Application of RTL6 gene in improving in-vitro embryo development rate

Abstract

The invention provides application of an RTL6 gene in improvement of an in-vitro embryo development rate, and relates to the technical field of mammal embryo engineering. According to the present invention, the RTL6 gene is constructed into the PcDNA3.1 (+)-RTL6 recombinant vector, and the pcDNA3.1 (+)-RTL6 recombinant vector is injected into the in vitro mature oocyte cytoplasm 4-5 h after the pig parthenogenetic activation, such that the embryonic development retardation phenomenon is effectively relieved, and the embryonic development is promoted;

Description

Technical Field

[0001] The present invention belongs to the technical field of mammalian embryo engineering, and particularly relates to the application of RTL6 gene in improving the rate of in vitro embryo development. Background Art

[0002] In vitro embryo production is a core technology in livestock breeding. Currently, the application of in vitro fertilization (IVF), intracytoplasmic sperm injection (ICSI), embryo transfer, embryo splitting, and embryonic stem cell engineering has promoted the development of the livestock industry. However, the development and application of these new technologies is significantly limited by the arrest of early embryonic development. Although numerous studies have improved embryonic developmental capacity by adding or subtracting factors from the culture medium used to culture mammalian early embryos in vitro, the quality and blastocyst development rate of in vitro embryos remain significantly inferior to those of in vivo embryos. In real-world production processes, the arrest of in vitro embryos is particularly severe at certain stages, resulting in significant waste of resources. The duration of this arrest in mammalian early embryonic development in vitro varies significantly among species.

[0003] Research has found that nearly all mammals carry the Gag-like retrotransposon 6 (RTL6) gene, which is activated in microglia, the brain's first responders to infection, protecting the animal brain from viral infection. Currently, there are no reports on the RTL6 gene's role in improving embryonic development in vitro. Summary of the Invention

[0004] In view of this, the purpose of the present invention is to provide an application of the RTL6 gene in improving the in vitro embryo development rate. The gene RTL6 alleviates the in vitro embryo development block phenomenon and significantly improves the embryo development rate.

[0005] In order to solve the above technical problems, the present invention provides the following technical solutions:

[0006] The present invention provides application of the RTL6 gene in preparing a product for improving the in vitro embryo development rate.

[0007] Preferably, the nucleotide sequence of the CDS coding region of the RTL6 gene is shown in SEQ ID NO.1.

[0008] The present invention provides a recombinant vector for improving the in vitro embryo development rate, wherein the recombinant vector contains the RTL6 gene.

[0009] Preferably, the original vector of the recombinant vector is pcDNA3.1(+).

[0010] Preferably, the RTL6 gene is inserted into the multiple cloning site region of the pcDNA3.1(+) vector to obtain the pcDNA3.1(+)-RTL6 recombinant vector.

[0011] Preferably, the primers used to amplify the RTL6 gene are shown as SEQ ID NO.2 and SEQ ID NO.3.

[0012] The present invention provides application of the recombinant vector in preparing a product for improving the in vitro embryo development rate.

[0013] The invention provides a method for improving the in vitro embryonic development rate of an animal, comprising the following steps: injecting the recombinant vector into the parthenogenetically activated embryo of the animal.

[0014] Preferably, the concentration of the recombinant vector is 400-600 ng / μL.

[0015] Preferably, the recombinant vector is injected within 4-5 hours after parthenogenetic activation of the embryo.

[0016] Compared with the prior art, the present invention has the following beneficial effects:

[0017] The present invention provides for the first time the use of the RTL6 gene in the preparation of a product for improving the in vitro embryo development rate. The nucleotide sequence of the RTL6 gene is shown in SEQ ID NO. 1. Experimental verification shows that the gene RTL6 alleviates the phenomenon of in vitro embryo development block and significantly improves the embryo development rate.

[0018] Furthermore, the present invention constructs the RTL6 gene into a pcDNA3.1(+)-RTL6 recombinant vector, and injects the pcDNA3.1(+)-RTL6 recombinant vector into the cytoplasm of in vitro matured oocytes 4-5 hours after pig parthenogenetic activation, effectively alleviating the embryonic development block phenomenon and promoting embryonic development. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 Schematic diagram of different embryonic development stages in the present invention, wherein from left to right are 2-cell, 4-cell, 8-cell, and 16-cell embryonic development stages.

