 261 genes.

[0028] Example 2: Analysis based on RNA-seq sequencing results

[0029] Three individual plants each of the large-fruited (180g, 175g, and 170g) and small-fruited (60g, 65g, and 67g) varieties were selected from the F1 extreme trait mixed pool. RNA-seq was performed on the mesocarps of 36 samples taken at 30, 45, 60, 75, 90, and 105 days after flowering. A total of 373.71 Gb of raw data was obtained, which, after filtering, yielded 364.06 Gb of clean data. The alignment rate to the peach reference genome was 93.96%–98.16%. Principal component analysis showed good inter-group differences and intra-group sample replication. The correlation coefficients of the three replicates within the same group were greater than 0.71, reaching a significant level.

[0030] 261 genes within the localization interval of Example 1 were analyzed. Genes that were not expressed or expressed at low levels (FPKM ≤ 2 at any stage in both large and small fruits) were removed, leaving 189 genes for subsequent analysis. The expression trends of these genes during fruit development were analyzed. In large and small fruit types, 52 genes showed expression trends at different stages. Figure 2 a) and 50 ( Figure 2 e) The overall expression levels of 57 genes showed a downward trend; Figure 2 d) and 53 ( Figure 2 h) gene expression increased continuously with fruit development in both large-fruited and small-fruited germplasm; 27 genes showed lower expression levels in the mid-fruit development stage of large-fruited germplasm. Figure 2 b), but the number of genes showing this expression trend is slightly higher in the small-fruited type, reaching 34 ( Figure 2 f); the remaining types of genes have fewer numbers ( Figure 2 c, Figure 2 g). Differences in cell division capacity in peach fruits are an important factor determining the number of mesocarp cells and affecting the weight of a single fruit. Thirty-eight genes that were highly expressed in the early stages of fruit development and expressed lowly in the later stages, and that showed differences between large and small fruit types, were selected for further analysis.

[0031] Example 3: Candidate gene screening

[0032] The locations and functions of 38 candidate genes were summarized (Table 1), among which 7 genes lacked functional annotation. Of the remaining 31 genes, 7 may be involved in the formation of single-fruit weight trait in peaches: Purpe.6G029100 (Regulatory protein RecX family protein), Purpe.6G029300 (Kinetin-like protein 1), Purpe.6G033200 (WD40 repeat-like superfamily protein), Purpe.6G039400 (Leucine-rich repeat protein kinase family protein), Purpe.6G039700 (Cytokinin response factor 1), Purpe.6G041200 (CYP450 superfamily), and Purpe.6G042800 (ovate family protein 17). Comparing the sequence differences of the above seven genes in germplasms with different single fruit weights, a 5167bp deletion located 1486bp upstream of the start codon of PpOFP17 was found to be associated with single fruit weight. Specifically, the presence of the 5167bp sequence corresponds to the genotype 0 / 0, representing small fruit (≤150g), while the deletion of the 5167bp sequence corresponds to the genotypes 0 / 1 and 1 / 1, representing large fruit (>150g).

[0033] Table 1. Candidate gene function prediction

[0034]

[0035]

[0036] The 5167bp deletion sequence (SEQ ID NO: 1) is as follows:

[0037]

[0038] Example 4: Tag Verification

[0039] 169 peach trees were randomly selected from the peach germplasm resource nursery of the Zhengzhou Fruit Research Institute, Chinese Academy of Agricultural Sciences. Genomic DNA was extracted from young leaves to obtain templates for PCR amplification. Using these templates, PCR amplification was performed with primer pair (FWprimerF / FWprimerR) to obtain the corresponding PCR products. The PCR products were subjected to agarose gel electrophoresis (1%), and band analysis was performed based on the molecular weight of different products. Analysis of genotyping and a survey of single-fruit weight traits showed results in line with expectations (see...). Figure 4 (Tables 4 and 5).

[0040] Primer sequence information:

[0041] FWprimerF (SEQ ID NO: 2):TTTCATTTGGGATTTCCGTGGG;

[0042] FWprimerR (SEQ ID NO: 3): GCCGGGCGGATACTCTTATAC.

[0043] The PCR amplification reaction system is as follows:

[0044] Table 2 PCR reaction system

[0045] reagents volume cDNA 2uL FWprimerF / FWprimerR 2 / 2μL 2×TransStarr FastPfu Fly PCR SuperMix 25μL <![CDATA[ddH2O]]> 19μL Total volume 50μL

[0046] The PCR amplification reaction procedure is as follows:

[0047] Table 3 PCR reaction procedure

[0048]

[0049]

[0050] Note: Repeat steps two through four for 35 cycles.

[0051] Table 4. Different genotypes and single fruit weight of 169 peach varieties

[0052]

[0053] Table 5. Typing results of different single fruit weight traits

[0054]

[0055] Note: 0 / 0 indicates no deletion in this region, the amplified product length is 6170bp, corresponding to small fruit size (≤150g); 0 / 1 indicates a heterozygous state, i.e., one strand is missing, the amplified product consists of two bands with lengths of 6170bp and 1003bp, corresponding to large fruit size (>150g); 1 / 1 indicates a homozygous deletion in this region, i.e., two strands are missing, the amplified product length is 1003bp, corresponding to large fruit size (>150g).

[0056] The results above show that analysis of genotype and phenotype (Tables 4, 5, and 6) is effective. Figure 4 The InDel marker was highly significantly associated with the single fruit weight trait in peaches. Meanwhile, the accuracy rate was 72.22% for small fruit type (0 / 0), 92.17% for large fruit type (0 / 1 and 1 / 1), and 85.80% for the overall accuracy rate. The 5167bp deletion was significantly associated with the single fruit weight trait.

[0057] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. Application of InDel molecular marker in identification or assisted identification of single fruit heavy trait of peach, characterized in that, The InDel molecular marker is located in PpOFP17 The allele is an insertion / deletion of 5167 bp at the position 1486 bp upstream of the start codon. The InDel molecular markers used the peach 'Lovel' genome version 2.0 as a reference genome; The 5167 bp nucleotide sequence is shown in SEQ ID NO:

1.

2. Application of InDel molecular marker in breeding of peach single fruit heavy trait, characterized in that, The InDel molecular marker is located in PpOFP17 The allele is an insertion / deletion of 5167 bp at the position 1486 bp upstream of the start codon. The InDel molecular markers used version 2.0 of the peach 'Lovel' genome as a reference genome; The 5167 bp nucleotide sequence is shown in SEQ ID NO:

1.

3. Application of the InDel molecular marker in identifying or screening germplasm resources of large-fruited peaches, characterized in that, The InDel molecular marker is located in PpOFP17 The allele is an insertion / deletion of 5167 bp at the position 1486 bp upstream of the start codon. The InDel molecular markers used version 2.0 of the peach 'Lovel' genome as a reference genome; The 5167 bp nucleotide sequence is shown in SEQ ID NO: 1; The large-fruited peach is defined as a peach weighing more than 150g.