A composting method based on in-situ photo-fenton and synergistic regulation of functional additives

By using tea waste and biochar as functional additives in forestry residue composting, combined with in-situ photo-Fenton reagent, the problems of slow iron ion conversion and insufficient hydroxyl radical generation were solved, achieving efficient degradation of lignocellulose and shortening the composting cycle, thus improving composting efficiency and quality.

CN120622970BActive Publication Date: 2025-11-21BEIJING FORESTRY UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511128214.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-08-13
Publication Date
2025-11-21
Estimated Expiration
2045-08-13

AI Technical Summary

Technical Problem

Traditional photo-Fenton process has problems such as slow iron ion conversion rate and insufficient hydroxyl radical generation in forestry residue composting, which leads to difficulty in lignocellulose degradation, long composting cycle and low efficiency.

Method used

Tea waste and biochar are used as functional additives, combined with in-situ photo-Fenton reagent (pyrite and ascorbic acid) to adjust the C/N ratio and moisture content, and aerobic composting is carried out to promote iron ion cycling and hydroxyl radical generation, thereby optimizing the microbial environment.

Benefits of technology

It significantly improves the degradation efficiency of lignocellulose, shortens the composting cycle, enhances composting efficiency and quality, and promotes the resource utilization of forestry residues.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120622970B_ABST
    Figure CN120622970B_ABST
Patent Text Reader

Abstract

The application discloses a composting method based on in-situ photo-Fenton and functional additive synergistic regulation, and belongs to the technical field of composting. The composting method comprises the following steps: adding in-situ photo-Fenton reagent and functional additive into forestry residues, adjusting C / N ratio and water content, adding EM bacterial agent, and uniformly mixing; and then, aerobic composting is carried out under sunlight, and the composting is completed when the pile body approaches room temperature; wherein the in-situ photo-Fenton reagent comprises pyrite and ascorbic acid, and the functional additive comprises at least one of tea waste and biochar. The application finds through experiments that the functional additive constructed by adding tea waste and biochar into forestry residues can optimize the role of the in-situ photo-Fenton process in the composting of forestry residues, can effectively solve the problems of slow iron ion conversion and poor in-situ photo-Fenton performance, can improve the degradation efficiency of lignocellulose of the system, can accelerate the decomposition of organic matter in the composting process of forestry residues, and can provide more favorable conditions for the composting process.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of composting, in particular to a composting method based on in-situ photo-Fenton and synergistic regulation of functional additives. BACKGROUND

[0002] With the increasing emphasis on ecological civilization construction worldwide, environmental protection has become a common consensus and common pursuit goal of all sectors of society. In the process of urban sustainable development, the continuous expansion of green areas has led to a sharp increase in the amount of forestry residues. How to handle these waste in a scientific and reasonable way has become an urgent environmental problem. Composting, as a processing method with both economic and environmental benefits, has become one of the main technical choices for handling forestry residues.

[0003] Forestry residues are widely sourced, mainly including dead branches and fallen leaves naturally shed by garden plants in urban green construction, waste generated by artificial green pruning, and other wood waste and by-products derived from other industries. This kind of waste contains a large amount of lignocellulose, of which lignin accounts for 23%-30%, cellulose accounts for 45%-50%, and hemicellulose accounts for 20%-30%. These components are closely intertwined to form a strong and stable network structure, significantly increasing the difficulty of waste disposal, adversely affecting the efficiency and quality of composting, and posing many challenges to forestry residue composting. Therefore, accelerating the degradation process of forestry residues and improving the quality and efficiency of composting have become the focus of research in this field.

[0004] With continuous research, it has been found that the hydroxyl radicals produced by the photo-Fenton process have the ability to oxidize fibers. It can destroy the connection between lignin and hemicellulose, provide more binding sites for lignin-degrading enzymes, and thus improve the efficiency of lignin decomposition. This has great significance for promoting the application of photo-Fenton technology in the field of composting. However, the traditional photo-Fenton process has certain limitations. Based on this situation, in-situ photo-Fenton oxidation method has been proposed. This method uses pyrite and organic acids to generate hydrogen peroxide (H2O2) in-situ, effectively solving the problem of large consumption and low utilization rate of H2O2 in traditional photo-Fenton technology. Given the advantages of strong oxidizing ability and high reaction rate of in-situ photo-Fenton oxidation method, it can be predicted that its application in the field of forestry residue composting will have a very broad development prospect.

