Preparation method and application of bio-enzyme-nano-enzyme cascade floating microspheres
By preparing bioenzyme-nanozyme cascade floating microspheres and combining the composite structure of ZIF nanozyme and NfsB bioenzyme, the problems of low efficiency, harsh conditions and poor stability in traditional methods were solved, and efficient and environmentally friendly organic phosphorus degradation was achieved.
Patent Information
- Application Number
- CN202510727158.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-03
- Publication Date
- 2025-09-12
AI Technical Summary
Traditional organophosphorus degradation methods have low efficiency, harsh reaction conditions, and poor enzyme stability, making it difficult to effectively degrade organophosphorus pollutants in complex environments.
The preparation method of bioenzyme-nanozyme cascade floating microspheres was adopted, combined with the composite structure of ZIF nanozyme and NfsB bioenzyme, and an efficient cascade reaction system was constructed through 3D printing technology to prepare a floating and recyclable microsphere structure.
It achieves rapid degradation of organophosphorus, improves enzyme stability and reusability, reduces industrial costs, is suitable for efficient degradation in complex environments, and avoids secondary pollution.
Smart Images
Figure CN120618529A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of enzyme immobilization, and in particular relates to a preparation method and application of bioenzyme-nanozyme cascade floating microspheres. Background Art
[0002] Organophosphorus compounds pose a serious threat to the environment and organisms due to their high toxicity. These compounds are widely present in pesticides, industrial wastewater, and certain chemicals. Once they enter the ecosystem, they can have profound negative impacts on soil, water, and biodiversity. For example, organophosphorus pesticides are widely used in agricultural production, but due to their difficult-to-degrade properties, residual pesticides can enter water bodies through soil infiltration, surface runoff, and other means, thereby affecting the survival and reproduction of aquatic organisms. In addition, organophosphorus compounds may also accumulate in the food chain, posing potential hazards to higher organisms and even human health. Therefore, how to effectively degrade and remove organophosphorus pollutants has become an important issue that needs to be urgently addressed in the fields of environmental science and ecology.
[0003] However, traditional organophosphorus degradation methods have numerous limitations that significantly impact their effectiveness in practical applications. First, traditional physical and chemical methods generally have low degradation efficiencies, making it difficult to effectively remove organophosphorus pollutants in a short period of time. For example, in some industrial wastewaters, organophosphorus compounds are present at high concentrations, and traditional enzymatic degradation methods can take weeks or even months to achieve optimal treatment results, which clearly falls short of the requirements for rapid treatment. Second, these methods often require harsh reaction conditions, such as high temperatures, high pressures, or extreme pH values. This not only limits their applicability in practical environments but can also lead to equipment corrosion and energy waste. For example, certain chemical oxidation methods require high temperatures and high pressures, which not only increases equipment costs but also poses potential safety risks. Furthermore, traditional enzymatic degradation methods suffer from poor stability, with some enzymes easily inactivated at high temperatures or extreme pH levels, significantly reducing degradation efficiency and making them difficult to meet the requirements for sustained degradation in complex environments. In complex natural environments, such as contaminated rivers or soils, organophosphorus degradation often requires water containing impurities or high temperatures, where traditional methods often exhibit significant incompatibility, further limiting their scope of application. Summary of the Invention
[0004] The purpose of the present invention is to overcome the defects of the prior art and provide a method for preparing bioenzyme-nanozyme cascade floating microspheres.
[0005] Another object of the present invention is to provide the use of the bioenzyme-nanozyme cascade floating microspheres prepared by the above preparation method.
[0006] The technical solutions of the present invention are as follows:
[0007] A method for preparing bioenzyme-nanozyme cascade floating microspheres comprises: mixing sodium alginate, hollow microsphere powder and Tris-HCl buffer, heating and stirring until completely dissolved; after cooling, adding a ZIF@NfsB complex prepared by mixing ZIF nanozyme and NfsB bioenzyme, and thoroughly mixing to form bio-ink; loading the bio-ink into a 3D printer, introducing a model of a three-dimensional structure of spherical particles for printing and shaping, and placing the spherical particles after shaping in a CaCl2 solution for cross-linking and fixation to prepare the bioenzyme-nanozyme cascade floating microspheres.
