Marker closely linked to corn lodging resistance and its application

Abstract

The application discloses a marker closely linked to corn lodging resistance and application thereof, and belongs to the technical field of molecular marker assisted breeding. The application first discovers markers qSB3, qSB5 and qSB9 closely linked to corn lodging resistance, qSB3 is located at the 197448846 site of chromosome 3, qSB5 is located at the 966087 site of chromosome 5, and qSB9 is located at the 148431047 site of chromosome 9; when the bases of the markers qSB3, qSB5 and qSB9 are T, T and A or T, C and A respectively, the corn shows strong lodging resistance; KASP primers for detecting the markers closely linked to corn lodging resistance are also provided, and the primer sequences are shown as SEQ ID NO. 1-SEQ ID NO. 9; the provided markers closely linked to corn lodging resistance and the related KASP primers for detecting the markers can be used for corn lodging resistance variety breeding and identification of lodging resistance performance, and have important significance for saving breeding cost, improving breeding efficiency and shortening breeding time limit.

Description

Technical Field

[0001] This invention relates to the field of molecular marker-assisted breeding technology, and in particular to markers closely linked to lodging resistance in maize and their applications. Background Technology

[0002] Maize (Zea mays L.) is one of the world's three major staple crops, playing a vital strategic role in ensuring food security and promoting industrial development. However, lodging has always been a significant factor affecting high and stable maize yields and restricting mechanized harvesting. Studies have shown that for every 1% increase in lodging rate, the yield per unit area will decrease significantly by 108 kg·hm². - 2. Corn lodging is generally classified into three types: root lodging, stem lodging, and stem breakage. It is a production disaster mainly caused by wind, rain, or improper management during corn growth, resulting in corn plants tilting or falling to the ground. Corn lodging is also closely related to several characteristics of the corn plant itself, including plant height and ear height, internode length, stem diameter and bark thickness, stem weight per unit stem volume and bark weight, stem puncture strength and transverse bending strength, and the number of annular aerial roots. At the microscopic level, the number of vascular bundles directly affects stem puncture strength and transverse bending strength.

[0003] Selecting lodging-resistant varieties is an important measure to prevent lodging. Lodging-resistant varieties can withstand natural forces such as wind and rain, significantly reducing the lodging rate of corn compared to easily lodged varieties, and providing a strong guarantee for high and stable yields during the planting process. Lodging-resistant varieties have sufficient leaf area, which can greatly improve the photosynthetic efficiency of corn, increasing yield while also improving corn quality and reducing field management costs.

[0004] Applying marker-assisted selection (MAS) technology to maize variety breeding has the advantages of saving breeding costs, convenience and speed, and being unaffected by the environment. It can significantly improve breeding efficiency, shorten breeding time, and reduce breeding workload. It is of great significance in screening high-quality and highly resistant materials, breeding lodging-resistant varieties, and promoting the progress of maize lodging resistance research. Therefore, it is of great significance to explore the genetic genes related to maize lodging resistance and develop linked SNP and KASP molecular markers.

[0005] KASP markers are a competitive allele-specific PCR technique primarily used for accurate biallelic identification of single nucleotide polymorphisms (SNPs) and insertions / deletions (InDels) at specific sites in a wide range of genomic DNA samples. KASP markers offer the following advantages:

[0006] 1) High flexibility and accuracy: KASP technology eliminates the need to synthesize specific fluorescent primers for each SNP site, instead using universal fluorescent primers for amplification. This significantly reduces reagent costs while maintaining the accuracy of the gold standard. 2) Reduced reaction costs: Compared to other methods, KASP technology offers better site adaptability, significantly reducing costs while ensuring accuracy. 3) Shortened analysis time: KASP technology can accurately determine molecular marker types in a short time, significantly shortening analysis time and improving work efficiency. 4) Wide application: KASP technology has wide applications in fine mapping of trait genes, molecular-assisted breeding, seed resource identification, molecular genetic mechanism research of diseases, disease gene mapping, and screening for drug sensitivity or disease susceptibility sites. Summary of the Invention

[0007] The purpose of this invention is to provide markers closely linked to lodging resistance in maize and their applications, in order to assist in the breeding of lodging-resistant varieties and the study of related molecular mechanisms.

