A molecular marker for identifying borneol-type and camphor-type camphor trees and its application

Abstract

This invention discloses a molecular marker for identifying camphor-type and camphor-type camphor trees and its application, belonging to the field of biotechnology. The molecular marker WZN02 provided by this invention for identifying camphor-type and camphor-type camphor trees consists of primer pairs with nucleotide sequences as shown in SEQ ID No. 1 and SEQ ID No. 2. This molecular marker is based on the camphor synthase gene. CcTPS9 The molecular markers developed and obtained from these markers and their intron sequences can quickly and accurately identify camphor-type and borneol-type camphor trees, and the identification process is simple and low-cost. Furthermore, the molecular markers provided by this invention are suitable for seedling identification of camphor trees and have broad application value in the cultivation and selection of camphor-type camphor industrial raw material forests.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a molecular marker for identifying camphor-type and camphor-type camphor trees and its application. Background Technology

[0002] Camphor tree ( Cinnamomum camphora Camphor trees are one of my country's important woody essential oil plant resources. The essential oil components of different chemical types of camphor trees vary significantly, directly determining their medicinal and industrial uses. Based on the differences in the main components of the leaf essential oil, they can be further subdivided into several chemical types, including borneol type, camphor type, linalool type, eucalyptol type, nerolidol type, and methyleugenol type. Among them, the leaf essential oil of borneol-type camphor trees, with natural borneol (borneol) as the main component, is a highly valuable medicinal resource and has been widely used in more than 300 traditional Chinese medicines, showing good efficacy in antibacterial, anti-inflammatory, analgesic, and cardiovascular disease treatment. The leaf essential oil of camphor-type camphor trees, with camphor as the main component, shows great application potential in the development of daily chemical products and biopesticides.

[0003] However, different chemotypes of camphor trees do not show significant phenotypic differences, making them difficult to distinguish using conventional taxonomic characteristics. The natural distribution ratios of camphor-type and camphor-type camphor trees are low, and currently, selection mainly relies on professionals using the experience-based "fragrance method." However, this method is highly subjective, dependent on experience, and lacks scientific rigor and accuracy. While leaf essential oils can be extracted in the laboratory and then identified using gas chromatography-mass spectrometry (GC-MS), this process is costly, cumbersome, and requires large sample sizes, making it unsuitable for identification during the seedling stage, significantly limiting its widespread use in practical applications and promotion. Furthermore, the chemotype of sexually reproduced camphor trees undergoes significant variation, and the essential oil composition in seedlings is unstable, preventing seedlings from being used for large-scale breeding of superior varieties. This results in slow variety renewal and the loss of a large amount of superior genetic resources. Therefore, there is an urgent need to develop a convenient, low-cost, and scientific identification method, which is of great significance for promoting the breeding of superior varieties of camphor trees of the camphor and camphor types, the planting of medicinal raw material forests, and the in-depth development of related products.

[0004] Terpenoid synthases (TPSs) are key enzymes regulating the synthesis of terpenoid compounds in plants, determining product diversity, and their expression abundance is positively correlated with the accumulation of final products. It has been reported that multiple TPSs (terpenoid synthases) in camphor trees... CcTPS1 , CcTPS9 , CcTPS26 , CcTPS49 and CcTPS72Borneol can be generated in vitro via catalytic reaction (see reference 1: Ma Qing, Ma Rui, Su Ping, et al. Systematic identification of key terpene synthases for the formation of camphor chemotype [J]. Chinese Journal of Traditional Chinese Medicine, 2023, 48(09): 2307-2315; reference 2: Yang Z, Zhan T, Xie C, et al. Genome-wide analysis and functional characterization on the TPS family provide insight into the biosynthesis of mono-terpenes in the camphor tree. Plant Physiol Biochem. 2023, 196: 55-64), which is then oxidized to camphor by borneol dehydrogenase (see reference: Ma R, Su P, Jin BL, et al. Molecular cloning and functional identification of a high-efficiency (+)-borneoldehydrogenase from Cinnamomum camphora (L.) Presl. Plant PhysiolBioch, 2021, 158: 363-371). However, related studies have not identified the "key" factor that dominates borneol synthesis in camphor trees. TPS "Genes", and the actual technical development of molecular markers for rapid and efficient identification of camphor trees of the borneol and camphor types has not been carried out. Summary of the Invention

