Application of TCL1A in preparation of NLRP7 mutation pathogenicity detection kit related to grape tire and kit
By constructing Flag-NLRP7 and Myc-TCL1A plasmids and combining immunoprecipitation and Western blotting to detect the binding ability of NLRP7 and TCL1A, the problem of difficulty in verifying the pathogenicity of NLRP7 mutations in existing technologies was solved, and a simple and easy mutant function assessment was achieved, which is suitable for clinical diagnosis.
Patent Information
- Application Number
- CN202510877340.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-27
- Publication Date
- 2025-09-12
AI Technical Summary
Existing technologies lack reliable molecular biological and biochemical methods to verify the pathogenicity of NLRP7 mutations, especially for sporadic missense mutations. In addition, NLRP7 gene mutations exhibit phenotypic heterogeneity, making it difficult to determine their pathogenicity.
By constructing Flag-NLRP7 wild-type and Myc-TCL1A plasmids, the binding ability of NLRP7 to TCL1A was detected by immunoprecipitation technology, and the functional impairment of NLRP7 mutants was evaluated, and the results were analyzed in combination with Western blotting.
It has achieved in vitro evaluation of the function of NLRP7 mutants, and can easily verify the pathogenicity of NLRP7 mutations. It is suitable for clinical use and provides technical support for clinical diagnosis.
Smart Images
Figure CN120629592A_ABST
Abstract
Description
Technical Field
[0001] The present application belongs to the field of biotechnology, and in particular relates to an application of TCL1A in the preparation of a kit for detecting the pathogenicity of NLRP7 mutations associated with hydatidiform mole, and a kit. Background Art
[0002] Hydatidiform mole (HM) is a reproductive disorder characterized by abnormal embryonic development and trophoblastic hyperproliferation. Women with a history of molar pregnancy are at increased risk for recurrent hydatidiform mole (RHM) and the potential for further development of malignant gestational trophoblastic tumors. NLRP7 was first identified in a human maternal gene from familial recurrent hydatidiform mole (FRHM), with pathogenic variants accounting for approximately 55% of RHM cases. Clinically, pathogenic NLRP7 mutations in patients are typically determined using genetic pedigrees combined with bioinformatics software. Currently, reliable molecular biological and biochemical methods are lacking to cross-validate these traditional approaches, particularly for sporadic missense mutations. Furthermore, NLRP7 mutations exhibit phenotypic heterogeneity, ranging from early embryonic arrest to miscarriage, multilocus imprinting disorder (MLID), and even live birth during assisted reproduction. This complicates the determination of the pathogenicity of NLRP7 mutations. In this application, based on our recent findings that TCL1A is a novel NLRP7 binding protein and that most hydatidiform mole-associated NLRP7 mutations disrupt binding to TCL1A, we provide a basis for experimentally assessing the extent to which mutations disrupt NLRP7 function. Summary of the Invention
[0003] The present invention provides an application of TCL1A in the preparation of a kit for detecting pathogenicity of NLRP7 mutations associated with hydatidiform mole to solve the problems existing in the related art. The technical solution is as follows:
[0004] In a first aspect, an embodiment of the present application provides a use of TCL1A in preparing a kit for detecting pathogenicity of NLRP7 mutations associated with hydatidiform mole.
[0005] In a second aspect, an embodiment of the present application provides a kit for detecting pathogenicity of NLRP7 mutations associated with hydatidiform mole, the kit comprising a Flag-NLRP7 wild-type plasmid and a Myc-TCL1A plasmid and a lysate.
[0006] In one embodiment, the Flag-NLRP7 wild-type plasmid is prepared by amplifying the NLRP7 gene sequence using primers and then recombining with p3×Flag-CMV10;
[0007] The Myc-TCL1A is prepared by amplifying the gene sequence of TCL1A using primers and then recombining it with p5×Myc-CMV10.
[0008] In one embodiment, the primers for amplifying the NLRP7 gene sequence are:
[0009] NLRP7-F:ATGACAAGCTTGCGGCCGCGATGACATCGCCCCAGCTAG, NLRP7-R:GCCACCCGGGATCCTCTAGATCAGCAAAAAAAGTCACAGCA;
[0010] The primers for amplifying the TCL1A gene sequence are:
[0011] TCL1A-F:ATGACAAGCTTGCGGCCGCGATGGCCGAGTGCCCG, TCL1A-R:GCCACCCGGGATCCTCTAGATCAGTCATCTGGCAGCAGCT.
[0012] In one embodiment, the mRNA number of NLRP7 is NM_001127255.2; the mRNA number of TCL1A is NM_021966.3.
[0013] In one embodiment, p3×Flag-CMV10 is digested with the endonucleases Not1 and Xba1, and then recombined with the amplified NLRP7 gene sequence according to the instructions of the OneStep Cloning Kit;
[0014] After p5×Myc-CMV10 was digested with the endonucleases Not1 and Xba1, plasmid recombination was performed with the amplified TCL1A gene sequence according to the instructions of the One Step Cloning Kit.