[0008] To achieve the above objectives, the present invention provides markers closely linked to lodging resistance in maize, namely qSB3, qSB5 and qSB9; qSB3 is located at locus 197448846 on chromosome 3; qSB5 is located at locus 966087 on chromosome 5; and qSB9 is located at locus 148431047 on chromosome 9.

[0009] Preferably, when the bases of qSB3, qSB5 and qSB9 are labeled with T, T and A or T, C and A, respectively, maize exhibits strong lodging resistance.

[0010] A kit for detecting lodging resistance in maize, comprising primers for detecting the markers closely linked to lodging resistance in maize.

[0011] Preferably, the primers are KASP primers or other primers that can amplify the three markers that are closely linked to lodging resistance in maize.

[0012] Preferably, the KASP primer sequences labeled with qSB3 are shown in SEQ ID NO.4 to SEQ ID NO.6; the KASP primer sequences labeled with qSB5 are shown in SEQ ID NO.7 to SEQ ID NO.9; and the KASP primer sequences labeled with qSB9 are shown in SEQ ID NO.10 to SEQ ID NO.12.

[0013] The application of a marker, as described above, closely linked to lodging resistance in maize in the breeding of lodging-resistant maize varieties.

[0014] The application of a kit for detecting lodging resistance in maize, as described above, in maize variety breeding, wherein the maize variety is a lodging-resistant variety.

[0015] Application of a marker, as described above, closely linked to maize lodging resistance in the identification of maize lodging resistance.

[0016] Application of a kit for detecting lodging resistance in maize as described above in the identification of maize lodging resistance.

[0017] Therefore, the specific technical effects of the marker and its application that are closely linked to lodging resistance in maize provided by this invention are as follows:

[0018] (1) This invention first discovered markers closely linked to lodging resistance in maize, namely qSB3, qSB5 and qSB9, where qSB3 is located at position 197448846 on chromosome 3, qSB5 is located at position 966087 on chromosome 5 and qSB9 is located at position 148431047 on chromosome 9; when the bases of markers qSB3, qSB5 and qSB9 are T, T and A or T, C and A, respectively, maize exhibits strong lodging resistance;

[0019] (2) The present invention also provides KASP primers for detecting markers closely linked to lodging resistance in maize, wherein the KASP primer sequences labeled with qSB3 are shown in SEQ ID NO.4 to SEQ ID NO.6; the KASP primer sequences labeled with qSB5 are shown in SEQ ID NO.7 to SEQ ID NO.9; and the KASP primer sequences labeled with qSB9 are shown in SEQ ID NO.10 to SEQ ID NO.12.

[0020] (3) The KASP primers related to the markers and detection markers closely linked to lodging resistance of maize provided by the present invention can be used for the breeding of lodging-resistant maize varieties and the identification of lodging resistance performance. This is of great significance for saving breeding costs, improving breeding efficiency and shortening the breeding cycle.

[0021] The technical solution of the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. Attached Figure Description

[0022] To more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings used in the description of the embodiments of the present invention will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0023] Figure 1 This is the genotyping result in Embodiment 1 of the present invention; where A is the qSB3 marker; B is the qSB5 marker; and C is the qSB6 marker.

[0024] Figure 2 This is the result of the genotyping information and trait association analysis in Embodiment 2 of the present invention; where A is the genotyping diagram of the number of small vascular bundles at locus 197,448,846 on chromosome 3, B is the genotyping diagram of the number of large vascular bundles at locus 966,087 on chromosome 5, and C is the genotyping diagram of the stem cross-sectional area at locus 148,431,047 on chromosome 9; ** and *** indicate significance at probability levels of 0.01 and 0.001, respectively;

[0025] Figure 3 The following are the typographical results of three markers used in Embodiment 3 of this invention to detect lodging-resistant and non-lodging-resistant varieties: A is the typographical diagram of 10 lodging-resistant inbred lines using the qSB3 marker; B is the typographical diagram of 10 lodging-resistant inbred lines using the qSB5 marker; C is the typographical diagram of 10 lodging-resistant inbred lines using the qSB9 marker; D is the typographical diagram of 10 non-lodging-resistant inbred lines using the qSB3 marker; E is the typographical diagram of 10 non-lodging-resistant inbred lines using the qSB5 marker; and F is the typographical diagram of 10 non-lodging-resistant inbred lines using the qSB9 marker. Detailed Implementation

[0026] The technical solution of the present invention will be further described below with reference to the accompanying drawings and embodiments.