[0005] The purpose of this invention is to provide a molecular marker for identifying camphor-type and borneol-type camphor trees and its application, solving the cost and technical problems existing in current methods. This invention is based on a key borneol synthase gene. CcTPS9 Based on its intron sequence, a molecular marker WZN02 was developed to identify camphor-type and camphor-type camphor trees, which can quickly and accurately identify the two types of camphor trees.

[0006] In a first aspect, the present invention provides a molecular marker WZN02 for identifying camphor-type and camphor-type camphor trees, comprising a primer pair consisting of an upstream primer WZN02-F with nucleotide sequences as shown in SEQ ID No. 1 and a downstream primer WZN02-R with nucleotide sequences as shown in SEQ ID No. 2.

[0007] In a second aspect, the present invention provides a method for developing the above-mentioned molecular marker, comprising: screening key candidate genes mediating camphor synthesis based on real-time quantitative PCR, obtaining intron sequences based on candidate genes, performing sequence alignment, designing specific primer pairs by selecting intron polymorphic regions, and verifying the development of molecular markers;

[0008] The candidate gene is the borneol synthase gene. CcTPS9 The intron sequences include the INT1 sequence, the INT2 sequence, and the INT3 sequence.

[0009] Furthermore, the INT1 sequence, INT2 sequence, and INT3 sequence are shown as SEQ ID No. 3, SEQ ID No. 4, and SEQ ID No. 5, respectively.

[0010] Furthermore, the intron polymorphic region is selected from the intron region of the INT1 sequence at positions 408 bp-1064 bp.

[0011] Thirdly, the present invention provides the application of the above-mentioned molecular markers or molecular markers developed by any of the above methods in the identification and screening of camphor-type and camphor-type camphor trees, including the following steps:

[0012] S1. Extract genomic DNA from individual camphor trees of different chemotypes to be tested;

[0013] S2. Using individual genomic DNA as a template, PCR amplification was performed using WZN02 primers;

[0014] S3. When the target band obtained by amplification is 512 bp, it is determined to be camphor-type and / or camphor-type camphor tree.

[0015] Optionally, the PCR amplification reaction system described in S2 is: 10 μL of 2×EasyTaq Mix, 100 ng of DNA, 0.5 μL each of 10 μmol / L WZN02-F and 10 μmol / L WZN02-R, and ddH2O to a final volume of 20 μL.

[0016] Optionally, the PCR amplification setup in S2 is as follows: 94℃ pre-denaturation for 3 min; 94℃, 30 s, 60℃, 30 s, 72℃, 1 min, 40 cycles; 72℃ extension for 10 min.

[0017] The beneficial effects of this invention are as follows:

[0018] (1) This invention screened the gene encoding the key borneol synthase in camphor tree based on real-time fluorescence quantitative PCR. CcTPS9Based on the nucleotide sequence of this gene and the nucleotide sequence of its introns, a pair of molecular markers, WZN02, was developed for the rapid identification of camphor-type and camphor-type camphor trees. The molecular marker WZN02 achieved 100% accuracy in large-sample population validation experiments, demonstrating high accuracy, simple operation, and low cost, and thus has broad application value.

