Gene, primer and method for specific molecular detection of alternaria ginseng and application of gene, primer and method
Through the use of Alternaria ginseng-specific molecular detection target genes and real-time fluorescence quantitative PCR methods, the problem of rapid and accurate detection of ginseng black spot pathogen was solved, early warning and efficient prevention and control of the disease were achieved, and scientific mathematical model support was provided.
Patent Information
- Application Number
- CN202511116291.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-11
- Publication Date
- 2025-09-09
- Estimated Expiration
- 2045-08-11
AI Technical Summary
Existing technologies make it difficult to quickly and accurately detect ginseng black spot pathogens, making disease prevention and control difficult. Traditional methods are time-consuming, have low success rates, and are easily affected by various factors.
A specific molecular detection target gene for Alternaria panax was designed, and a real-time fluorescence quantitative PCR method was developed using this gene. Qualitative and quantitative detection was performed using specific detection primers, and a mathematical model of the relationship between spore count and cycle threshold (Ct) was established.
It achieves rapid and accurate disease warning and early prevention and control, improves detection efficiency, reduces operational errors, provides scientific mathematical model support, ensures result stability, and provides a technical basis for precise prevention and control and disease management for ginseng cultivation.
Smart Images

Figure CN120608173A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of molecular detection, and in particular relates to specific molecular detection genes, primers, methods and applications of ginseng black spot pathogen. Background Art
[0002] Ginseng (Panax ginseng CA Meyer), belonging to the genus Panax in the Araliaceae family, is one of my country's most distinctive perennial medicinal plants, accounting for approximately 70% of the global annual production. With the expansion of ginseng cultivation area and the increase in years of cultivation, it is often infected by pathogenic fungi, resulting in a variety of diseases such as ginseng black spot, ginseng rust, ginseng sclerotinia rot, ginseng gray mold, and ginseng anthracnose.
[0003] Ginseng black spot disease is caused by infection of three fungi belonging to the Aspergillus, Hyphomycetes and Alternaria, namely Alternaria ginseng ( Alternaria alternata )、Alternaria ginseng( A. panax ) and Alternaria tenuissima ( A. tenuissima ), among which Alternaria ginseng ( A. panax ) is the most pathogenic. Black spot disease can occur in all parts of ginseng, but is most prevalent on leaves. Lesions initially appear yellowish-brown and water-soaked, gradually increasing in size to brown or grayish-brown with slight whorled streaks. Once symptoms appear on the plant, the pathogen spreads more widely, leading to an epidemic. Therefore, it is essential to detect and quantify pathogens in propagation materials and soil before planting ginseng. Compared to molecular biology techniques, traditional pathogen isolation and microscopic observation methods are time-consuming, have low success rates, are inaccurate, and are susceptible to various factors. Summary of the Invention
[0004] In view of the problems that ginseng black spot disease is common, harmful, and difficult to control, the present invention provides a ginseng alternaria ( A. panax ) molecular detection target gene, and used this gene to design specific detection primers and construct a real-time fluorescence quantitative PCR detection method to determine the ginseng Alternaria ginseng ( A. panax ) Under appropriate conditions, the minimum infection threshold is determined, and qualitative and quantitative detection of residual pathogens in the soil is carried out to provide a basis for early warning of diseases.
[0005] In order to solve the above-mentioned purpose, the present invention adopts the following technical solutions to achieve the goal: The specific molecular detection gene of Panax ginseng black spot pathogen has the nucleotide sequence shown in SEQ ID NO: 1.
[0006] Specific detection primers for the ginseng black spot pathogen Alternaria ginseng, comprising: a pair of primers whose base sequences are shown as SEQ ID NO: 2 and SEQ ID NO: 3.
[0007] Preferably, the specific detection primers further include: a pair of primers whose base sequences are shown as SEQ ID NO: 4 and SEQ ID NO: 5.
[0008] The method for detecting the ginseng black spot pathogen Alternaria ginseng comprises the following steps: 1) Extracting genomic DNA from microorganisms in the plants, seeds or soil to be tested; 2) using the genomic DNA from step 1) as a template, and performing PCR amplification using a pair of primers such as SEQ ID NO: 2 and SEQ ID NO: 3; 3) Determine the length of the PCR amplification products obtained in step 2). If a product having a size that meets the target detection value is detected in the PCR amplification products, it is determined that the source sample of the template genomic DNA contains Alternaria ginseng.