[0027] To make the objectives, technical solutions, and advantages of this application clearer, more thorough, and more complete, the technical solutions of the present invention are described clearly and completely below with reference to the accompanying drawings and embodiments. The following detailed descriptions are all descriptions of embodiments, intended to provide further detailed explanation of the present invention. Unless otherwise specified, all technical terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0028] The instruments, equipment, reagents, and materials used in the examples were all obtained commercially.

[0029] Example 1

[0030] Genotyping of maize plants was performed using loci qSB3, qSB5, and qSB9, as detailed below:

[0031] (1) qSB3 is located at locus 197448846 on chromosome 3, qSB5 is located at locus 966087 on chromosome 5, and qSB9 is located at locus 148431047 on chromosome 9. The sequences of marker qSB3 and its upstream and downstream 100bp are shown in SEQ ID NO.1, the sequences of marker qSB5 and its upstream and downstream 100bp are shown in SEQ ID NO.2, and the sequences of marker qSB9 and its upstream and downstream 100bp are shown in SEQ ID NO.3.

[0032] SEQ ID NO.1:

[0033] GCTGTGTGCTCTGCTCACCACTGTTTCTGCGCTGCTGGTTGCTGTGATTGTG TTTTGCCATCACAAACTTCCCCTCCTCTTCCTCTCAAACGGGAAGCCT[G / T]GCAACTGCAGTTAGCTATCTTCACAGGATTCTCTCCGTCACGTAATTTCCTC ACGCGCTACCTCTCGTGGAACACAGGTACCAGAACGGGCGCCAGAACA

[0034] SEQ ID NO.2:

[0035] ATATGGGCGTTGCGGTTCTTTTGCTGCCACTCAGAGTCTCAGAGGGTCCTC AACCAGGTTCATGTTCGGGACGTGGTTGTTTGGAGCTCTCTGGTTTCAG[C / T]TTACGCTTTCCATGGTCGTGCAATCTCGCTTTTCCAACACATGGAGGACC AGGTTGGTGTTCGGGCTGACAGCATCATATTCCTTAGTTTGTTAGCGGCC

[0036] SEQ ID NO.3:

[0037] TTTTGTGCCACTCGACTGAATTGGTGTCAAATGCATATGTGCCCCAAAGTTG ATTGAATGATACCAGTATGTAGGTGTCGACCACCACATAAGACGTGAT[A / G]AGTACAACTGGCAGCATGGTATAAACAAATGGGGTAATCTTCCAAGGGAAG CAAGGTGGATGTGGTAGCTCAATCCAGGAGCATCCCTCCAGGTGGGAGC

[0038] The primers for amplifying qSB3, qSB5, and qSB9 markers are shown in Table 1. Each primer includes two upstream genotyping primers, A and B (each targeting one of the two alleles), and one downstream universal primer, C. The KASP primer sequence information in Table 1 was sent to the company for primer synthesis, and the primers were dissolved according to the instructions provided with the received primers.

[0039] Table 1. KASP primer information for amplification markers qSB3, qSB5, and qSB9.