[0019] (2) The molecular marker WZN02 provided by this invention and its application in identifying camphor-type and camphor-type camphor trees. This identification application can be applied to the identification of tree species in the seedling stage, which can greatly improve the breeding efficiency of camphor-type camphor trees. This invention is not only beneficial to the identification of camphor tree varieties and the cultivation of camphor-type camphor industrial raw material forests, but also provides important theoretical guidance for the analysis of camphor tree kinship and the formation mechanism of different chemical types. Attached Figure Description

[0020] Figure 1 In Embodiment 1 of the present invention CcTPS9 A graph showing the expression levels of genes in leaf tissues of camphor trees with different chemotypes;

[0021] Figure 2 This is an agarose gel electrophoresis image of the intron sequence product amplified by PCR in Example 2 of the present invention;

[0022] Figure 3 The alignment results of the intron region in the INT1 sequence with the linalool-type camphor tree genome sequence in Example 3 of this invention;

[0023] Figure 4 This is an agarose gel electrophoresis image of the PCR products of five chemical types of camphor trees initially amplified by the molecular marker WZN02 in Example 3 of this invention;

[0024] Figure 5 This is an electrophoresis image of PCR products from six chemotype camphor tree population samples detected by molecular marker WZNO2 in Example 4 of this invention;

[0025] Figure 6 This is a GC-MS analysis diagram of essential oil from the leaves of 6 camphor trees randomly sampled in Example 4 of the present invention. Detailed Implementation

[0026] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Unless otherwise defined, the technical or scientific terms used herein should have the ordinary meaning understood by those skilled in the art to which this invention pertains.

[0027] In the following embodiments, operations not described in detail are all conventional technical operations, which can be performed with reference to the experimental equipment manual, guidance manual, and existing publicly available journal literature. The embodiments and drawings are for explanation only and are not intended to limit the scope of protection of the present invention. Example 1

[0028] Example 1 analyzes the borneol synthase gene based on real-time quantitative PCR. CcTPS The expression levels of 9 in six chemotypes of camphor tree leaf tissues were selected. CcTPS9 The gene was identified as a key candidate gene and subsequent operations were performed. The specific steps are as follows:

[0029] (1) Samples of young camphor leaves of six chemical types, namely camphor type, camphor type, linalool type, eucalyptol type, nerolidol type and methyleugenol type, were collected from the Lauraceae plant gene bank of Jiangxi Forestry Science and were quickly placed in liquid nitrogen for preservation.

[0030] (2) The frozen leaf samples were ground and total RNA was extracted using the polysaccharide and polyphenol plant RNA extraction kit (model ZH120) produced by Beijing Huayueyang Biotechnology Co., Ltd. Then, the quality and concentration of the extracted total RNA were rigorously evaluated by agarose gel electrophoresis combined with spectrophotometer detection to ensure that the RNA samples meet the requirements of subsequent experiments.

[0031] (3) Take 100 ng of total RNA sample that has passed quality assessment, and use the EasyScript All-in-One First-Strand cDNA Synthesis Kit produced by Beijing TransGen Biotech Co., Ltd. (TransGen Biotech) to complete the reverse transcription reaction and successfully synthesize cDNA.

[0032] (4) Design specific primers for real-time quantitative PCR experiments and select camphor trees. β -The Actin gene is used as an internal reference gene, and its upstream and downstream primer sequences are shown in SEQ ID NO.6 and SEQ ID NO.7, respectively; Meanwhile, targeting... CcTPS9 Gene (Genebank accession number: OP879876), upstream and downstream primers were designed, and their sequences are shown in SEQ ID NO.8 and SEQ ID NO.9, respectively.

[0033] (5) Real-time quantitative PCR was performed using a universal dye-based premixed PCR solution produced by TransGen Biotech. The reaction system consisted of: 10 μL Super Mix, 50 ng cDNA, 0.4 μL each of forward and reverse primers (10 μmol / L), with the remainder made up to 20 μL with ddH2O. The amplification reaction was performed using a Bio-Rad CFX96 Touch qPCR instrument. The specific program was set as follows: 95℃ pre-denaturation for 30 s, followed by 40 cycles, each cycle including 95℃ denaturation for 10 s, 60℃ annealing and extension for 30 s. A melting curve analysis step was added after the reaction to ensure the specificity of the amplified products.