[0008] In a preferred embodiment of the present invention, the concentration of sodium alginate in the bio-ink is 1.8-2.6 wt %.
[0009] In a preferred embodiment of the present invention, the concentration of the hollow microsphere powder in the bio-ink is 1.8-2.6 wt %.
[0010] In a preferred embodiment of the present invention, in the bio-ink, the concentration of the ZIF@NfsB complex is 0.08-0.20 wt %, and the mass ratio of the ZIF nanozyme to the NfsB bioenzyme in the ZIF@NfsB complex is 0.8-1.2:2.8-3.2.
[0011] In a preferred embodiment of the present invention, in the bio-ink, the concentration of sodium alginate is 1.8-2.6wt%, the concentration of hollow microsphere powder is 1.8-2.6wt%, the concentration of ZIF@NfsB complex is 0.08-0.20wt%, and the mass ratio of ZIF nanozyme and NfsB bioenzyme in the ZIF@NfsB complex is 0.8-1.2:2.8-3.2.
[0012] In a preferred embodiment of the present invention, sodium alginate, hollow microsphere powder and Tris-HCl buffer with a pH of 7.0-9.0 are mixed, and heated and stirred at 80-100° C. until completely dissolved.
[0013] More preferably, the heating and stirring speed is 100-500 r / min.
[0014] More preferably, the concentration of the CaCl2 solution is 5-20 wt%.
[0015] The bioenzyme-nanozyme cascade floating microspheres prepared by the above preparation method are used in the treatment of organophosphorus compounds.
[0016] A method for treating organophosphorus compounds comprises: using the bioenzyme-nanozyme cascade floating microspheres prepared by the above preparation method.
[0017] The beneficial effects of the present invention are:
[0018] 1. The present invention solves the problems of low efficiency, harsh reaction conditions and poor stability of traditional degradation methods. In particular, it develops an efficient and stable degradation technology to address the problem of enzyme inactivation under high temperature or extreme pH conditions.
[0019] 2. The present invention designs a floatable and recyclable microsphere structure, which effectively solves the problem of enzyme immobilization, avoids the loss of enzyme activity caused by traditional immobilization methods, improves the reusability of the enzyme, and reduces industrial costs.
[0020] 3. The present invention constructs an efficient cascade reaction system through the composite structure of ZIF nanozyme and NfsB bioenzyme, combined with 3D printing technology, to achieve rapid degradation of organophosphorus and improve degradation efficiency.
[0021] 4. The present invention combines the green and environmental protection concept of enzyme cascade degradation, reduces the use of chemical reagents in traditional degradation methods, avoids secondary pollution, reduces industrial application costs, and helps achieve the goal of green environmental protection.
[0022] 5. The present invention designs a ZIF nanozyme with high-temperature stability, which enables it to maintain efficient degradation ability in harsh environments such as water containing impurities or high temperature, thereby improving its applicability and reliability in practical applications.
[0023] 6. The present invention solves the problems of low efficiency of organophosphorus degradation by traditional physical and chemical methods and poor stability, high cost and difficulty in reuse of organophosphorus degradation by biological enzymes through enzyme immobilization technology and cascade reaction system design. It provides a new technical solution for the efficient degradation of organophosphorus, which has important practical significance and broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS
[0024] Figure 1 This is a scanning electron microscope photograph of the ZIF nanozyme prepared in Example 1 of the present invention.
[0025] Figure 2 This is the FTIR spectrum of the ZIF nanozyme prepared in Example 1 of the present invention.
[0026] Figure 3 This is an SDS-PAGE electrophoresis analysis of the NfsB enzyme prepared in Example 1 of the present invention. Wherein: M: Maker; 1: Protein supernatant; 2: 20 mM imidazole; 3: 40 mM imidazole; 4: 50 mM imidazole; 5: 80 mM imidazole; 6: 100 mM imidazole; 7: 200 mM imidazole; 8: 500 mM imidazole; 9: 1 M imidazole.
[0027] Figure 4 It shows that the ZIF@NfsB interface microspheres prepared in Example 1 of the present invention are floating on the water surface.
[0028] Figure 5 The different reaction conditions of ZIF@NfsB interface floating microspheres prepared in Example 1 of the present invention are shown.