[0009] Preferably, in the detection method, the target detection value size is 413 bp.
[0010] Preferably, in the detection method, in step 2), the genomic DNA in step 1) can be used as a template to perform real-time fluorescence quantitative PCR amplification using a pair of primers such as SEQ ID NO: 4 and SEQ ID NO: 5.
[0011] Preferably, the detection method further comprises the following steps: when real-time fluorescence quantitative PCR amplification detection is used, the quantitative linear regression equation is y=-3.6597x+41.234, wherein y is the Ct value, x=lg[DNA concentration], the correlation coefficient R²>0.99 between the logarithm of the standard DNA concentration and the Ct value, and when the Ct value is ≥35, it is considered that the sample to be tested does not contain Alternaria ginseng, and when the Ct value is <35, it is considered that the sample to be tested contains Alternaria ginseng.
[0012] Preferably, in the detection method, the minimum concentration for real-time fluorescence quantitative PCR amplification detection is 0.5 fg / μL.
[0013] Preferably, in the detection method, an internal reference gene amplification system is simultaneously added to the PCR amplification step, wherein the internal reference gene is a microbial housekeeping gene that is stably present in the soil; when the Ct value of the internal reference gene deviates from the preset threshold by ±1.5, DNA purification compensation is initiated: DNA was re-extracted from the original soil samples using the chemical lysis-silica gel membrane adsorption method, including the addition of a humic acid scavenger; The purified DNA was retested for nucleic acid concentration and purity, and the results showed that A260 / A280 = 1.8-2.0 and A260 / A230 ≥ 1.8; Repeat the real-time fluorescence quantitative PCR test using the purified DNA as a template until the Ct value of the internal reference gene returns to the threshold range.
[0014] Preferably, in the detection method, when the Ct value is 34.5≤<35.5, a verification procedure is initiated, including any one or a combination of the following steps: a) Using PCR amplification reagents from different batches and manufacturers, re-test the same sample DNA with real-time fluorescence quantitative PCR; b) Use another real-time fluorescence quantitative PCR instrument to re-perform real-time fluorescence quantitative PCR on the same sample DNA; c) Calibration using the Ct value of the internal reference gene: Calculate the difference between the measured Ct value of the internal reference gene and its median value at the preset threshold; Add the difference to the Ct value to obtain the corrected Ct value; The Ct value obtained after retesting in steps a) and b) or the corrected Ct value calculated in step c) is used to re-determine whether the sample to be tested contains Alternaria ginseng.
[0015] The application of the nucleotide sequence or the detection primer in the detection of Alternaria ginseng or ginseng planting.
[0016] The present invention aims to find the pathogen of ginseng black spot disease Alternaria ginseng ( A. panax ) and used this gene to design specific primers for detecting black spot pathogens, leading to the development of a real-time fluorescence quantitative PCR method for detecting black spot pathogens. This method, based on the determination of the minimum infection threshold for black spot pathogens under appropriate conditions, allows for qualitative and quantitative detection of residual pathogens in soil, providing a basis for disease early warning, technical support for early disease prevention and control, and guaranteeing a high ginseng yield.
[0017] Compared with the prior art, the advantages and beneficial technical effects of the present invention are: The present invention screened out a specific sequence through bioinformatics analysis and comparison, and further developed molecular detection primers with strong specificity and high amplification efficiency for ginseng black spot pathogen through experimental screening. Through literature review and experimental verification, the primers used in the present invention and the corresponding two-step quantitative amplification technology model have better specificity and higher sensitivity, and the standard curve and regression equation are highly reliable. The present invention uses standard plasmids of different concentrations as templates to establish a fast, stable and accurate real-time fluorescence quantitative PCR detection method for the detection of Alternaria ginseng ( A. panax ) content. This method not only effectively improves detection efficiency but also reduces errors during operation, ensuring the stability of the results. Furthermore, the present invention further explores the relationship between spore count and cycle threshold (Ct), establishing a more scientific mathematical model. This research finding provides strong technical support for ginseng soil treatment, early diagnosis, and dynamic monitoring of black spot disease. It also provides a more accurate and reliable technical basis for rapid molecular testing of infected ginseng seeds and seedlings, contributing to precise prevention and control and more effective disease management in agricultural production.