[0034] (6) To ensure the reliability and accuracy of the data, three replicate experiments were set up for each sample. Statistical analysis of the experimental data was performed using 2... -ΔΔCT Methods for analyzing different chemical types of camphor tree leaf tissues CcTPS9 The relative expression levels of genes are quantitatively compared.

[0035] like Figure 1 As shown, CcTPS9 The expression level of this gene in camphor and borneol-type camphor leaves was significantly higher than that in the other four chemotypes, suggesting that this gene is very likely a key catalyst for camphor synthesis. TPS Based on this, it was identified as a key candidate gene and will be used to further develop molecular markers specific to camphor and camphor types of camphor trees. Example 2

[0036] This embodiment 2 provides CcTPS9 The specific steps for obtaining the intron sequence of a gene are as follows:

[0037] (1) Based on homologous gene structure analysis, predict CcTPS9 The gene may contain six introns. Therefore, six pairs of specific primers were designed for amplification. CcTPS9 Intron sequences of a gene;

[0038] (2) Six chemically derived camphor tree DNAs were extracted using a universal plant genomic DNA extraction kit produced by TransGen Biotech.

[0039] (3) Amplify the intron sequence by PCR technology; the specific reaction system is 10 μL of 2×EasyTaq Mix, 100 ng of DNA, 0.5 μL each of upstream and downstream primers (10 μmol / L), and ddH2O to 20 μL; the reaction program is: 94℃ pre-denaturation for 3 min: 94℃, 30 s, 55℃, 30 s, 72℃, 2 min, 40 cycles; 72℃ extension for 10 min.

[0040] (4) Detection of PCR reaction products by agarose gel electrophoresis ( Figure 2 The target band was recovered by gel extraction and purified, then ligated into the cloning vector pMD18-T (manufactured by TAKARA). The vector was transformed into Top10 competent E. coli cells by heat shock, plated on LB solid medium (containing ampicillin resistance), and cultured overnight. Positive single clones were selected and sent to Shanghai Sangon Biotech Co., Ltd. for Sanger sequencing.

[0041] The gel electrophoresis results are as follows Figure 2 As shown, three target intron sequences were successfully amplified, named INT1, INT2, and INT3, as shown in SEQ ID No. 3, SEQ ID No. 4, and SEQ ID No. 5, respectively. The specific primer pairs for amplifying these three intron sequences are as follows: primer pairs INT1-F and INT1-R are shown in SEQ ID No. 10 and SEQ ID No. 11; primer pairs INT2-F and INT2-R are shown in SEQ ID No. 12 and SEQ ID No. 13; and primer pairs INT3-F and INT3-R are shown in SEQ ID No. 14 and SEQ ID No. 15.

[0042] Sequencing results and CcTPS9 According to the CDS sequence alignment, the first intron INT1 is located between bases 222 and 223 of the CDS sequence, with a length of 1064 bp; the second intron INT2 is located between bases 1076 and 1077 of the CDS sequence, with a length of 759 bp; and the third intron INT3 is located between bases 1215 and 1216 of the CDS sequence, with a length of 540 bp.

[0043] In fact, the INT1, INT2, and INT3 sequences obtained by PCR amplification, as shown in SEQ ID No. 3, SEQ ID No. 4, and SEQ ID No. 5, contain intron regions and adjacent exon regions on both sides. Specifically, the intron region in the INT1 sequence is 196 bp to 1259 bp (total length 1064 bp), the intron region in the INT2 sequence is 101 bp to 859 bp (total length 759 bp), and the intron region in the INT3 sequence is 92 bp to 631 bp (total length 540 bp). Example 3

[0044] This embodiment 3, based on the intron sequence obtained in embodiment 2, further sequence alignment was performed to determine the intron polymorphic region and design specific primer pairs to obtain the molecular marker WZN02. The specific steps are as follows:

[0045] (1) Using blast software, CcTPS9 The CDS region sequence and the sequences of three intron regions of the gene were compared with the published genome sequence of *Cinnamomum camphora* (see: Wang XD, Xu CY, Zheng YJ, et al. Chromosome-level genome assembly and resequencing of camphor tree (Cinnamomum camphora) provides insight into phylogeny and diversification of terpenoid and triglyceride biosynthesis of Cinnamomum. Hortic Res. 2022,9:uhac216.). This *Cinnamomum camphora* genome sequence was used as the reference genome sequence and labeled Chr02.