[0005] Although in-situ photo-Fenton technology can produce a large amount of active oxygen and effectively improve the degradation rate of complex organic matter such as lignocellulose, this reaction depends on the Fe 3+ / Fe 2+ cycle. Due to the difference in rate constant, Fe 3+ is reduced to Fe 2+The process is very slow, resulting in a slow overall circulation rate, which affects the performance of the photo-Fenton reaction. As the core of the in-situ photo-Fenton reaction, the number of hydroxyl radicals is mainly determined by Fe 2+ and H2O2. If a higher concentration of Fe 2 + cannot be maintained in the system, it is difficult to effectively generate hydroxyl radicals, which will seriously inhibit the degradation of lignocellulose and may prolong the composting time.

[0006] In addition, in the complex organic environment of composting, iron ions are prone to form complexes with humic acid, lignin degradation intermediates, etc., and then produce iron sludge precipitation. This precipitation not only reduces the density of the catalytic active site, but also blocks the pores of the pile, hinders the diffusion of oxygen, and inhibits the activity of microorganisms. Therefore, in order to enhance the reduction ability of Fe 3+ , further improve the microenvironment of composting, improve the activity of microorganisms, and improve the quality of compost products, it is of great significance to explore an excellent additive.

[0007] Therefore, there is an urgent need in the art to develop a functional additive to improve the application of in-situ photo-Fenton technology in composting. The additive not only eliminates the drawbacks of in-situ photo-Fenton technology, but also improves the efficiency of forestry residue composting. Specifically, it is to solve the problem of slow conversion rate of iron ions, break through the bottleneck of free radical generation, and further improve the degradation ability of free radicals to lignocellulose. If such technology can be successfully developed, it is expected to be applied to the composting of forestry residues, accelerate the degradation process of lignocellulose, shorten the composting period, and ultimately improve the efficiency and quality of composting. SUMMARY

[0008] The purpose of the present application is to provide a composting method based on in-situ photo-Fenton and functional additive synergistic regulation to solve the problems existing in the prior art. By constructing a functional additive composed of tea waste and biochar, the role of in-situ photo-Fenton process in forestry residue composting can be optimized, the synergistic effect of the two can be fully played, the problems of slow conversion of iron ions and poor performance of in-situ photo-Fenton can be effectively solved, the degradation efficiency of lignocellulose by the system can be improved, and the decomposition of organic matter in the composting process can be accelerated to provide more favorable conditions for the composting process.

[0009] To achieve the above-mentioned purpose, the present application provides the following solutions:

[0010] The present application provides a composting method based on in-situ photo-Fenton and functional additive synergistic regulation, comprising the following steps:

[0011] Add in-situ photo-Fenton reagent and functional additive to forestry residues, adjust C / N ratio and moisture content, add EM bacterial agent, mix uniformly, and then carry out aerobic composting under sunlight. When the pile approaches room temperature, the composting is completed.

[0012] The in-situ photo-Fenton reagent comprises pyrite and ascorbic acid, and the functional additive comprises at least one of tea waste and biochar.

[0013] Preferably, the added amount of the pyrite and ascorbic acid is 1% of the dry weight of the forestry residues.

[0014] Preferably, the added amount of the tea waste is 0-15% of the dry weight of the forestry residues, and the added amount of the biochar is 0-20% of the dry weight of the forestry residues.

[0015] Preferably, the added amount of the tea waste is 5% of the dry weight of the forestry residues, and the added amount of the biochar is 10% of the dry weight of the forestry residues.

[0016] Preferably, the C / N ratio is 25%-30%, and the moisture content is 60%.

[0017] Preferably, 10g of the EM microbial agent is added to 1kg of the forestry residues in terms of the dry weight of the forestry residues.

[0018] The application further provides an in-situ photo-Fenton reagent for composting, which comprises pyrite and ascorbic acid, and the weight ratio of the pyrite to the ascorbic acid is 1:1.

[0019] The application further provides a functional additive for composting, which comprises at least one of tea waste and biochar, and the weight ratio of the tea waste to the biochar is 0-15:0-20.