[0020] Figure 2 Schematic diagram of RTL6 expression levels in normal embryos at different developmental stages in the present invention.

[0021] Figure 3 Schematic diagram of the pcDNA3.1(+)-RTL6 recombinant vector of the present invention.

[0022] Figure 4 Schematic diagram of the effects of RTL6 on different stages of embryonic development in the present invention. DETAILED DESCRIPTION

[0023] The present invention provides the use of the RTL6 gene in the preparation of a product for improving in vitro embryo development rates. The porcine RTL6 gene is located on chromosome 5, has a coding sequence of 720 bp, and encodes 240 amino acids. The RTL6 gene described herein is the RTL6 CDS coding region sequence. The nucleotide sequence of the CDS coding region of the RTL6 gene described herein is shown in SEQ ID NO. 1.

[0024] The present invention also provides a recombinant vector for improving in vitro embryo development rate, the recombinant vector containing the RTL6 gene. The nucleotide sequence of the RTL6 gene of the present invention is shown in SEQ ID NO. 1. The primers used to amplify the RTL6 gene of the present invention are an upstream primer for amplifying the RTL6 CDS coding region (SEQ ID NO. 2) and a downstream primer for amplifying the RTL6 CDS coding region (SEQ ID NO. 3).

[0025] The original vector of the recombinant vector of the present invention is pcDNA3.1(+).

[0026] In the present invention, the RTL6 gene is inserted into the multiple cloning site region of the pcDNA3.1(+) vector to obtain the pcDNA3.1(+)-RTL6 recombinant vector. KpnI and BamHII restriction enzyme sites are selected in the multiple cloning site region of the pcDNA3.1(+) vector of the present invention.

[0027] The present invention also provides application of the recombinant vector in preparing a product for improving the in vitro embryo development rate.

[0028] The present invention also provides a method for improving the in vitro embryonic development rate of an animal, comprising the steps of: injecting the recombinant vector into a parthenogenetically activated embryo of an animal. The concentration of the recombinant vector of the present invention is 400-600 ng / μL, preferably 450-550 ng / μL, more preferably 460-540 ng / μL, 470-530 ng / μL, 480-520 ng / μL, 490-510 ng / μL, or 500 ng / μL. In the present invention, the recombinant vector is injected within 4-5 hours after parthenogenetically activated embryos. The animal of the present invention is preferably a pig.

[0029] In the present invention, unless otherwise specified, all components, reagents, or culture media are commercially available products well known to those skilled in the art.

[0030] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solutions of the present invention. Obviously, the embodiments described are only some of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0031] Example 1

[0032] 1. In vitro maturation of porcine oocytes

[0033] On the day of ovarian harvest, prepare in vitro maturation medium according to Table 1. Add 400 μL of culture medium to each of the five culture wells, followed by 200 μL of paraffin oil. Place the cells in a cell culture incubator and equilibrate at 5% CO2 and 38.5°C for at least 2 hours.

[0034] After collecting sow ovaries from the COFCO Meat Food Processing Plant in Wuhan, they were immediately placed in 35°C sterile saline supplemented with double-antibody and returned to the laboratory within 2-4 hours. The ovarian tissue was first washed with 75% alcohol for 1 minute, then washed three times with sterile and preheated saline. Then, a sterile syringe with a standard 20-gauge needle (containing a small amount of balanced DPBS) was used to extract follicles with a diameter of 3-8 mm on the surface of the ovary. The extracted fluid was injected into a 50 mL conical centrifuge tube and placed in a conical centrifuge tube in a 39°C water bath. Wait for the cumulus-oocyte complex (COC) to form. S After precipitation, oocytes were washed twice with DPBS (Gibco) and examined under a stereomicroscope. Oocytes with normal morphology, uniform cytoplasm, and at least three layers of granulosa cells were selected. The detected COCs were washed three times with the oocyte cleaning solution (prepared in Table 2) and then three times with maturation medium. The oocytes were then transferred to a five-well cell culture plate containing 500 μL of maturation medium and covered with paraffin oil, with 100-150 COCs placed in each well. The plates were then pre-equilibrated in a CO2 incubator for at least 2 hours and then matured in vitro for 42-44 hours at 39°C, 5% CO2, and saturated humidity.