[0029] Figure 6 This shows the reaction repeatability of the ZIF@NfsB interface floating microspheres prepared in Example 1 of the present invention.
[0030] Figure 7 The thermal stability of the ZIF@NfsB interface floating microspheres prepared in Example 1 of the present invention is shown. DETAILED DESCRIPTION
[0031] The technical solution of the present invention is further illustrated and described below through specific implementation methods in conjunction with the accompanying drawings.
[0032] Example 1
[0033] (1) Preparation of ZIF nanozymes:
[0034] 0.26346 g of zinc acetate dihydrate (Zn(CH3COOH)2·2H2O) and 0.057654 g of imidazole-2-carboxaldehyde (2-ICA) were weighed and added to 6 mL of dimethylformamide (DMF) solution, mixed and stirred for 10 min until the solid dissolved, and then the two solutions were mixed for 280 r·min. -1 After stirring at room temperature for 5 minutes and reacting for 5 minutes, 30 mL of DMF was added to the reaction mixture to further stabilize the spheres, and then centrifuged at 8000 rpm for 10 minutes to separate the particles. Then, it was washed with 30 mL of ethanol (EtOH) and centrifuged again at 8000 rpm for 15 minutes. The washing process was repeated 5 times. The resulting material was dried under vacuum at 80 ° C for 24 hours to obtain ZIF nanozyme (ZIF-90), and stored at 4 ° C in the dark. Figure 1 As shown in FIG, the ZIF-90 has a typical rhombohedral shape, a smooth surface, and a uniform particle size of about 70 nm. Figure 2 As shown, the Fourier transform infrared (FTIR) spectrum is at about 795 cm -1 The Zn-N stretching vibration band was detected at 1660 cm -1 An obvious stretching vibration peak was detected at , corresponding to the C=O stretching vibration of the aldehyde group in the imidazole ligand, thus confirming the chemical structure of ZIF-90. The presence of active aldehyde groups promoted the functional modification of ZIF-90.
[0035] (2) Preparation of NfsB enzyme:
[0036] a. Target gene transformation
[0037] Plasmid construction: The gene encoding the NfsB biocatalyst (SEQ ID NO.01:
[0038] ccatcatcatcatcatcacagcagcggcctggtgccgcgcggcagccatatggatattattagcgtggcgctgaaacgccatagcaccaa
[0039] agcgtttgatgcgagcaaaaaactgaccccggaacaagcggaacagattaaaaccctgctgcagtatagcccgagcagcaccaacagt
[0040] cagccgtggcattttattgtggcgagcaccgaagaaggcaaagcgcgcgtggcgaaaagcgcggcgggcaactatgtgtttaacgaac
[0041] gcaaaatgctggatgcgagccatgtggttgtgttttgcgcgaaaaccgcgatggatgatgtgtggctgaaactggtggtggatcaagaag
[0042] atgcggatggccgctttgcgaccccggaagcgaaagcggcgaacgataaaggccgcaaattttttgcggatatgcatcgcaaagatctg
[0043] catgatgatgcggaatggatggcgaaacaagtgtatctgaacgtgggcaactttctgctgggcgtggcggcgctgggcctggatgcggt
[0044] gccgattgaaggctttgatgcggcgattctggatgcggaatttggcctgaaagaaaaaggctatacgagcctggtggttgtgccggtggg
[0045] ccatcatagcgtggaagattttaacgcgaccctgccgaaaagccgcctgccgcagaacattaccctgaccgaagtgctcgagcaccaccaccaccaccact) was constructed into the pET 28b plasmid, and a 6×His tag was added to the protein tail by gene editing.
[0046] Transformation: Under sterile conditions, dissolve the plasmid powder in 40 μL ddH2O, add 1-2 μL of the plasmid vector to the competent E. coli BL21 cell, incubate on ice for 20-30 min, heat shock in a 42°C water bath for 60-90 s, incubate on ice again for 2-5 min, add 1 mL of LB medium, and culture at 37°C with shaking for 40 min.
[0047] Amplification: Add 4 mL of LB medium containing 50 μg / mL kanamycin to the transformed bacterial suspension and culture at 37°C with shaking overnight.