[0015] In one embodiment, the lysis buffer comprises 25 mM Tris-HCl, pH=7.4, 150 mM NaCl, 1 mM EDTA, 1% NP-40 and 1× protease inhibitor.
[0016] In a third aspect, the present invention provides a method for using the above-mentioned kit.
[0017] The Flag-NLRP7 wild-type plasmid and Myc-TCL1A plasmid were transformed and the plasmids were extracted respectively;
[0018] The extracted plasmid was transfected into cells and cultured. The cells were collected and lysed. The lysate containing the Flag-NLRP7 wild type was immunoprecipitated and then mixed and incubated with the lysate containing Myc-TCL1A. The eluted immunoprecipitate was detected by Western blotting.
[0019] In one embodiment, based on the NLRP7 mutation information of clinical patient samples, primers with relevant mutations are used to obtain an expression vector of mutant NLRP7 using a wild-type plasmid as a template, which is the sample plasmid to be tested;
[0020] The test sample plasmid was treated according to the above-mentioned Flag-NLRP7 wild-type plasmid treatment method; and Western blotting was performed.
[0021] In one embodiment, the amount of Flag-NLRP7 wild-type and the amount of NLRP7 mutant to be tested precipitated on TCL1A is compared to determine the functional impairment of the NLRP7 mutant to be tested.
[0022] The advantages or beneficial effects of the above technical solution include at least:
[0023] In this application, by expressing NLRP7 and interacting with TCL1A, the NLRP7 mutation can be evaluated based on the ability of NLRP7 to bind to TCL1A, and the functional impairment of the NLRP7 mutant to be tested can be determined; the in vitro evaluation of the functional abnormalities of NLRP7 mutants is achieved, providing technical options for the next step of clinical use.
[0024] The above summary is for illustrative purposes only and is not intended to be limiting in any way. In addition to the illustrative aspects, embodiments and features described above, further aspects, embodiments and features of the present application will be readily apparent by reference to the accompanying drawings and the following detailed description. BRIEF DESCRIPTION OF THE DRAWINGS
[0025] In the accompanying drawings, unless otherwise specified, the same reference numerals throughout the multiple drawings represent the same or similar components or elements. These drawings are not necessarily drawn to scale. It should be understood that these drawings only depict some embodiments disclosed in this application and should not be construed as limiting the scope of this application.
[0026] Figure 1 Flowchart for the detection of NLRP7-TCL1A binding ability;
[0027] Figure 2 WB graph of the binding ability of NLRP7 mutants to TCL1A;
[0028] Figure 3 This is the result of data analysis of WB results using Image J software. DETAILED DESCRIPTION
[0029] Hereinafter, only certain exemplary embodiments are briefly described. As will be appreciated by those skilled in the art, the described embodiments may be modified in various ways without departing from the spirit or scope of the present application. Therefore, the drawings and description are to be regarded as illustrative in nature and not restrictive.
[0030] Example 1
[0031] Clinical testing (e.g., genetic diagnosis) has confirmed that the patient carries an NLRP7-related mutation. This mutation can generally be detected by whole-exome sequencing of the patient's blood DNA combined with PCR verification, or by direct PCR amplification and sequencing of the NLRP7 gene exons. Because this section is a standard clinical method, it is not included in this application.
[0032] 1) Plasmid construction
[0033] Expression plasmids of NLRP7 wild type, patient-specific NLRP7 mutant, and TCL1A were constructed.
[0034] The plasmid must be suitable for expression in mammalian cells (such as HEK293T cells) and must carry an appropriate tag sequence that can be used for immunoprecipitation, such as Flag-tagged-NLRP7 or Myc-tagged-TCL1A, which carry different tags to facilitate subsequent detection.
[0035] In the present application, p3×Flag-CMV10 (Sigma-Aldrich) and p5×Myc-CMV10 vectors in which the 3×Flag tag is replaced with a 5×Myc tag were used.
[0036] Specifically, the expression region fragment of NLRP7 (mRNA number: NM_001127255.2) was amplified using primers and purified and recovered;
[0037] NLRP7-F:ATGACAAGCTTGCGGCCGCGATGACATCGCCCCAGCTAG,NLRP7-R:GCCACCCGGGATCCTCTAGATCAGCAAAAAAAGTCACAGC A,
[0038] The expression region fragment of TCL1A (mRNA number: NM_021966.3) was amplified using primers and purified and recovered;
[0039] TCL1A-F:ATGACAAGCTTGCGGCCGCGATGGCCGAGTGCCCG, TCL1A-R:GCCACCCGGGATCCTCTAGATCAGTCATCTGGCAGCAGCT,
[0040] p3×Flag-CMV10 and p5×Myc-CMV10 were digested with endonucleases Not1 and Xba1, respectively, and purified and recovered. The NLRP7 amplified product was recombined with the digested p3×Flag-CMV10 according to the instructions of the One Step Cloning Kit (C112-01, Vazyme) and named Flag-NLRP7. The TCL1A amplified product was recombined with the digested p5×Myc-CMV10 according to the instructions of the One Step Cloning Kit (C112-01, Vazyme) and named Myc-TCL1A.