[0040]

[0041] (2) Genomic DNA was extracted from 182 maize inbred lines provided by the Hebei Branch of the National Maize Improvement Center of Hebei Agricultural University, which had undergone breeding practices in both China and the United States (these 182 inbred lines broadly represent the germplasm resource base of China's main maize producing areas; for details of the 182 inbred lines, please refer to Zheng Yunxiao's 2021 Master's Thesis at Hebei Agricultural University, titled: Comprehensive Evaluation of Maize Lodging Resistance and Genetic Analysis of Stalk Vascular Bundle Traits. DOI:10.27109 / d.cnki.ghbnu.2021.000431.). After electrophoresis and Nanodrop detection, high-quality DNA solutions were selected, and the following dosage was added: DNA 1.5 μL, 2×Master mix (KASP V4.02X Mastermix 96 / 384, catalog number: KBS-1016-012, brand: LGC) 0.75 μL, primers 0.0417 μL, ddH2O A reaction mixture of 0.75 μL and a total volume of 3 μL was prepared. PCR amplification was performed using a high-throughput PCR instrument. The amplification program was as follows: 94℃ for 15 min; 94℃ for 20 s, 61-55℃ (gradient annealing, decreasing by 0.6℃ per cycle) for 60 s, 10 cycles; 94℃ for 20 s, 55℃ for 60 s, 26 cycles; 94℃ for 20 s, 57℃ for 60 s, 5 cycles.

[0042] After the PCR reaction, the fluorescence signal was converted into analyzable values ​​using an Omega fluorescence signal reader and an Araya instrument. Genotyping was then performed using Kraken™ software provided by LGC (Laboratory of the Government Chemist). The results were visualized using SNPviewer software. The specific principles for genotyping were as follows:

[0043] If the tested material shows a blue fluorescent signal at this SNP locus based on qSB3-KASP, its genotype is homozygous GG; if it shows a dark red fluorescent signal, its genotype is TT; if it shows a green fluorescent signal, its genotype is TG; black dots represent NTC empty tube controls; pink and purple are unknown. If the tested material shows a blue fluorescent signal at this SNP locus based on qSB5-KASP, its genotype is homozygous CC; if it shows a dark red fluorescent signal, its genotype is TT; if it shows a green fluorescent signal, its genotype is TC; black dots represent NTC empty tube controls; pink and purple are unknown. If the tested material shows a blue fluorescent signal at this SNP locus based on qSB9-KASP, its genotype is homozygous AA; if it shows a dark red fluorescent signal, its genotype is GG; if it shows a green fluorescent signal, its genotype is AG; black dots represent NTC empty tube controls; pink and purple are unknown.

[0044] The results of PCR amplification using a mixed primer set of 3-A, 3-B, and 3-C (qSB3-KASP marker) are as follows: Figure 1 As shown in A, if the primer combination perfectly matches the genomic DNA, the fluorescence signal in the detection result will be red, indicating that the detected plant is homozygous TT genotype; if the fluorescence signal in the detection result is blue, it indicates that the detected plant is homozygous GG genotype; and if the fluorescence signal in the detection result is green, it indicates that the detected plant is heterozygous TG genotype.

[0045] The results of PCR amplification using a mixed primer set of 5-A, 5-B, and 5-C (qSB5-KASP marker) are as follows: Figure 1 As shown in B, if the primer combination perfectly matches the genomic DNA, the fluorescence signal in the detection result will be red, indicating that the detected plant is homozygous TT genotype; if the fluorescence signal in the detection result is blue, it indicates that the detected plant is homozygous CC genotype; if the fluorescence signal in the detection result is green, it indicates that the detected plant is heterozygous TC genotype.

[0046] The results of PCR amplification using a mixed primer set of 9-A, 9-B, and 9-C (qSB6-KASP marker) are as follows: Figure 1 As shown in C, if the primer combination perfectly matches the genomic DNA, the fluorescence signal in the detection result will be red, indicating that the detected plant is homozygous GG genotype; if the fluorescence signal in the detection result is blue, it indicates that the detected plant is homozygous AA genotype; if the fluorescence signal in the detection result is green, it indicates that the detected plant is heterozygous AG genotype.

[0047] Example 2

[0048] Based on the known information on the number of small vascular bundles (NSVB), the number of large vascular bundles (NLVB), and the cross-sectional area (CSA) of stems one week after pollination of 182 inbred lines (see Zheng Yunxiao's 2021 Master's thesis at Hebei Agricultural University, titled: Comprehensive Evaluation of Lodging Resistance Traits and Genetic Analysis of Stem Vascular Bundle Traits in Maize. DOI:10.27109 / d.cnki.ghbnu.2021.000431.), the genotyping information of the three loci qSB3, qSB5, and qSB9 obtained in Example 1 was correlated with the information on the number of small vascular bundles, the number of large vascular bundles, and the cross-sectional area of ​​stems. The results are shown in Table 2 and... Figure 2 As shown.