[0035] Table 1 Preparation of oocyte in vitro maturation medium IVM

[0036]

[0037]

[0038] Table 2 Oocyte cleaning solution

[0039] Components Dosage: 50mL BSA 1％ P / S 1％ PBS Add to 50mL

[0040] 2. Selection of mature oocytes

[0041] After 42-44 hours of COC culture, the cumulus cells can be observed under a stereomicroscope to be fully expanded and radiating. Thaw the 0.1% hyaluronidase solution prepared in Table 3 in advance. Remove the fully expanded COCs and place them in a 0.5 mL EP tube. Add 50 μL of 0.1% hyaluronidase and mix. Oocytes should then be shaken on a shaker for 5 minutes. After washing 2-3 times, the oocytes, free of granulosa cells, should be transferred to a small dish containing a manipulation device. Oocytes with a first polar body should be selected under a stereomicroscope to identify mature oocytes.

[0042] Table 30.1% Hyaluronidase Solution Preparation

[0043] Components Dosage IVM solution 10mL Hyaluronidase powder 0.12g

[0044] 3. Parthenogenetic activation of porcine in vitro matured oocytes

[0045] Place the selected mature oocytes into a fusion tank containing the activation solution prepared according to Table 4 and perform electrical activation using a BTX-2001 fusion instrument. Activation parameters: 30 μs, 1.1 kV / cm, 1 DC pulse. After activation, wash the oocytes three times with preheated embryo culture medium PZM-3 prepared according to Table 5 before use.

[0046] Table 4 Activation liquid configuration

[0047] Components concentration Mannitol 0.25mol / L CaCl 0.5mol / L <![CDATA[MgCl2]]> 0.5mol / L HEPES 0.5mol / L PVA 0.01％

[0048] Table 5 Preparation of embryo in vitro culture medium PZM-3

[0049] Components concentration Dosage: 200mL NaCl 108.00mmol / L 1.2623g KCL 10.00mmol / L 0.1492g <![CDATA[KH2PO4]]> 0.35mmol / L 0.0096g <![CDATA[MgCl2·7H2O]]> 0.40mmol / L 0.0198g <![CDATA[NaHCO3]]> 25.07mmol / L 0.4212g Sodiumpyruvate 0.2mmol / L 0.0044g <![CDATA[Ca-(Lactate)·5H2O]]> 2.00mmol / L 0.2000g L-Glutamine 2.00mmol / L 0.0584g Hypotaurine 5.00mmol / L 0.1092g Gentamicin 0.005g / L 0.0100g BME(50×)AminoAcidsSolution 20mL / L 4mL BME(100×)Non-essentialAminoAcids 10mL / L 2mL BSA 3g / L 0.6g

[0050] 4. In vitro culture of parthenogenetic activated embryos

[0051] After parthenogenetic activation of in vitro matured oocytes, oocytes with a first polar body, uniform cytoplasm, and intact cell membrane were selected and washed three times in PZM-3 embryo culture medium that had been equilibrated for 2 hours before transfer to an incubator for culture at 39°C, 5% CO2, and saturated humidity. The proportion of 4-cells was counted at 48 hours, the proportion of 8-cells at 72 hours, and the blastocyst development rate at 7 days. A schematic diagram of cells at different embryonic developmental stages is shown below. Figure 1 shown.

[0052] Example 2 Determination of RTL6 expression levels at different developmental stages of parthenogenetic activated pig embryos

[0053] 1. Embryo RNA Extraction

[0054] Based on step 4 of Example 1, embryos of corresponding developmental stages were collected into EP tubes at the 2-cell, 4-cell, 8-cell and 16-cell stages, centrifuged briefly, and the supernatant was discarded. The precipitates obtained were the embryos used. TM RNA micro-extraction kit (Thermo Fisher, Invitrogen) was used to extract RNA from porcine parthenogenetic activated embryos at different developmental stages.