[0020] The application further provides application of the composting method, the in-situ photo-Fenton reagent or the functional additive in improving the iron ion conversion rate or the composting efficiency.

[0021] The application further provides application of the composting method, the in-situ photo-Fenton reagent or the functional additive in improving the safety of the composting product or improving the seed germination index.

[0022] The application discloses the following technical effects:

[0023] (1) The in-situ photo-Fenton process is a key technology for driving the overall efficiency of the forestry residue composting to jump.

[0024] Principle of in-situ photo-Fenton reagent: The in-situ photo-Fenton reagent combination (pyrite and ascorbic acid) will undergo a chemical reaction under the irradiation of sunlight, thereby generating a large amount of H2O2, ensuring that hydroxyl radicals can be continuously generated. Hydroxyl radicals have strong oxidizing properties and can oxidize and destroy C-O bonds and C-C bonds in the lignin structure, promote the degradation and mineralization of recalcitrant organic matter, and make the inside of the compost fluffy, effectively relieving the anaerobic environment. It can also provide substrates for laccase and increase the activity of laccase, thereby accelerating the composting process. In addition, hydroxyl radicals can promote the decomposition of fulvic acid into stable humic acid, enhancing the complexity of humus. And Fe 2+ can accelerate the redox cycle of peroxidase and improve the activity of lignin peroxidase.

[0025] The present application aims to address the key problems of traditional composting in treating forestry residues, such as difficulty in degrading lignocellulose, long composting period, and low treatment efficiency. It fully utilizes the strong oxidizing properties of hydroxyl radicals generated by in-situ photo-Fenton process to precisely attack and destroy the structure of lignocellulose, thereby significantly improving the overall efficiency of composting. This method effectively breaks down the barriers between disciplines, not only provides a solid theoretical basis for multi-technology collaborative optimization of composting, but also creates a practical example for reference, opening up a new path for the innovative development of composting technology.

[0026] Through interdisciplinary innovation, the present application successfully breaks through the limitations of traditional composting technology which relies solely on microbial action, and introduces the in-situ photo-Fenton process which has achieved remarkable results in the field of environmental chemistry into the composting process. Based on the combination of in-situ photo-Fenton technology and composting process, the efficiency of lignocellulose degradation is improved, the composting period is shortened, and the composting process is accelerated, thereby widening the application prospect of composting technology and promoting the resource utilization of forestry residues.

[0027] (2) The present application is based on the synergistic effect of in-situ photo-Fenton and functional additives to promote the oxidation efficiency and efficiency improvement mechanism of forestry residue composting.

[0028] Action principle of tea waste: Tea polyphenols are natural chelating agents and reducing agents, including catechins, flavonoids and their glycosides, phenolic acids, and proanthocyanidins. They have a wide pH application range and can easily form stable complexes with Fe 2+ or Fe 3+ under neutral pH conditions, which has great potential in accelerating the rate of in-situ photo-Fenton reaction and enhancing degradation efficiency. Studies have shown that tea polyphenols accelerate the cycling speed of Fe 2+ / Fe 3+ , reduce the dosage of in-situ photo-Fenton reagent, and generate more hydroxyl radicals.

[0029] The principle of the action of biochar: as a green and cheap biomass-derived carbon material, biochar can not only directly participate in degradation as an electron donor, but also indirectly participate in the removal of target degradation products as an electron shuttle. At the same time, the persistent free radicals, oxygen-containing functional groups and edge defects of biochar have redox activity, which can promote the electron transfer between Fe 3+ and biochar, and continuously generate Fe 2+ , which can effectively activate the oxidizing agent and enhance the in-situ photo-Fenton reaction.

[0030] The combined application of tea waste and biochar as functional additives can play a synergistic mechanism: tea waste contains rich nutrients and exogenous microorganisms, which can provide abundant nutrients and energy for microorganisms, while the porosity of biochar can provide a good living environment for microorganisms. The coupling of the two can strengthen the enzyme production, heat production and degradation capacity of microorganisms. The high adsorption capacity of biochar and the rich surface functional groups of tea waste can provide a suitable microenvironment for enzymes to enhance the adsorption and stability of enzymes, thereby maintaining their activity and continuously acting on target degradation products during composting. The addition of biochar may inhibit the abundance or activity of certain bacteria, leading to a decrease in bacterial community diversity. However, the rich microbial community, water-soluble compounds and abundant nitrogen compounds in tea waste can provide more microbial numbers and species, accelerate the succession of microbial community, and make up for the shortcomings of biochar.