[0018] Other advantages, objectives, and features of the embodiments of the present invention will be reflected in part through the following description, and in part will be understood by those skilled in the art through study and practice of the embodiments of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS
[0019] Figure 1 The primer specificity test verification results in one of the schemes of the present invention are shown in Figure 1. a is the verification result of 1-24, and b is the verification result of 25-28, where M is a DNA molecular weight marker, 1-8 are different strains of Alternaria ginseng. A. panax , 9-14: Different strains of Alternaria tenuifolia A. tenuissima ; 15-20: Different strains of Alternaria alternata A. alternata , 21: Alternaria solani A. solani , 22: Alternaria brassicae A. brassicicola , 23: Alternaria alternata A. alternata , 24: Alternaria tenuifolia A. tenuissima , 25: Alternaria alternata A. alternata , 26: Alternaria cyanus A. jacinthicola , 27: Alternaria sunflower A. helianthinficiens , 28: Alternaria sunflower A. helianthinficiens , 29: Alternaria longipes A. longipes , 30: Alternaria alternata A. alternata , 31: Alternaria tenuifolia A. tenuissima , 32: Alternaria alternata A. alternata , 33-39: Different strains of Botrytis cinerea Botrytis cinerea , 40: Botrytis cinereaB. fabae , 41: Phytophthora Phytophthora cactorum , 42: Ginseng spiny disc spore Colletotrichum panacicola , 43: Strong Earth Red Shell Ilyonectria robusta , 44: Rhizoctonia solani Rhizoctonia solani , 45: Fusarium oxysporum Fusarium oxysporium , 46: Phytophthora P. cactorum , 47: Sclerotinia Sclerotia sclerotiorum, 48:ddH2O (negative control).
[0020] Figure 2 This is a colony PCR verification diagram in one of the solutions of the present invention.
[0021] Figure 3 This is a graph showing the amplification curves of the real-time fluorescence quantitative PCR of the recombinant plasmid in one embodiment of the present invention, wherein the horizontal axis represents the cycle number and the vertical axis represents the fluorescence signal intensity. The curves in the graph are the amplification curves of the recombinant plasmid, other pathogenic fungi, and ddH2O, respectively.
[0022] Figure 4 The figure shows the primer sensitivity test verification result in one of the schemes of the present invention, wherein M is a DNA molecular weight marker, and the template concentrations in lanes 1-5 are: 100 ng / μL, 10 ng / μL, 1 ng / μL, 10 -1 ng / μL, 10 -2 ng / μL.
[0023] Figure 5 In one embodiment of the present invention, Q2-1-F and Q2-1-R are used as real-time fluorescence quantitative specific primers to detect the expression of the gene by real-time fluorescence quantitative PCR. A. panax Sensitivity test results graph.
[0024] Figure 6 This is a standard curve diagram established in one of the embodiments of the present invention.
[0025] Figure 7 This is a diagram showing the incidence of Alternaria ginseng caused by indoor artificial inoculation in one of the schemes of the present invention.
[0026] Figure 8 This is a curve for extracting soil genome for quantitative amplification after indoor inoculation with Alternaria ginseng in one of the schemes of the present invention, and an equation diagram showing the relationship between soil inoculation with spore suspension and disease incidence. DETAILED DESCRIPTION
[0027] To further illustrate the technical means and effects of the present invention, the present invention is further described below with reference to the embodiments and accompanying drawings. The specific embodiments described herein are only used to explain the present invention, not to limit the present invention.
[0028] It should be noted that the experimental methods described in the following embodiments are conventional methods unless otherwise specified, and the reagents and materials can be obtained from commercial channels unless otherwise specified.
[0029] Real-time fluorescence quantitative PCR is significantly superior to traditional methods and other molecular techniques in terms of detection time, sensitivity and quantification.