[0046] (2) Through comparison, CcTPS9 The CDS, INT2, and INT3 sequences all showed homologous sequences with similarity exceeding 90%. However, the intron regions of the INT1 sequence had the lowest alignment rate; only the 148 bp-407 bp segment showed 78% similarity to the reference genome sequence. The remaining portions failed to align with homologous sequences showing similarity higher than 50%. The alignment results are shown below. Figure 3 Based on this result, the intron polymorphic region from 408 bp to 1064 bp in the INT1 sequence was selected as the intron polymorphic region. An upstream primer WZN02-F for the candidate marker was designed, with the sequence shown in SEQ ID No. 1 (TTGTCTTCCCATTAACAGTTC). A downstream primer WZN02-R was designed in the adjacent CDS region, with the sequence shown in SEQ ID No. 2 (TCATAACAGCGCTCGCCTG). Specific primer pairs were obtained to develop the molecular marker WZN02.

[0047] (3) Five different chemotypes of camphor tree DNA were randomly selected as templates for PCR reaction, and the PCR products were detected by agarose gel electrophoresis. Figure 4 ); The specific reaction system consisted of 10 μL of 2×EasyTaq Mix, 100 ng of DNA, 0.5 μL each of 10 μmol / L WZN02-F and 10 μmol / L WZN02-R, and ddH2O to a final volume of 20 μL. The reaction program was as follows: pre-denaturation at 94℃ for 3 min; 94℃ for 30 s, 60℃ for 30 s, 72℃ for 1 min, for 40 cycles; and extension at 72℃ for 10 min.

[0048] The agarose gel electrophoresis results of the preliminary amplification of five chemotype camphor tree PCR products using the molecular marker WZN02 are as follows: Figure 4 As shown, primers WZN02-F and WZN02-R successfully amplified bands of the same size (512 bp) as the target product only in the DNA of camphor-type and camphor-type camphor trees, while no effective amplification was observed in other chemical types of camphor trees. This result preliminarily indicates that the molecular marker WZN02 can effectively distinguish and track camphor-type and camphor-type camphor trees, demonstrating its potential as a specific molecular marker. Example 4

[0049] In Example 4, the population test of the developed molecular marker WZN02 was conducted to verify the accuracy of this molecular marker in tracking camphor trees of the borneol and camphor-type varieties. The specific steps are as follows:

[0050] (1) At the Jiangxi Academy of Forestry Sciences, 3-year-old seedlings were selected, and 16 camphor trees of the borneol type and camphor type were preliminarily screened using the empirical "fragrance method" (the borneol type camphor trees were numbered B1 to B16, and the camphor type was numbered Ca1 to Ca16). At the same time, 48 samples of camphor trees of the linalool type (numbered L1 to L16), nerolidol type (numbered N1 to N16), eucalyptol type (numbered Ci1 to Ci12), and methyl eugenol type (numbered M1 to M4) were collected.

[0051] (2) Extract DNA from 80 of the above camphor tree samples using the same extraction method as in Example 1.

[0052] (3) Using WZN02-F and WZN02-R as upstream and downstream primers, and each single-strain DNA as a template, PCR amplification reaction was carried out. The PCR amplification system and reaction conditions were the same as in Example 3.

[0053] (4) The PCR products were detected by agarose gel electrophoresis, and the results are as follows: Figure 5 As shown, the target product was successfully amplified in all 32 camphor and borneol-type camphor tree samples, while no effective amplification product was obtained in the other 48 chemical types of samples.