[0048] b. Target protein expression
[0049] Seed preservation: Mix 500 μL of the above bacterial solution with 500 μL of sterilized 50% glycerol and freeze at -80°C.
[0050] Induction: Transfer 4 mL of the above bacterial solution into 400 mL of LB medium to which the corresponding antibiotics have been added, and culture on a shaking platform at 37°C until the OD 600 When the pH value reached between 0.6 and 0.8, IPTG with a final concentration of 0.5 mmol / L was added to induce expression, and then cultured in a shaking incubator at 16°C for 18 to 20 h.
[0051] Cell collection: Transfer the induced bacterial solution to a centrifuge bottle and centrifuge at 4000 rpm for 13 min in a high-speed centrifuge. Discard the supernatant and retain the precipitate. Add approximately 20-30 mL of buffer (20 mmol / L Tris-HCl, 100 mmol / L NaCl, pH 8.0) to resuspend the cell. After resuspension, transfer the cell to a 50 mL centrifuge tube and store in a -20°C refrigerator for later use.
[0052] Disruption and Centrifugation: Thaw the collected cell suspension at room temperature and transfer it to a small beaker. While in an ice bath, raise and lower the probe until it is 1-2 cm below the liquid surface. Set the operating parameters to ultrasound on for 2 seconds, off for 2 seconds, set the alarm temperature to 25.0°C, and ultrasonic power to 50%. After 30 minutes of operation, remove the disruption solution and transfer it to a 50mL centrifuge tube. Centrifuge at 9500 rpm at 4°C for 60 minutes. Separate the supernatant and pellet. Place the supernatant tube in an ice box for use in the next step.
[0053] c. Nickel column affinity purification
[0054] After equilibration of the column, add the protein supernatant to the column at a flow rate of 1 mL / min. Elute the protein by adding different concentrations of imidazole. Collect the corresponding supernatants, label them, and perform SDS-PAGE electrophoresis to determine protein concentration. Find the enzyme-eluted solution that elutes the NfsB protein with the highest degree of purification.
[0055] d. SDS-PAGE electrophoresis detection
[0056] Prepare samples of the supernatants corresponding to different concentrations of imidazole and perform SDS-PAGE detection. Then, based on the results of SDS-PAGE electrophoresis, select the imidazole concentration that produces the most target protein in the supernatant, determine the elution concentration of the NfsB enzyme, and express the NfsB enzyme (NfsB) in large quantities. The theoretical molecular weight of the NfsB enzyme is 27.1kDa. According to the comparison of the Maker bands, the target protein band should be between the 35kDa and 48kDa Maker bands. Figure 3 As shown, there are clear protein bands between the 25kDa and 35kDa bands, and protein bands appear at 100mM imidazole and 1M imidazole, with a large amount of target protein appearing at 500mM imidazole. Therefore, the imidazole concentration for washing the NfsB enzyme was determined to be 100mM, and the imidazole concentration for elution was determined to be 500mM imidazole.
[0057] (3) Preparation of ZIF@NfsB interface floating microspheres
[0058] Sodium alginate, hollow microsphere powder (3M TM Hollow glass microspheres (S15) were mixed with Tris-HCl buffer at pH 7.0, heated and stirred at 80°C until completely dissolved at a stirring speed of 400 r / min. After cooling, the ZIF nanozyme (ZIF-90) prepared in step (1) and the NfsB bioenzyme (NfsB) prepared in step (2) were added to prepare a ZIF@NfsB complex, and the mixture was thoroughly mixed to form a bio-ink (the concentration of sodium alginate was 2wt%, the concentration of hollow microsphere powder was 0.8wt%, and the ZIF@NfsB complex was 0.13wt% (the mass ratio of ZIF-90 and NfsB was 1:3). The mass concentration of this complex refers to the sum of the mass of the bioenzyme and nanozyme divided by the mass of the entire bio-ink). The bio-ink was loaded into a 3D printer, and a three-dimensional structure model of spherical particles was introduced for printing (printing parameters were: using 3D printer control, selecting a 0.21 mm needle, and a pressure of 0.4 MPa). The spherical particles after molding were placed in a CaCl2 solution with a concentration of 5.5 wt% for cross-linking and fixation, and the following was prepared: Figure 4 The ZIF@NfsB interface floating microspheres (i.e., the bioenzyme-nanozyme cascade floating microspheres of the present invention) suspended on the water surface are shown.