[0030] At present, the use of real-time fluorescence quantitative PCR technology to detect Alternaria ginseng ( A. panax) There is no relevant report on the research of this invention. A. panax ) and designed specific primers to develop a precise real-time fluorescence quantitative PCR detection method. This invention provides strong technical support for ginseng soil treatment, early diagnosis, and dynamic monitoring of black spot disease. It also provides a more accurate and reliable technical basis for rapid molecular detection of diseased ginseng seeds and seedlings, contributing to precise prevention and control and more effective disease management in agricultural production.
[0031] A ginseng black spot pathogenic fungus Alternaria ginseng ( A. panax ) specific fragments, pan-genome analysis and comparison of different species of Alternaria within the same genus identified a unique gene fragment. The sequence is shown in SEQ ID NO: 1: SEQ ID NO: 1 ATGGCACCTCGCAATCACGGTACCCAACGCGAAACTCCTCAAGCACATGCTCGTGGTGCAGAAGATGTTTCTCGTCCGACCAATATGGGTATCAACGCTAGACGCCCAACTGTAGCAGATCGCAACATCCTTAGCGCAAACACTGGCGCGGGTATCGGTGCCAGACGCTCAACTGCACCTACCAGTCGTACCAGTCGCAGTGGCAGTGACAAGCATCCACAGCGATGTCAACGCACCCCCCGAGTCCGCGGAACCGCTACCGCTGCCGTAACTCGCCCCCAGAACGATCGCGCTACAAGCTCAAGAACCCAAGGTACTACCAGACATCGTACCGACGCCGCATTCCGTGGTACAATGGCTCCTCCCACGACCCCCGGTTCGGTACCTATCCTCCCCCCGATCAACCCAGCACCCGTATCCACACCCGCTGCCCATCCCACCACCATACTCCCCATCCGCCAAGTCAACTCGAGCCCAGGTCATGCGTCGCCTGCGTTCAGTGGCAGATTAACACGCGTCTTCCCGGAGTCTCAGCGCAGGCTGGATCAAATTTCGCCTATCGGTCGGGACACGTCGTTTACTGTGGTGCCGAGGCCTATTCGCCTGTTTGATAGTATTTTGTCTACTGCTGCTGGTGGTGGTACACCCAGCCATATCAACCTCATCACCGGTCAGGGGTATGTGTATGTTCTCCTTCTCCTTCCATCCTTCCATGTCTAACATACTAACCACCCAGCCCCCTCCCGGTCCCCAAACCTCGTTCTTCAACGTACCGCGACCCCTCCTCTATCAAACACGCCGTCTCAAACCCCAATCTACGCGCTATCCTGTCCGACAAACCGTATCCGAGGGAGCGCAAGAAGTCTGCTGGGGAGCGACCGGTGTTGAAGATGGGGATTAGTAGGGAGTATAAGTGA To establish a prediction and forecasting mechanism for Alternaria panax, the present invention adopts the following technical solution: Alternaria panax, the pathogen of Alternaria panax disease A. panax) specific molecular detection primers, using the NCBI nr database to conduct a pan-genome comparison of different species of Alternaria in the same genus, identify common genes and unique genes, design primers through gene sequence comparison, and verify their amplification efficiency and specificity through experiments. The sequences of the primer pairs are as follows: 1-2-F: 5'-ATACGGGTGCTGGGTTGA-3' (SEQ ID NO: 2) 1-2-R: 5'-ACCTCGCAATCACGGTAC-3' (SEQ ID NO: 3) Q2-1-F: 5'-ATCGCTGTGGATGCTTGT-3' (SEQ ID NO: 4) Q2-1-R: 5'-CGTCCGACCAATATGGGTATC-3' (SEQ ID NO: 5) Specific molecular detection primers in Alternaria ginseng ( A. panax ) is to extract DNA from microorganisms in the plants, seeds or soil to be tested as a template, perform PCR amplification, and perform agarose gel electrophoresis on the amplified products. The results are tested under ultraviolet light. If a specific band of 413 bp is present, it proves that the test article contains Alternaria ginseng ( A. panax ).
[0032] Alternaria ginseng ( A. panax ) application of specific molecular detection primers in PCR detection. Through conventional PCR amplification verification, the primers can only be used in the presence of Alternaria ginseng ( A. panax ) DNA template, a 413 bp band was specifically amplified. It can be used to qualitatively detect whether isolated pathogens, diseased ginseng plants or soil contain ginseng black spot pathogen ( A. panax ).