[0041] The constructed vector was confirmed by Sanger sequencing.
[0042] The construction of mutant vectors was based on Flag-NLRP7. Flag-NLRP7 was mutated using a point mutagenesis kit (e.g., MutExpress II Fast Mutagenesis Kit V2) to 52 reported NLRP7 mutants: C84Y, R156R, V182M, T185del, L234S, F250L, K277Q, L311I, E340K, K379N, G380R, R390H, L398R, C399Y, R413W, A494T, G498R, K511R, P651S, D657V, R659L, L661F, C668R, S675T, R 693G, R693W, R693Q, R693P, R701C, C704Y, P716A, A719V, R721W, R721Q, D722G, H735P, L750V, C761Y, R795C, R815H, I858T, L880S, N913S, L964P, D1201V, G981Rfs*19, C931*, W920*, Y872*, I858Hfs*11, E776Gfs*11, H520Tfs*46, etc.
[0043] 2) Extraction of plasmid
[0044] The plasmid was transformed into competent E. coli Top10, plated on solid LB medium containing 100 μg / ml ampicillin, and cultured overnight in a 37°C incubator. A single colony was picked and inoculated into 50 ml of LB medium containing 100 μg / ml ampicillin for 14 hours. The endotoxin-free plasmid was extracted according to the instructions and the concentration was adjusted to 1000 ng / μl.
[0045] If the expression fragment contains repetitive sequences, use, for example, stabl3 competent cells instead of TOP10 competent cells.
[0046] 3) Cell culture and transfection.
[0047] The vectors of Flag-NLRP7, mutant (transfected in 12-well plates) and Myc-TCL1A (transfected in 10 cm culture dishes) were expressed in HEK293T cells for 24-36 hours.
[0048] 4) Flag pull-down
[0049] After removing the culture medium, add 500 μl of cold PBS and blow up the cells; transfer to a 1.5 ml EP tube, centrifuge at 1000 g for 3 minutes at 4°C, and remove the supernatant;
[0050] Resuspend in 200 μl of lysis buffer (25 mM Tris-HCl pH 7.4, 150 mM NaCl, 1 mM EDTA, 1% NP-40, and 1× protease inhibitor) and place on ice for 15 minutes; centrifuge at 12,000 g for 15 minutes at 4°C.
[0051] The supernatant was collected to obtain lysate containing Flag-NLRP7, lysate containing mutants, and lysate containing Myc-TCL1A;
[0052] Add 0.2-0.5 μl of anti-Flag antibody (AE092 from abclonal, or other commercially available Flag antibodies) and 15 μl of agerose-protein A+G beads (Beyotime) to the lysate containing Flag-NLRP7 or mutants; incubate at 4°C for 2 hours. Alternatively, replace the antibody and beads with anti-Flag affinity gel (such as AE121 from abclonal) depending on the specific situation.
[0053] Then, the lysate supernatant was removed by centrifugation at 1000g for 1 min, and the beads were incubated with lysis buffer containing Myc-TCL1A (200 μl) for another 2 h at 4°C;
[0054] 10 μl of Myc-TCL1A lysate was retained in each group as input; 500 μl of lysate was washed four times, each time incubated at 4°C for 5 minutes; 25 μl of 1.5× SDS loading buffer was added, and the sample was boiled at 95°C for 10 minutes before Western blotting. Figure 1 As shown, the WB results are as follows Figure 2 shown.
[0055] 5) Data Analysis
[0056] After the bands in Western blotting were scanned in grayscale using Image J software, the concentrations were calculated using the formula [co-IP(TCL1A) / co-IP(NLRP7)] / input(TCL1A), and normalized to the wild type as 100%. Figure 3 As shown in Table 1.
[0057] The pathogenicity of NLRP7 mutations was determined by comparing the amount of NLRP7 precipitated onto TCL1A in the wild-type and mutant groups.
[0058] Table 1
[0059]
[0060] A total of 45 missense mutations and 7 frameshift or stop mutations were detected. These 52 mutations primarily caused recurrent hydatidiform mole (RHM) (35 cases), non-recurrent hydatidiform mole (nRHM) (11 cases), and miscarriage or embryogenesis (6 cases). Of these, 25 RHM, 4 nRHM, and 1 miscarriage-associated variants disrupted binding to TCL1A. Therefore, the binding of NLRP7 to TCL1A strongly corresponds to the pathogenic NLRP7 mutations associated with recurrent hydatidiform mole.