[0054] (5) Randomly select single plants with positive amplification results (numbered B4, Ca7 and Ca12) and negative results (numbered L9, Ci5 and M3), and collect 1 g of leaf samples from each. Extract leaf essential oil using organic solvent extraction method. The specific operation steps are as follows:

[0055] ① Grind the leaf samples rapidly into powder in liquid nitrogen; ② Transfer the powder to a 10 mL centrifuge tube, add 5 mL of n-hexane, and shake at low speed for 5 h on a shaker; ③ Centrifuge at high speed for 30 min, and transfer the supernatant to a 2 mL centrifuge tube; ④ Repeat step ③ once; ⑤ Filter the supernatant through a 0.22 μm filter membrane; ⑥ Finally, analyze the essential oil components using GC-MS. Helium was used as the carrier gas at a flow rate of 1.0 mL / min, and a split injection with a split ratio of 20:1 was employed.

[0056] Gas chromatography (GC) conditions: Inlet temperature 280℃, temperature program: initial column temperature 50℃, hold for 2 min, increase to 180℃ at 3℃ / min, hold for 2 min, then increase to 240℃ at 8℃ / min, hold for 5 min, total run time 60 min. Mass spectrometry (MS) conditions: Interface temperature 260℃, ion source temperature 180℃, scan range (m / z) 50-620.

[0057] (6) The test results are shown in Figure 6 Individual trees numbered B4, Ca7, and Ca12 were identified as camphor-type or borneol-type camphor trees, while individual trees numbered L9, Ci5, and M3 were identified as linalool-type, eucalyptol-type, and methyleugenol-type camphor trees, respectively. This result fully demonstrates that the molecular marker WZN02 can specifically track camphor-type and borneol-type camphor trees, validating its accuracy and effectiveness as a molecular marker.

[0058] In summary, the molecular marker WZN02 demonstrated 100% accuracy in tracking camphor-type and borneol-type camphor trees in Example 4. This outstanding performance not only validates its strong potential as an effective molecular marker but also provides a precise and efficient identification method for the breeding of superior varieties of camphor-type and borneol-type camphor trees and the in-depth development of their related medicinal value, which is expected to promote the rapid development of research and application in this field.

[0059] While embodiments of the present invention have been described in detail above, it will be apparent to those skilled in the art that various modifications and variations can be made to these embodiments. However, it should be understood that such modifications and variations fall within the scope and spirit of the invention as set forth in the claims. Furthermore, the invention described herein may have other embodiments and can be implemented or carried out in various ways.

Claims

1. A WZN02 primer for identifying camphor-type and camphor-type camphor trees, characterized in that, The primer pair consists of an upstream primer WZN02-F with a nucleotide sequence as shown in SEQ ID No. 1 and a downstream primer WZN02-R with a nucleotide sequence as shown in SEQ ID No.

2.

2. The application of the WZN02 primer as described in claim 1 in the identification of camphor-type and camphor-type camphor trees, characterized in that, Includes the following steps: S1. Extract genomic DNA from individual camphor trees of different chemotypes to be tested; S2. Using individual genomic DNA as a template, PCR amplification was performed using WZN02 primers; S3. When the target band obtained by amplification is 512 bp, it is determined to be camphor-type and / or camphor-type camphor tree.

3. The application according to claim 2, characterized in that, The PCR amplification reaction system described in S2 is as follows: 10 μL of 2×EasyTaq Mix, 100 ng of DNA, 0.5 μL each of 10 μmol / L WZN02-F and 10 μmol / L WZN02-R, and ddH2O to a final volume of 20 μL.

4. The application according to claim 2, characterized in that, The PCR amplification setup described in S2 is as follows: 94℃ pre-denaturation for 3 min; 94℃, 30 s, 60℃, 30 s, 72℃, 1 min, 40 cycles; 72℃ extension for 10 min.

Images