[0033] Alternaria ginseng ( A. panax ) Application of specific molecular detection primers in real-time fluorescence quantitative PCR molecular detection, standard curve equation based on quantified standard DNA samples, correlation coefficient R between the logarithm of standard DNA concentration and Ct value 2 >0.99, the quantitative linear regression equation is y=-3.6597x+41.234, where y is the Ct value and x=lg[DNA concentration]. It can simultaneously qualitatively and quantitatively detect whether there is Alternaria ginseng in the sample ( A. panax ) exists, for the quantitative analysis of the unknown sample Alternaria ginseng ( A. panax ) provides a theoretical basis for the DNA.
[0034] It can predict the incidence of ginseng black spot disease. The minimum concentration of real-time fluorescence quantitative PCR detection is 0.5 fg / μL, which is more sensitive than ordinary PCR. A. panax ) detection amount was determined, and the relationship between spore number and Ct value was established by inoculating soil with spore suspension.
[0035] Example 1 DNA extraction and quantification After the test strains were cultured on potato dextrose agar (PDA) at 25°C for 5 days, approximately 50 mg of mycelium was gently scraped from the surface of the culture medium for genomic DNA extraction. Total genomic DNA from tissue samples and soil was extracted using the CTAB method and a soil genomic DNA extraction kit (TIANGEN Biotech, Beijing Co., Ltd.), respectively. The extracted DNA was purified and recovered, and quantified using a NanoDrop 2000. Genomic DNA with an A260:A280 ratio of 1.8 to 2.0 was used for conventional PCR and real-time fluorescence quantitative PCR. Passing samples were stored at -20°C until further use.
[0036] Example 2 Confirmation of primer specificity by conventional PCR The reaction system of conventional PCR is 20 μL, including 10 μL of TaqSuperMix enzyme, 1 μL of conventional PCR upstream and downstream primers, 1 μL of template DNA, and 7 μL of sterile water. The reaction conditions are 95 ℃ pre-denaturation for 3 min, 95 ℃ denaturation for 10 s, annealing at the optimal annealing temperature of conventional PCR primers for 10 s, 72 ℃ for 30 s, for a total of 34 cycles, and extension at 72 ℃ for 5 min. ddH2O was used instead of template as a negative control. The PCR amplification product was detected by 1% agarose gel electrophoresis. Figure 1 As shown, PCR amplification of different ginseng pathogenic fungi from different regions was performed. Primers were screened that amplified Alternaria ginseng, but not other ginseng pathogens. The specificity of the selected primers was verified using ddH2O as a control.
[0037] Example 3 Preparation of standard plasmids and verification of primer specificity for real-time fluorescence quantitative PCR by A. panaxThe sd3-3 strain was used as a template, and the pathogen DNA was amplified by conventional PCR using primers. The PCR product was recovered by gel excision using a conventional agarose gel DNA recovery kit (Sangon Biotech Shanghai Co., Ltd.). The recovered fragment was ligated with the pUCm-T vector at 16°C for 2 h, then transformed into Escherichia coli DH5α competent cells, spread on LB medium containing 100 μg / mL ampicillin, and cultured in a constant temperature incubator at 37°C for 12 h. After a single clone grew out, Figure 2 After successful colony PCR verification, single clones were screened; positive clones were inoculated into LB liquid medium containing 100 μg / mL ampicillin and cultured for 16-24 hours. Plasmids were extracted using a rapid plasmid DNA mini kit (TIANGEN Biotech, Beijing Co., Ltd.), amplified using primers, and identified by electrophoresis and enzyme digestion before being sent to the company for sequencing verification. After correct plasmid identification, the plasmid concentration was determined. The plasmid was tested by real-time fluorescence quantitative PCR. Figure 3 It can be seen that primer Q2-1F / R is only effective for A. panax The DNA template had a unique product amplification curve, while no signal was detected for other pathogenic fungi, proving the specificity of the primers.