[0055] 2. RTL6 Expression Determination: RNA extracted from different developmental stages was reverse transcribed into cDNA using the Vazyme HiScript IIQ RT SuperMix for qPCR (+gDNAwiper) Kit (Novozymes). Using this cDNA as a template, qPCR amplification was performed using the ChamQ Blue Universal SYBR qPCR MasterMix Kit to detect RTL6 expression in embryos at each developmental stage. Fluorescence quantitative qPCR detection: The primers used are shown in Table 6. The reaction mixture was prepared in qPCR tubes according to the system in Table 7. The amplification program was as follows: heating to 95°C at 1.6°C / s for 30 seconds; 95°C for 10 seconds, cooling to 60°C at 1.6°C / s for 30 seconds, for a total of 40 cycles; heating to 95°C at 1.6°C / s for 15 seconds, cooling to 60°C at 1.6°C / s for 1 minute, heating to 95°C at 0.15°C / s for 1 second. Using p-GAPDH as the internal reference primer, qPCR reaction was performed according to the above amplification procedure and amplification reaction system, and quantitative detection was performed in a fluorescent quantitative PCR instrument. After the program was completed, Excel software was used for data analysis, and 2 -△△Ct The relative expression of genes was calculated by the Student's ttest. The results showed that the expression of RTL6 was the highest in embryos at the 8-cell developmental stage. Embryos at the 8-cell developmental stage were selected for subsequent experiments ( Figure 2 ).

[0056] Table 6 Primers used in qRT-PCR

[0057] Primers Primer sequences RTL6-F GCTGTGACTCATCGGCCTG(SEQ ID NO.4) RTL6-R TTGTTCTCGGTCCTGGGTCT(SEQ ID NO.5) p-GAPDH-F CGTCCCTGAGACACGATGGT(SEQ ID NO.6) p-GAPDH-R GCCTTGACTGTGCCGTGGAAC(SEQ ID NO.7)

[0058] Table 7 qPCR reaction system

[0059] Reagents Dosage 2×ChamQBlueUniversalSYBRqPCRMaster 10 μL Upstream primer (10 μM) 0.4μL Downstream primer (10 μM) 0.4μL cDNA 200ng <![CDATA[ddH2O]]> to 20 μL

[0060] Example 3 Construction of RTL6 gene in vitro transcription vector

[0061] The porcine RTL6 gene is located on chromosome 5, with a coding sequence of 720 bp, encoding 240 amino acids. TMRNA was extracted from the 8-cell stage of pig parthenogenetic activated embryos using an RNA microextraction kit (Thermo Fisher Scientific, Invitrogen), and the corresponding embryonic cDNA was obtained using the HiScript IIQ RT SuperMix for qPCR (+gDNAwiper) kit (Novozymes). Using this cDNA as a template, the PCR amplification enzyme PrimerStar was used to obtain the full-length reading frame fragment of the RTL6 gene (shown in SEQ.ID.NO.1), and restriction enzyme sites were added to the ends of the gene fragment using primers shown in SEQ ID NO.2 and SEQ ID NO.3. The amplified fragment was recovered by gel electrophoresis. The kpnI and BamHII restriction enzyme sites were selected in the multiple cloning site region of the pcDNA3.1(+) vector and double enzyme digestion was performed. The amplified and recovered fragment was spliced ​​into the multiple cloning site region of the pcDNA3.1(+) vector digested with kpnI and BamHII using a nucleic acid ligase solution kit ( Figure 3 The constructed vector was named pcDNA3.1(+)-RTL6. RNase-free ultrapure water was used to dissolve pcDNA3.1(+)-RTL6 to the experimental working concentration and stored in aliquots at -80°C, using one vial at a time to avoid repeated freezing and thawing.

[0062] The nucleotide sequence of the porcine RTL6 CDS coding region (720 bp) is shown in SEQ ID NO. 1: The upstream primer sequence (5'-3') for amplifying the porcine RTL6 CDS coding region is shown in SEQ ID NO. 2: GTGGCGGCCGCTCGAATGGTCCAGCCCCAGACATC, and the downstream primer sequence (5'-3') for amplifying the porcine RTL6 CDS coding region is shown in SEQ ID NO. 3: AAAC GGGCCCTCTAGCTAAAGGTTCCGAGCTCGCG.