[0031] The functional additives composed of tea waste and biochar constructed in the present application can further promote the conversion of iron ions and the generation of hydroxyl radicals in the in-situ photo-Fenton reaction, significantly improve the reaction performance, and break through the functional limitations of single additives, constructing a complete metabolic chain from organic matter decomposition to product maturation, providing a theoretical paradigm for the development of composite compost functional additives.

[0032] The addition of the functional additives of the present application can optimize the role of in-situ photo-Fenton process in forestry residue composting. It can effectively solve the problems of slow iron ion conversion and poor in-situ photo-Fenton performance, improve the degradation efficiency of lignocellulose in the system, and accelerate the decomposition of organic matter in the forestry residue composting process, providing more favorable conditions for composting. Based on this, the composting efficiency is significantly improved, the cycle is shortened, and the quality of the composting product is optimized, realizing the multi-dimensional upgrading of composting technology. BRIEF DESCRIPTION OF DRAWINGS

[0033] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed in the embodiments will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can be obtained by those skilled in the art without creative labor.

[0034] Figure 1 Changes in temperature during composting reaction for T2-T9 in the example and control group (T1);

[0035] Figure 2 Changes in pH during composting reaction for T2-T9 in the example and control group (T1);

[0036] Figure 3 Changes in electrical conductivity during composting reaction for T2-T9 in the example and control group (T1);

[0037] Figure 4 Changes in organic matter degradation rate during composting reaction for T2-T9 in the example and control group (T1);

[0038] Figure 5 Changes in humus during composting reaction for T2-T9 in the example and control group (T1);

[0039] Figure 6 Changes in hydrogen peroxide during composting reaction for T2-T9 in the example and control group (T1);

[0040] Figure 7 Changes in hydroxyl radical during composting reaction for T2-T9 in the example and control group (T1);

[0041] Figure 8 Changes in Fe 3+ / Fe 2+ and ratio between them during composting reaction for T2-T9 in the example and control group (T1); (a) Fe 3+ content change, (b) Fe 2+ content change, (c) Fe 3+ / Fe 2+ change;

[0042] Figure 9 Changes in polyphenol during composting reaction for T2-T9 in the example and control group (T1);

[0043] Figure 10 Changes in ammonium nitrogen and nitrate nitrogen and changes in the ratio thereof during composting reaction for T2-T9 in the example and control group (T1); (a) ammonium nitrogen content change, (b) nitrate nitrogen content change, (c) ammonium nitrogen / nitrate nitrogen change;

[0044] Figure 11 Changes in laccase during composting reaction for T2-T9 in the example and control group (T1);

[0045] Figure 12The changes in catalase during the composting process in examples T2-T9 and the control group (T1) are shown.

[0046] Figure 13 The changes in bacterial community phylum levels at different stages during the composting process of T2-T9 and the control group (T1) in the examples are shown; (a)-(c) represent the warming period, high temperature period and cooling period of composting, respectively.

[0047] Figure 14 The changes in bacterial community genus level during the warming period in the composting reaction of T2-T9 and the control group (T1) in the examples;

[0048] Figure 15 The changes in bacterial community genus level during the high-temperature period in the composting reaction of T2-T9 and the control group (T1) in the examples;

[0049] Figure 16 The changes in bacterial community genus level during the cooling period in the composting reaction of T2-T9 and the control group (T1) in the examples;

[0050] Figure 17 The changes in seed germination index during the composting process of T2-T9 and the control group (T1) in the examples are shown. Detailed Implementation

[0051] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0052] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0053] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0054] Many modifications and variations of the specific embodiments of the application can be practiced in accordance with the teachings of the description of the application, which are intended to cover all such modifications and variations as fall within the scope of the present application. Other embodiments of the application will be apparent to those skilled in the art from consideration of the specification and practice of the application disclosed herein. The specification and examples of the application are exemplary only.

[0055] As used herein, the terms “comprises”, “comprising”, “includes”, “including”, “has”, “having” or variants thereof are open-ended, meaning that they do not exclude additional, non-recited members, elements or steps.