[0038] Example 4 Evaluation of Real-time Fluorescence Quantitative PCR System and Generation of Real-time Fluorescence Quantitative PCR Standard Curve The pathogen genomic DNA was diluted in a 10-fold gradient to obtain five concentration gradients of genomic DNA (100 ng / μL, 10 ng / μL, 1 ng / μL, 10 -1 ng / μL, 10 -2 ng / μL) for PCR amplification. The weakest band observed was taken as the minimum detection limit to test the sensitivity of the pathogen PCR primers. A gradient dilution was performed according to the following plasmid copy number calculation formula. After 10-fold gradient dilution, 9 standard plasmid concentration gradients (1.65 × 10 −2 , 1.65 × 10 −1 , 1.65× 10 0 , 1.65 × 10 1 , 1.65 × 10 2 , 1.65 × 10 3 , 1.65 × 10 4 , 1.65 × 10 5 and 1.65 × 10 6copies / μL), and perform real-time fluorescence quantitative PCR amplification. The minimum detection limit is the smooth amplification curve and good repeatability, and the sensitivity of the real-time fluorescence quantitative PCR primers for detecting pathogens is determined. Figure 4 As shown, the lowest concentration of DNA that can be detected by PCR is 10 -1 ng / µL, and the minimum detection limit of real-time fluorescence quantitative PCR was 1.65×10 1 copies / μL( Figure 5 ), equivalent to a DNA concentration of 0.5 fg / μL.
[0039] The calculation formula of plasmid copy number is: plasmid copy number (copies / μL) = (6.02×10 -9 ×10 23 / mol) × plasmid concentration (g / mL) / [(vector length + fragment length) × 660] 1.65 × 10 1 -1.65 × 10 5 Real-time fluorescence quantitative PCR was performed using a standard plasmid containing 100 copies / µL of DNA as a template. Amplification was performed within each group (three replicates of the same qPCR experiment) and between groups (three replicates of the same qPCR experiment). The standard deviation (SD) and coefficient of variation (CV) of the Ct values were used as criteria. The analysis results are shown in Table 1. The maximum CV of the established qPCR system within the replicates was 1.06%, and the maximum CV of the established qPCR system between replicates was 1.67% (Table 1), indicating that the established qPCR system has good reproducibility.
[0040] 1.65 × 10 −2 -1.65 × 10 5 A standard plasmid with a concentration of copies / μL was used as a template to generate a qPCR standard curve. Real-time fluorescence quantitative PCR amplification was repeated three times for each plasmid concentration. The standard curve was plotted with the logarithm of the plasmid DNA concentration as the horizontal axis and the Ct value as the vertical axis. The standard curve equation was y = -3.6597x + 41.234, with a correlation coefficient of R. 2 =0.9968( Figure 6 ), indicating that the linear relationship is good.
[0041] Combined with the above experimental results, a Ct value of <35 was determined as the threshold for determining whether the strain contained Alternaria ginseng.
[0042] Example 5 Artificial inoculation of ginseng black spot pathogen and detection of infection threshold The surface of healthy ginseng leaves was disinfected with 75% alcohol for 2 minutes, 2% sodium hypochlorite for 1 minute, and rinsed with sterile water several times. The test strain was cultured in PDA medium for 1-2 weeks to prepare a spore suspension, and 20 μL of the spore suspension was inoculated into a single healthy ginseng leaf. The inoculated ginseng leaves were cultured at room temperature, and DNA was extracted at 0 h, 3 h, 6 h, 12 h, 24 h, 2 d, 3 d, 4 d, 5 d, 6 d, 7 d, and 8 d after infection, and verified by real-time fluorescence quantitative PCR. The observation results showed that the Ct value within 12 h after inoculation was >28.02 and the DNA abundance was <2.47 fg / μL; 4 d after inoculation, A. panax The content in ginseng leaves increased significantly to 89.26 fg / μL; on the 8th day of inoculation, the pathogens detected A. panax The highest content (1071.17 fg / μL) was observed, and the diseased area became darker and larger ( Figure 7 ).