[0061] Clinically, genetic pedigrees combined with bioinformatics software are often used to determine whether a patient's NLRP7 mutation is pathogenic. Using the kit described in this application, by comparing the amount of NLRP7 precipitated onto TCL1A in wild-type and mutant groups, the pathogenicity of NLRP7 mutations can be determined, complementing traditional prediction methods. This method is simple and suitable for most differentiation testing laboratories.
[0062] In the description of this specification, the reference terms "one embodiment," "some embodiments," "example," "specific example," or "some examples" mean that the specific features, structures, materials, or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present application. Moreover, the specific features, structures, materials, or characteristics described may be combined in any appropriate manner in any one or more embodiments or examples. In addition, those skilled in the art may combine and combine different embodiments or examples described in this specification, as well as features of different embodiments or examples, unless they are mutually inconsistent.
[0063] Furthermore, the terms "first" and "second" are used for descriptive purposes only and should not be construed as indicating or implying relative importance or implicitly specifying the number of technical features being referred to. Thus, a feature defined as "first" or "second" may explicitly or implicitly include at least one such feature. Throughout the description of this application, "plurality" means two or more, unless otherwise specifically defined.
[0064] The above description is merely a specific embodiment of the present application, but the scope of protection of the present application is not limited thereto. Any person skilled in the art can easily conceive of various modifications or substitutions within the technical scope disclosed in this application, and such modifications or substitutions should be included within the scope of protection of the present application. Therefore, the scope of protection of the present application should be based on the scope of protection of the claims.
Claims
1. Application of TCL1A in the preparation of a detection kit for pathogenicity of NLRP7 mutations associated with hydatidiform mole.
2. A kit for detecting pathogenicity of NLRP7 mutations associated with hydatidiform mole, characterized in that: The kit includes a Flag-NLRP7 wild-type plasmid, a Myc-TCL1A plasmid, and a lysate.
3. The kit according to claim 2, wherein The Flag-NLRP7 wild-type plasmid was prepared by amplifying the NLRP7 gene sequence using primers and then recombining with p3×Flag-CMV10; The Myc-TCL1A is prepared by amplifying the gene sequence of TCL1A using primers and then recombining it with p5×Myc-CMV10.
4. The kit according to claim 3, wherein The primers for amplifying the NLRP7 gene sequence are: NLRP7-F:ATGACAAGCTTGCGGCCGCGATGACATCGCCCCAGCTAG, NLRP7-R:GCCACCCGGGATCCTCTAGATCAGCAAAAAAAGTCACAGCA; The primers for amplifying the TCL1A gene sequence are: TCL1A-F:ATGACAAGCTTGCGGCCGCGATGGCCGAGTGCCCG, TCL1A-R:GCCACCCGGGATCCTCTAGATCAGTCATCTGGCAGCAGCT.
5. The kit according to claim 3, characterized in that The mRNA number of the NLRP7 is NM_001127255.2; the mRNA number of the TCL1A is NM_021966.
3.
6. The kit according to claim 3, characterized in that After digesting p3×Flag-CMV10 with the restriction enzymes Not1 and Xba1, the plasmid was recombined with the amplified NLRP7 gene sequence according to the instructions of the One Step Cloning Kit; After p5×Myc-CMV10 was digested with the endonucleases Not1 and Xba1, plasmid recombination was performed with the amplified TCL1A gene sequence according to the instructions of the One Step Cloning Kit.
7. The kit according to claim 3, wherein The lysis solution includes 25 mM Tris-HCl, pH=7.4, 150 mM NaCl, 1 mM EDTA, 1% NP-40 and 1× protease inhibitor.
8. A method for using the kit according to claim 3, characterized in that: The Flag-NLRP7 wild-type plasmid and Myc-TCL1A plasmid were transformed and the plasmids were extracted respectively; The extracted plasmid was transfected into cells and cultured. The cells were collected and lysed. The lysate containing the Flag-NLRP7 wild type was immunoprecipitated and then mixed and incubated with the lysate containing Myc-TCL1A. The eluted immunoprecipitated product was detected by Western blotting.
9. The method of use according to claim 8, characterized in that: Based on the NLRP7 mutation information of clinical patient samples, primers with relevant mutations are used to obtain the expression vector of mutant NLRP7 using the wild-type plasmid as a template, which is the sample plasmid to be tested; The test sample plasmid is processed according to the Flag-NLRP7 wild-type plasmid processing method of claim 8; and Western blotting is performed.
10. The method of use according to claim 9, characterized in that: The amount of Flag-NLRP7 wild type and the NLRP7 mutant to be tested precipitated on TCL1A was compared to determine the functional impairment of the NLRP7 mutant to be tested.