[0056] Room temperature of the present application refers to 25±2℃.

[0057] The forestry residues in the embodiments of the present application are fallen leaves and branches generated during landscape maintenance in autumn 2024 and spring 2025 in Beijing National Botanical Garden. The tea waste used in the embodiments of the present application is purchased from Tianhe Tea Village in Huaining County, Anqing City, Anhui Province, which is by-product tea, coarse old stem leaves and tea ash generated in the initial tea processing process, and contains tea polyphenols, vitamin C, amino acids and other substances. The biochar is purchased from Shengxiang Activated Carbon Operating Department in Gongyi City, Zhengzhou City, Henan Province, which is a product of bamboo after thermal cracking, and the main component is carbon molecules, with a particle size of 1-3 mm, a carbon content of 58.92%, a hydrogen content of 1.87%, and a specific surface area of 390 m 2 / g. The EM microbial agent is purchased from Guoyou Ecological Environment Technology Co., Ltd. in Hangzhou City, Zhejiang Province.

[0058] Example 1: A composting method based on in-situ photo-Fenton and synergistic regulation of functional additives

[0059] This example was carried out in Beijing National Botanical Garden (40°00′64″N- 116°20′22″E) from July to September 2024. The area belongs to a semi-humid and semi-arid monsoon climate, with an average temperature of 23.5℃ and an average daily sunshine time of 14.3h.

[0060] 1. Experimental design

[0061] 1.1 Grouping: 8 experimental groups (T2-T9) and 1 control group (T1) were set up. The experimental groups used the composting technology of in-situ photo-Fenton reagent and functional additives synergistic effect of the present application, and the control group used the traditional natural composting method (only added in-situ photo-Fenton reagent, without adding functional additives), as shown in Table 1. Each treatment was set up in triplicate.

[0062] 1.2 Method: Forestry residues were crushed into fine segments of 5-20 mm long, tea waste and biochar were added according to Table 1 based on the dry weight of forestry residues (60 kg), then in-situ photo-Fenton reagent (1% pyrite and 1% organic acid, %: percentage of dry weight of forestry residues) was added to each treatment, water was added to adjust the moisture content to 60±5%, urea was added to adjust the C / N ratio to 25-30%, EM microbial agent (10 g EM microbial agent was added per 1 kg of forestry residues) was added, and then mixed evenly to form a conical pile in a greenhouse (with sunlight);

[0063] Table 1

[0064]

[0065] During the composting reaction process, samples were collected at 0, 4, 7, 11, 25, 32, 39, 41, 42, 43, 44, and 45 days. During the sampling process, 200 g of sample was collected from the upper, middle, and lower parts of each pile, mixed evenly, and divided into three parts: the first part was dried for testing organic matter and other indicators; the second part was fresh sample, placed in a plastic bag and stored in a refrigerator (4°C) for pH and active oxygen testing; the third part was stored in a freezer (-80°C) for microbial community analysis.

[0066] 1.2.1 Physicochemical indicators

[0067] (1) Temperature monitoring: During composting, the temperature of the pile was measured daily using a probe-type thermometer. The specific operation method is: select three evenly distributed detection points, perform insertion measurement, then take the average of the readings of the three measurement points as the daily composting temperature data. The temperature measuring device can also be used to measure the ambient temperature. When the pile temperature is equal to or lower than the room temperature, it indicates that the composting is complete.

[0068] (2) pH and EC values: pH changes are shown in Figure 2 , and the conductivity (EC) changes are shown in Figure 3 . The pH and conductivity measurement method is to use MP521 pH / EC meter (Shanghai, China) to directly measure the pH and EC values of the filtrate obtained by mixing the sample with deionized water at a volume ratio of 1:10.

[0069] (3) Organic matter degradation: Organic matter changes are shown in Figure 4 , and the determination of organic matter uses potassium dichromate titration method.

[0070] (4) Humus content: Humus changes are shown in Figure 5 , and the determination of humus uses sodium pyrophosphate alkaline solution extraction method.

[0071] 1.2.2 In-situ photo-Fenton reaction related indicators

[0072] H2O2 content: The H2O2 content was determined by spectrophotometry.