[0043] Table 1 Repeatability analysis of real-time fluorescence quantitative PCR Table 2 Spore inoculated soil test results Serial number Spore count (spores / mL) Ct mean DNA concentration (fg / μL) 1 50 30.12 0.659746357 2 100 29.13 1.22995997 3 200 28.38 1.971631772 4 500 27.46 3.517325282 Example 6 Field sampling and detection of ginseng black spot pathogen Soil samples were collected from seven areas in Jilin Province where black spot disease often occurs. DNA was extracted from the samples and amplified using specific primers for conventional PCR and real-time fluorescence quantitative PCR. ddH2O was used as a negative control for each amplification. The conventional PCR amplification products were subjected to 1% agarose gel electrophoresis. The electrophoresis results were detected by a gel imaging system. The applicability of real-time fluorescence quantitative PCR primers was tested and the real-time fluorescence quantitative PCR amplification curve was observed. Figure 8 As shown in Table 3, Alternaria ginseng was detected in the soil of Tonghua City, Jilin Province.
[0044] Table 3 Quantitative detection results of Panax ginseng black spot pathogen in soil collected from different regions Serial number Sample No. Collection location Ginseng growth period Sample delivery date Black spot test results Ct value 1 BSZ Changbai Town, Baishan City, Jilin Province 4 2025.4.18 none 2 JLTH1 Tonghua, Jilin 4 2025.4.18 have 33.89±0.22 3 JLTH2 Tonghua, Jilin 4 2025.4.18 have 33.64±0.19 4 BSFSX Songjianghe Town, Fusong County, Baishan City, Jilin Province 4 2025.4.18 none 5 NMGKEQ Horqin, Inner Mongolia 4 2025.3.19 none 6 DD Dandong 4 2025.3.19 none 7 JLJA Ji'an City, Jilin Province 4 2025.3.19 none 8 SBS Dr. Shen 4 2025.3.19 none Example 7 DNA Purification Compensation Step 1: Soil DNA extraction and internal reference monitoring Soil samples from the 0-20 cm layer of a ginseng cultivation site in Tonghua, Jilin Province, were initially extracted using the TIANGEN Soil Genomic DNA Extraction Kit. Simultaneously, internal reference primers targeting a soil microbial housekeeping gene (16S rRNA) were added for real-time quantitative PCR amplification. The normal Ct value threshold for the internal reference gene was set at 28.5 ± 1.5 (i.e., between 27.0 and 30.0).
[0045] Step 2: Trigger the compensation process When the internal reference Ct value of a sample reaches 31.2 (offset +2.7), inhibitor interference is determined to exist, and the DNA purification compensation procedure is initiated: Take 1 g of original soil sample, add CTAB lysis solution containing 5% polyvinyl pyrrolidone, lyse in a water bath at 65 °C for 2 h, and purify by silica gel membrane adsorption column. Add humic acid scavenger (sodium citrate-EDTA mixture) during the elution stage The purified DNA was detected by NanoDrop, A260 / A280=1.92, A260 / A230=1.85 Step 3: Repeat the internal reference gene amplification using purified DNA as a template, achieving a Ct value of 29.1, which returned to the threshold range. Subsequently, specific detection for Alternaria ginseng was performed, with a Ct value of 33.8 (not detected before calibration).
[0046] Example 8 During the testing process, when the Ct value of a soil sample from the ginseng-growing area of Changbai Mountain was 34.8 (within the critical range of 34.5≤Ct value<35.5), the review and verification procedure was initiated. First, another batch of PCR reagents was used to retest the same DNA template, and the measured Ct value was 34.6; then, the real-time fluorescence quantitative PCR instrument from a different manufacturer was used for retesting, and the result was 34.9. At the same time, the internal reference gene correction method was used to calculate: the actual measured Ct value of the internal reference gene of the sample was 29.3, which differed from the preset threshold median of 28.5 by +0.8. This difference was added to the original Ct value of 34.8 to obtain a corrected Ct value of 35.6. Combining the three results, it was determined that the sample did not contain Alternaria ginseng. This process significantly reduces the risk of false positives and ensures the reliability of the test results.
[0047] Although the embodiments of the present invention have been disclosed above, they are not limited to the applications listed in the description and embodiments. They can be applied to a variety of fields suitable for the embodiments of the present invention. Those skilled in the art will readily realize further modifications. Therefore, without departing from the general concept defined by the claims and their equivalents, the embodiments of the present invention are not limited to the specific details and illustrations shown and described herein.