[0049] The qSB3 marker locus (chromosome locus 197448846) has genotypes of TT, TG, or GG. The average number of small vascular bundles is 67.79 for the TT genotype and 57.29 for the GG genotype. The qSB5 marker locus (chromosome locus 966087) has genotypes of TT, TC, or CC. The average number of large vascular bundles is 65.12 for the TT genotype and 58.15 for the CC genotype. The qSB9 marker locus (chromosome locus 197448846) has genotypes of AA, AG, or GG. The average stem cross-sectional area is 10.85 for the AA genotype and 16.63 for the GG genotype.

[0050] Table 2. Genotype and trait correspondence at qSB3, qSB5, and qSB9 loci.

[0051]

[0052] Example 3

[0053] Studies have shown (see Zill P, Büttner A, Eisenmenger W, et al. Single nucleotide polymorphism and haplotype analysis of a novel tryptophan hydroxylase isoform (TPH2) gene in suicide victims[J]. Biological psychiatry, 2004, 56(8):581-586.) that using combined markers to identify target traits is more accurate than using single markers. The three markers qSB3, qSB5, and qSB9 provided in this invention can form eight major haplotype combinations as shown in Table 3.

[0054] Table 33 Haplotype Combinations of Markers

[0055] Tag Name Hap1 Hap2 Hap3 Hap4 Hap5 Hap6 Hap7 Hap8 qSB3-KASP T T T T G G G G qSB5-KASP T T C C T T C C qSB9-KASP A G A G A G A G

[0056] The 182 maize inbred lines in Example 1 were analyzed using the eight haplotype combinations shown in Table 3. The results are shown in Table 4. Different haplotype combinations have a significant impact on the lodging resistance of maize. It is known that the larger the NSVB, NLVB, and CSA, the stronger the lodging resistance. Therefore, the haplotype combination Hap1 (TTA) is the haplotype combination with strong lodging resistance in maize, followed by Hap3 (TCA), which can be used to breed maize varieties with high lodging resistance.

[0057] Table 4. Effects of different haplotype combinations on antagonism

[0058] Haplotype Combination NSVB NLVB <![CDATA[CSA(mm 2 )]]> Hap1(TTA) 78.82 74.11 18.27 Hap2(TTG) 64.39 68.27 18.12 Hap3(TCA) 69.68 73.34 15.19 Hap4(TCG) 65.39 68.27 18.12 Hap5 (GTA) 60.50 64.84 16.99 Hap6 (GTG) 58.10 62.93 17.95 Hap7(GCA) 59.68 60.22 17.70 Hap8(GCG) 55.38 55.21 16.362

[0059] Example 4

[0060] The primer pairs in Table 1 were used for the currently known highly lodging-resistant maize inbred lines R1656, 4003, LD61, Ye52106, Ye515, A801, 7026B, WIL901, 926, and Xu. The loci qSB3, qSB5, and qSB9 of n926 (see Zheng Yunxiao's 2021 Master's thesis at Hebei Agricultural University, titled: Comprehensive Evaluation of Lodging Resistance Traits and Genetic Analysis of Stalk Vascular Bundle Traits in Maize. DOI:10.27109 / d.cnki.ghbnu.2021.000431.) and non-lodging-resistant maize inbred lines IB014, NS501, B8, M7, Song1145, XOP2, PHM10, Max, 6103, and S8324 (see Zheng Yunxiao's 2021 Master's thesis at Hebei Agricultural University, titled: Comprehensive Evaluation of Lodging Resistance Traits and Genetic Analysis of Stalk Vascular Bundle Traits in Maize. DOI:10.27109 / d.cnki.ghbnu.2021.000431.) were analyzed using the same methods as in Example 1.