[0073] Hydroxyl radical: The hydroxyl radical content was determined by the thiobarbituric acid (TBA) method, and its activity was expressed by the absorbance at 532 nm.

[0074] Iron ion transformation: The transformation between iron ions was determined by the o-phenanthroline colorimetric method. 2+ and Fe 3+ content.

[0075] Polyphenol content: The polyphenol content was determined by the Folin-Ciocalteu colorimetric method.

[0076] 1.2.3 Nutrient indicators

[0077] Nitrogen transformation: The content changes of ammonium nitrogen and nitrate nitrogen were determined by ultraviolet spectrophotometry.

[0078] 1.2.4 Microbial indicators

[0079] Enzyme activity analysis: The samples were stored at 4°C, and the activities of laccase and catalase in the samples were determined and compared with the control group (T1). The determination methods of laccase and catalase were ABTS method and potassium permanganate titration method, respectively, and their changes were shown in Figure 11 and Figure 12 .

[0080] Microbial community analysis: The samples were stored at -80°C and the changes in their microbial communities were determined. The dynamic changes of bacterial communities in the forestry residue composting process of the compost products obtained in the examples T2-T9 and the control group (T1) were explored using high-throughput sequencing technology. Total DNA was extracted from the compost samples using the FastDNA® Spin Kit for Soil kit from Mpbio, USA. Polymerase chain reaction (PCR) amplification was performed on an ABI GeneAmp® Model 9700 thermal cycler using 338F (ACTCCTACGGGAGGCAGCAG, SEQ ID NO. 1) and 806R (GGACTACHVGGGTWTCTAAT, SEQ ID NO. 2) primers. The raw reads obtained by sequencing were filtered and quality controlled using QIIME (version 2.0). UPARSE was used to cluster the qualified reads into operational taxonomic units (OTUs) at a similarity threshold of 97%, and the OTUs were classified using the SILVA database (Version 132). The bacterial community composition and difference analysis were performed using the Majorbio I-Sanger cloud platform (http: / / www.iSanger.com).

[0081] 1.2.5 Toxicity indicators

[0082] Seed germination experiment: The compost products obtained in the examples T2-T9 and the control group (T1) were used for seed germination experiments. Specifically, 5 mL of the filtrate obtained by thoroughly shaking the compost samples with distilled water was placed on filter paper in a sterile culture dish, 5 mL of distilled water was used as a control, and uniform-sized Brassica parachinensis seeds were evenly placed in each culture dish. The culture dishes were placed in a 25°C incubator in the dark for 2 days, the filter paper was kept moist during this period, each treatment was repeated three times, and finally the germination index was calculated. The calculation formula for the germination index is: Germination index = (average number of germinated seeds in the treatment group x average radicle length in the treatment group x 100) / (average number of germinated seeds in the control group x average radicle length in the control group).

[0083] 2. Results and analysis

[0084] 2.1 Determination results of physicochemical indicators

[0085] After adding tea waste and biochar, the temperature of the pile was significantly regulated, and the results are as follows Figure 1As shown in the figure, the temperature changes during the composting reaction of groups T2-T9 and the control group (T1) are illustrated. The figure reveals that the addition of functional additives shortened the composting process, resulting in higher peak temperatures, a longer thermophilic period, and a shorter composting cycle. Specifically, the experimental groups (T2-T9) exhibited a superior heating rate compared to the control group (T1). The peak temperatures of T6 (15% tea waste + 10% biochar), T3 (15% tea waste), and T9 (15% tea waste + 20% biochar) exceeded 60℃ during the high-temperature period. Furthermore, the composting cycles of T5 (5% tea waste + 10% biochar) and T6 were shortened to 38 days, completing composting two days earlier than the control group. Considering all factors, T5 is superior. T5 (5% tea waste + 10% biochar) achieved fully composted products within 38 days, with a maximum temperature of 58.2℃ during composting, while the composting cycle of T1 (without functional additives) was as long as 40 days.