[0063] Example 4 Injection of pcDNA3.1(+)-RTL6 into Parthenogenetic Activated Pig Embryos

[0064] Four to five hours after parthenogenetic activation of in vitro matured porcine oocytes, the oocytes were randomly divided into groups. The pcDNA3.1(+)-RTL6 prepared in Example 3 was injected into the cytoplasm of the cells using a micromanipulation system under an inverted microscope, avoiding the nucleus. The pcDNA3.1(+)-RTL6 concentrations in each group were 0, 100 ng / μL, 250 ng / μL, 500 ng / μL, and 750 ng / μL, respectively. Each group was then washed three times in PZM-3 embryo culture medium and cultured again at 39°C, 5% CO2, and saturated humidity. The rates of 4-cell, 8-cell, and blastocyst formation were counted at 36 hours, 48 ​​hours, and day 7. The results, shown in Table 8, demonstrate that the RTL6 gene promotes embryonic development, with the most effective injection dose of 500 ng / μL.

[0065] Table 8 Effects of microinjection of pcDNA3.1(+)-RTL6 on the in vitro development of porcine parthenogenetic activated embryos

[0066]

[0067]

[0068] Note: Different letters in the table indicate significant differences among different experimental groups, p < 0.05.

[0069] Example 5 Injection of pcDNA3.1(+)-RTL6 into parthenogenetic activated embryos of the same batch of pigs

[0070] 4-5 hours after parthenogenetic activation of the same batch of in vitro matured porcine oocytes, pcDNA3.1(+)-RTL6 at a working concentration of 500 ng / μL prepared in Example 3 was injected into the cell cytoplasm under an inverted microscope with the aid of a micromanipulation system. Subsequently, the embryos were washed three times in embryo culture medium PZM-3 and cultured under the conditions of 39°C, 5% CO2, and saturated humidity. Embryos not injected with pcDNA3.1(+)-RTL6 served as the control group. The rates of 4 cells, 8 cells, and blastocysts were counted at 48 hours, 72 hours, and on the 7th day, respectively. The results are shown in Tables 9 and Figure 4 The results showed that the development rate of embryos injected with pcDNA3.1(+)-RTL6 was significantly higher than that of untreated embryos (4-cell rate 94% vs 82.8%, 8-cell rate 87.9% vs 69.3%, blastocyst rate 30.6% vs 21.1%), indicating that RTL6 overexpression can improve the development rate of embryos in vitro.

[0071] Table 9 Effects of RTL6 at different stages of embryonic development

[0072]

[0073] Note: Different letters in the table indicate significant differences among different experimental groups, p < 0.05.

[0074] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. Application of RTL6 gene in the preparation of products for improving the rate of in vitro embryo development.

2. The use according to claim 1, characterized in that The nucleotide sequence of the CDS coding region of the RTL6 gene is shown in SEQ ID NO.

1.

3. A recombinant vector for improving the rate of in vitro embryo development, characterized in that: The recombinant vector contains the RTL6 gene according to claim 1 or 2.

4. The recombinant vector according to claim 3, wherein The original vector of the recombinant vector is pcDNA3.1(+).

5. The recombinant vector according to claim 3, wherein The RTL6 gene was inserted into the multiple cloning site region of the pcDNA3.1(+) vector to obtain the pcDNA3.1(+)-RTL6 recombinant vector.

6. The recombinant vector according to claim 3, wherein The primers used to amplify the RTL6 gene are shown in SEQ ID NO. 2 and SEQ ID NO.

3.

7. Use of the recombinant vector according to any one of claims 3 to 6 in the preparation of a product for improving the rate of in vitro embryo development.

8. A method for improving the embryonic development rate of an animal in vitro, characterized in that: The method comprises the following steps: injecting the recombinant vector according to any one of claims 3 to 6 into parthenogenetically activated embryos of animals.

9. The method according to claim 8, wherein The concentration of the recombinant vector is 400-600 ng / μL.

10. The method according to claim 8, wherein The recombinant vector is injected within 4-5 hours after embryo parthenogenetic activation.

Images