[0059] The free ZIF nanozyme and NfsB bioenzyme (not 3D printed) were reacted with the above-mentioned ZIF@NfsB interface floating microspheres (3D printed) containing equal amounts of ZIF nanozyme and NfsB bioenzyme at 40°C and pH = 7, and their activities were tested. Figure 5 As shown in the figure, under the same conditions, the enzyme activity of the floating microspheres of ZIF@NfsB was 1.67 times higher than that of the free ZIF+NfsB.
[0060] like Figure 6 As shown, after eight cycles of reaction (reaction conditions: in 50 mL of 75 mM methyl parathion solution, reaction temperature is 60 ° C, pH = 7, reaction time is 1.5 hours, and after the reaction is completed, the microspheres are washed with clean water and the activity is tested again, and this process is repeated eight times), the residual enzyme activity of the ZIF@NfsB interface floating microspheres is 79.63%.
[0061] like Figure 7 As shown, after the free ZIF nanozyme and NfsB bioenzyme (not 3D printed) and the above-mentioned ZIF@NfsB interface floating microspheres (3D printed) containing equal amounts of ZIF nanozyme and NfsB bioenzyme were stored at a high temperature of 80°C for 8 hours, the residual enzyme activity of the free enzyme was about 65%, and the residual enzyme activity of the ZIF@NfsB interface floating microspheres was about 80%.
[0062] The above description is merely a preferred embodiment of the present invention and therefore cannot be used to limit the scope of the present invention. In other words, equivalent changes and modifications made within the scope of the present invention and the contents of the specification should still fall within the scope of the present invention.
Claims
1. A method for preparing bioenzyme-nanozyme cascade floating microspheres, characterized by: include: Sodium alginate, hollow microsphere powder and Tris-HCl buffer were mixed and heated and stirred until completely dissolved; After cooling, a ZIF@NfsB complex prepared by mixing ZIF nanozyme and NfsB bioenzyme is added and thoroughly mixed to form bio-ink; the bio-ink is loaded into a 3D printer, and a model of a three-dimensional structure of spherical particles is introduced for printing and shaping. The spherical particles after shaping are placed in a CaCl2 solution for cross-linking and fixation to prepare the bio-enzyme-nanozyme cascade floating microspheres.
2. The preparation method according to claim 1, wherein: In the biological ink, the concentration of sodium alginate is 1.8-2.6 wt %.
3. The preparation method according to claim 1, wherein: In the bio-ink, the concentration of the hollow microsphere powder is 1.8-2.6 wt %.
4. The preparation method according to claim 1, wherein: In the bio-ink, the concentration of the ZIF@NfsB complex is 0.08-0.20wt%, and the mass ratio of the ZIF nanozyme to the NfsB bioenzyme in the ZIF@NfsB complex is 0.8-1.2:2.8-3.
2.
5. The preparation method according to claim 1, wherein: In the bio-ink, the concentration of sodium alginate is 1.8-2.6wt%, the concentration of hollow microsphere powder is 1.8-2.6wt%, the concentration of ZIF@NfsB complex is 0.08-0.20wt%, and the mass ratio of ZIF nanozyme to NfsB bioenzyme in the ZIF@NfsB complex is 0.8-1.2:2.8-3.
2.
6. The preparation method according to any one of claims 1 to 5, characterized in that: Sodium alginate, hollow microsphere powder and Tris-HCl buffer with a pH of 7.0-9.0 are mixed, and heated and stirred at 80-100° C. until completely dissolved.
7. The preparation method according to claim 6, wherein: The heating and stirring rotation speed is 100-500r / min.
8. The preparation method according to claim 7, wherein: The concentration of the CaCl2 solution is 5-20 wt%.
9. Use of the bioenzyme-nanozyme cascade floating microspheres prepared by the preparation method according to any one of claims 1 to 8 in treating organophosphorus compounds.
10. A method for treating an organophosphorus compound, characterized in that: include: The method is carried out using bioenzyme-nanozyme cascade floating microspheres prepared by the preparation method according to any one of claims 1 to 8.