[0086] In the complex organic environment of composting, iron ions easily form complexes, producing iron sludge precipitates. This reduces the density of catalytically active sites, clogs the pores of the compost pile, hinders oxygen diffusion, inhibits microbial activity, and negatively impacts the chemical environment of the compost. The addition of tea waste and biochar can regulate pH and EC values, optimizing the chemical environment, with results as follows... Figure 2 and Figure 3 As shown, the pH value decreased by 1.6-5.9% and the EC value increased by 2.9-66.3% in the experimental groups (T2-T9), and both were within the reasonable range for application (pH: 6.5-7.5; EC value: <4.0mS / cm). Suitable pH and EC provide a favorable living environment for microorganisms, promoting their decomposition of organic matter and facilitating the continuous in-situ photo-Fenton reaction, thus improving the quality of compost products. Among all treatments, the T5 treatment (5% tea waste + 10% biochar) exhibited the optimal levels of pH and inorganic salt content within the compost pile during the composting process.

[0087] Depend on Figure 4 It was found that the addition of functional additives promoted the degradation of organic matter during the composting process of forestry residues, with the organic matter degradation rate of all treatments ranging from 39.9% to 45.5%. Compared with the control group, the organic matter degradation rate of the experimental groups increased by 0.1% to 5.6%, especially the T5, T6, and T8 treatments, which showed significant effects; among them, the organic matter degradation rate of the T5 (5% tea waste + 10% biochar) compost product was 5% higher than that of the control group (T1).

[0088] Depend on Figure 5It was found that the addition of functional additives promoted the maturation of compost products, resulting in a faster increase in humic content during the composting process. The humic content of all experimental groups (T2-T9) increased, with T6 and T8 showing the most significant increases, at 9.8% and 9.3%, respectively. Among the compost products, the humic content of T5 (5% tea waste + 10% biochar) was 5.62% higher than that of the control group (T1).

[0089] 2.2 Results of in-situ optical Fenton reaction related index determination

[0090] Depend on Figure 6 It can be seen that the addition of functional additives improved the recycling efficiency of iron ions, accelerated the rate of in-situ photo-Fenton reaction, and thus increased the H2O2 content. Among them, the H2O2 levels of treatments T2, T3, T5, T6, T8, and T9 all showed a certain degree of increase. The maximum H2O2 content of T5 (5% tea waste + 10% biochar) in the compost product was 23.9% higher than that of the control group (T1).

[0091] Depend on Figure 7 It can be seen that the addition of functional additives significantly regulates the dynamic changes of hydroxyl radicals, and the trend of these changes is consistent with that of H2O2.

[0092] Depend on Figure 8 It can be seen that the addition of functional additives has a certain regulatory effect on the iron cycle and H2O2 regeneration during composting. In the experimental groups (T2-T9), Fe 2+ The content was 20.4%-47.2% higher than that of the control group, Fe 3+ The content decreased by 2.8%-17.5%, Fe 3+ with Fe 2+ The ratio (T2-T9) was ultimately lower than that of the control group (T1). This indicates that the additive effectively increased the Fe content in the system. 2+ The concentration provides sufficient raw materials for the generation of hydroxyl radicals, breaks through the bottleneck of free radical generation, improves the ability of free radicals to degrade lignocellulose, and accelerates the degradation process of organic matter.

[0093] Depend on Figure 9 It can be seen that the addition of functional additives improved the iron ion recycling efficiency and oxidation performance during composting. Among them, the polyphenol concentration of T5 compost product (5% tea waste + 10% biochar) was ultimately maintained at a low level (0.5 mg / kg).

[0094] 2.3 Nutrient index determination results

[0095] Depend on Figure 10It can be seen that the present application improves the nutrient content of the compost product by adding functional additives to the forestry residues. The ammonium nitrogen content of T5, T6, T7 and T8 is reduced by 13.9%, 18.5%, 3.5% and 15.5% respectively compared with T1; the nitrate nitrogen content is increased, especially T5 and T8, which is increased by 12.5% and 14.9% respectively compared with T1; the ammonium nitrogen / nitrate nitrogen ratio of T5, T6 and T8 is reduced by 25.1%, 29.8% and 30.2% respectively compared with T1.

[0096] 2.4 Microbial index determination results

[0097] From Figure 11 and Figure 12 It can be seen that the addition of functional additives improves the activity of enzymes in the composting process and promotes the growth and reproduction of microorganisms under in-situ photo-Fenton reaction. The activity of laccase and catalase in T5 (5% tea waste + 10% biochar) is higher than that in other treatments during composting, which reflects that the microbial activity in T5 (5% tea waste + 10% biochar) is stronger. T5, T6 and T8 show the best laccase increase rate and content, and the peak value is increased by 12.9%, 9.3% and 18.0% respectively compared with T1; the peak value of catalase of T2-T9 is increased by 0.7%-14.2% compared with T1, and the increment of T5 is the largest, reaching 14.2%.