[0061] The results are shown in Table 5 and Figure 3 As shown, among the 10 lodging-resistant inbred lines, 8 were TT genotype, 1 was GG genotype, and 1 was TG genotype, as indicated by marker qSB3; 7 were TT genotype and 3 were CC genotype, as indicated by marker qSB5; and 8 were AA genotype, 1 was GG genotype, and 1 was GA genotype, as indicated by marker qSB9.

[0062] Among the 10 non-lodging-resistant inbred lines, the results using marker qSB3 showed that 8 inbred lines were of the GG genotype, 1 was of the TT genotype, and 1 was of the TG genotype; the results using marker qSB5 showed that 9 inbred lines were of the CC genotype, and 1 was of the TT genotype; and the results using marker qSB9 showed that 8 inbred lines were of the GG genotype, 1 was of the AA genotype, and 1 was of the AG genotype.

[0063] In single-marker detection, the screening rates for lodging resistance dominant genes using the three markers were 80% (TT), 70% (TT), and 80% (AA), respectively. The screening rate using multiple markers was 70% (TTA). The screening rates for non-lodging resistance dominant genes using the three markers were 80% (GG), 80% (CC), and 90% (GG), respectively. The screening rate using multiple markers was 80% (GCG). Therefore, these three markers can be used to screen for lodging resistance in maize inbred lines.

[0064] Table 5 Bases of qSB3, qSB5 and qSB9

[0065]

[0066] Therefore, this invention discovers for the first time three markers closely linked to lodging resistance in maize: qSB3, qSB5, and qSB9. qSB3 is located at locus 197448846 on chromosome 3, qSB5 at locus 966087 on chromosome 5, and qSB9 at locus 148431047 on chromosome 9. When the bases of markers qSB3, qSB5, and qSB9 are T, T, and A, or T, C, and A, respectively, maize exhibits strong lodging resistance. The invention also provides KASP primers for detecting these three markers closely linked to lodging resistance in maize, with primer sequences shown in SEQ ID NO.1 to SEQ ID NO.9. The provided KASP primers for the markers closely linked to lodging resistance in maize and the detection markers can be used for breeding maize varieties with lodging resistance and for identifying lodging resistance performance. This is of great significance for saving breeding costs, improving breeding efficiency, and shortening the breeding cycle.

[0067] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit them. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can still be made to the technical solutions of the present invention, and these modifications or equivalent substitutions cannot cause the modified technical solutions to deviate from the spirit and scope of the technical solutions of the present invention.

Claims

1. The application of markers closely linked to lodging resistance in maize variety breeding, characterized by: The maize variety is a lodging-resistant variety; the markers closely linked to the lodging resistance of maize are qSB3, qSB5, and qSB9; qSB3 is located at locus 197448846 on chromosome 3; the sequence of qSB3 and its upstream and downstream 100bp are shown in SEQ ID NO.1; qSB5 is located at locus 966087 on chromosome 5; the sequence of qSB5 and its upstream and downstream 100bp are shown in SEQ ID NO.2; qSB9 is located at position 148431047 on chromosome 9; the sequence of qSB9 and its upstream and downstream 100bp are shown in SEQ ID NO.3; when the bases of qSB3, qSB5 and qSB9 are labeled as T, T and A or T, C and A, respectively, maize exhibits strong lodging resistance.

2. The application of a kit for detecting lodging resistance in maize in maize variety breeding, characterized in that: The maize variety is a lodging-resistant variety; the kit includes primers for detecting the marker described in claim 1 that is closely linked to maize lodging resistance; The primers are KASP primers; the KASP primer sequences labeled qSB3 are shown in SEQ ID NO.10~SEQ ID NO.12; the KASP primer sequences labeled qSB5 are shown in SEQ ID NO.7~SEQ ID NO.9; and the KASP primer sequences labeled qSB9 are shown in SEQ ID NO.4~SEQ ID NO.

6.

3. The application of the markers closely linked to maize lodging resistance as described in claim 1 in the identification of maize lodging resistance.

4. The application of the kit for detecting lodging resistance of maize as described in claim 2 in the identification of maize lodging resistance.

Images