Claims
1. A specific molecular detection gene for Panax ginseng black spot pathogen, characterized in that: It is the nucleotide sequence shown in SEQ ID NO:
1.
2. Specific detection primers for the ginseng black spot pathogen Alternaria ginseng, characterized in that: The primers include: a pair of primers whose base sequences are shown as SEQ ID NO: 2 and SEQ ID NO:
3.
3. The specific detection primer according to claim 2, wherein The primers further include: a pair of primers whose base sequences are shown as SEQ ID NO: 4 and SEQ ID NO:
5.
4. A method for detecting ginseng black spot pathogen Alternaria ginseng, characterized in that: 1) Extracting genomic DNA from microorganisms in the plants, seeds or soil to be tested; 2) using the genomic DNA from step 1) as a template, and performing PCR amplification using a pair of primers such as SEQ ID NO: 2 and SEQ ID NO: 3; 3) Determine the length of the PCR amplification products obtained in step 2). If a product having a size that meets the target detection value is detected in the PCR amplification products, it is determined that the source sample of the template genomic DNA contains Alternaria ginseng.
5. The detection method according to claim 4, wherein In step 2), the genomic DNA in step 1) can be used as a template to perform real-time fluorescence quantitative PCR amplification using a pair of primers such as SEQ ID NO: 4 and SEQ ID NO:
5.
6. The detection method according to claim 5, wherein When real-time fluorescence quantitative PCR amplification detection is used, the following steps are also performed: The quantitative linear regression equation is y=-3.6597x+41.234, where y is the Ct value, x=lg[DNA concentration], and the correlation coefficient R² > 0.99 between the logarithmic value of the standard DNA concentration and the Ct value. When the Ct value is ≥35, it is considered that the sample does not contain Alternaria ginseng, and when the Ct value is <35, it is considered that the sample contains Alternaria ginseng.
7. The detection method according to claim 5, wherein The minimum concentration for real-time fluorescence quantitative PCR amplification detection was 0.5 fg / μL.
8. The detection method according to claim 5, wherein During the PCR amplification step, an internal reference gene amplification system is added simultaneously. The internal reference gene is a microbial housekeeping gene that is stably present in the soil. When the Ct value of the internal reference gene deviates from the preset threshold by ±1.5, DNA purification compensation is initiated: DNA was re-extracted from the original soil samples using the chemical lysis-silica gel membrane adsorption method, including the addition of a humic acid scavenger; The purified DNA was retested for nucleic acid concentration and purity, and A260 / A280 was 1.8-2.0 and A260 / A230 ≥ 1.
8. Real-time fluorescence quantitative PCR was repeated using the purified DNA as a template until the Ct value of the internal reference gene returned to the threshold range.
9. The detection method according to claim 8, wherein When the Ct value is 34.5≤ < 35.5, initiate the verification procedure, which includes any one or a combination of the following steps: a) Using PCR amplification reagents from different batches and manufacturers, re-test the same sample DNA with real-time fluorescence quantitative PCR; b) Use another real-time fluorescence quantitative PCR instrument to re-perform real-time fluorescence quantitative PCR on the same sample DNA; c) Calibration using the Ct value of the internal reference gene: Calculate the difference between the measured Ct value of the internal reference gene and its median value at the preset threshold; Add the difference to the Ct value to obtain the corrected Ct value; The Ct value obtained after retesting in steps a) and b) or the corrected Ct value calculated in step c) is used to re-determine whether the sample to be tested contains Alternaria ginseng.
10. Use of the nucleotide sequence according to claim 1 or the detection primer according to claim 3 in the detection of Alternaria ginseng or ginseng cultivation.
Citation Information
Patent Citations
Detection primer and molecular detection method of wheat black point dominant pathogen alternaria
CN103088138A
Real-time PCR (polymerase chain reaction) detection primer for pathogenic bacteria fusarium oxysporum of root rot disease of pseudo-ginseng and detection method
CN109457043A
Specific primer for identifying and detectingAlternaria panax in Panax ginseng
KR1020070048098A
Cited By
Colletotrichum ginseng specific molecular target, primer group, detection method and application
CN121272110A
Specific molecular target of ginseng-colletotrichum, primer set, detection method and application
CN121272110B