[0098] From Figures 13-16 It can be seen that in-situ photo-Fenton and functional additives can synergistically adjust the bacterial community structure in the compost and improve the metabolic activity. During the composting temperature rising period, the relative abundance of Proteobacteria in T2, T3, T5, T6, T8 and T9 is increased by 1.6%-21.9% compared with T1; during the high temperature period, the relative abundance of Firmicutes in T4, T6, T8 and T9 is increased by 36.4%-57.4% compared with T1. At the bacterial genus level, the dominant genus of each treatment is different. Among them, the relative abundance of Bacillus in T4, T6 and T8 is increased by 5.4%-20.8% compared with T1. It shows that suitable bacterial community structure is beneficial to the decomposition of organic matter and the smooth progress of composting.

[0099] 2.5 Toxicity index determination results

[0100] From Figure 17It can be known that the functional additive is added in the process of combined in-situ photo-Fenton degradation of compost lignin, which can promote compost product maturity and reduce its phytotoxicity, and the germination index of all treated seeds is more than 80%. The germination index of T4, T5, T7 and T8 is increased by 1.4%-12.1% compared with T1. Among them, the germination index of T5 (5% tea waste + 10% biochar) is the highest, which is 124.3%. The seed germination index is an important indicator for measuring the toxicity of compost products, and the additive reduces the toxicity of the products and improves the safety of the compost products, so that it is more conducive to subsequent application.

[0101] In summary, in the process of forestry residue composting, lignocellulose has a complex structure, and its chemical bonds are difficult to be effectively degraded and converted by microorganisms, which greatly prolongs the composting period and reduces the resource utilization efficiency. In view of this key problem, the present application provides a composting method based on in-situ photo-Fenton and functional additive synergistic regulation, which improves the application of in-situ photo-Fenton technology in composting by adding functional additives in forestry residues. The functional additive not only eliminates the drawbacks of in-situ photo-Fenton technology, but also improves the efficiency of forestry residue composting. Specifically, it solves the problem of slow iron ion conversion rate and breaks through the bottleneck of free radical generation, further improves the degradation ability of free radicals to lignocellulose, improves the efficiency and quality of composting, shortens the composting period, and has significant advantages in forestry residue composting, which is conducive to promoting the resource utilization process.

[0102] The above-described embodiments are only preferred modes of the present application and do not limit the scope of the present application. Without departing from the design spirit of the present application, various modifications and improvements to the technical solutions of the present application made by those skilled in the art shall fall within the protection scope determined by the claims of the present application.

Claims

1. A composting method based on the synergistic regulation of in-situ photo-Fenton and functional additives, characterized in that, Includes the following steps: In-situ photo-Fenton reagent and functional additives were added to forestry residues to adjust the C / N ratio and moisture content. EM bacteria were added, and after mixing evenly, aerobic composting was carried out under sunlight. Composting was completed when the compost pile was close to room temperature. The in-situ photo-Fenton reagent is composed of pyrite and ascorbic acid, and the functional additive is composed of tea waste and biochar. The amounts of pyrite and ascorbic acid added are 1% of the dry weight of the forestry residue, respectively. The amount of tea waste added is 5% of the dry weight of the forestry residue, and the amount of biochar added is 10% of the dry weight of the forestry residue; Based on the dry weight of the forestry residue, 10g of the EM agent is added to every 1kg of the forestry residue.

2. The composting method as described in claim 1, characterized in that, The C / N ratio is 25%-30%, and the moisture content is 60%.

3. The application of the composting method as described in any one of claims 1-2 in improving the iron ion conversion rate or composting efficiency.

4. The application of the composting method as described in any one of claims 1-2 in improving the safety of compost products or improving the seed germination index.

Citation Information

Patent Citations

  • Fenton reaction catalyst using coffee grounds or tea dregs as raw material

    CN102858451A

  • Method for intensively removing antibiotic resistance genes in aerobic compost

    CN115073230A