Use of circular RNA hsa_circ_0008135 in acute myeloid leukemia with NPM1 mutation

Abstract

The application discloses application of circular RNA hsa_circ_0008135 in acute myeloid leukemia with NPM1 mutation, and determines that the differentially expressed circular RNA in NPM1 mutant AML patients and non-NPM1 mutant AML patients is hsa_circ_0008135; hsa_circ_0008135 knockdown inhibits OCI-AML3 cell proliferation, and hsa_circ_0008135 overexpression promotes OCI-AML3 cell proliferation; hsa_circ_0008135 knockdown promotes intracellular ferroptosis of OCI-AML3 cells; and hsa_circ_0008135 overexpression inhibits intracellular ferroptosis of OCI-AML3 cells, thereby providing a possible new therapeutic target for clinical treatment of NPM1 mutant AML.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to the application of circular RNA hsa_circ_0008135 in NPM1-mutant acute myeloid leukemia. Background Technology

[0002] Acute myeloid leukemia (AML) is a malignant clonal hematologic disorder characterized by abnormal proliferation of primitive and immature myeloid cells in the bone marrow and peripheral blood, accompanied by impaired differentiation of hematopoietic stem cells or progenitor cells in the bone marrow. Clinical data shows that nearly one-third of newly diagnosed AML patients have nucleophosmin 1 (NPM1) gene mutations. Due to its unique clinicopathological and molecular characteristics, NPM1-mutant AML was included as a separate subtype in the 2017 World Health Organization (WHO) Classification of Hematopoietic and Lymphoid Tissue Tumors Guidelines. These patients often have normal chromosomal karyotypes and rarely have recurrent gene abnormalities associated with AML. Although new molecularly targeted drugs such as Bcl-2 inhibitors (venetoclax) and various immunotherapy regimens have emerged in recent years, the clinical treatment of NPM1-mutant leukemia still faces the challenge of relapse and refractory disease. Therefore, it is urgent to further elucidate the pathogenesis of NPM1-mutant AML and find individualized precision treatment strategies.

[0003] Circular RNA (circRNA) was first discovered in RNA viruses in 1976 and initially thought to be viroids. In 1991, circRNA was observed in eukaryotic cell lines using electron microscopy and was once considered a byproduct of missplicing. However, with the rapid development of high-throughput sequencing technology and bioinformatics, a large number of circRNAs have been identified in eukaryotes, clearly demonstrating that they are not accidental or missplicing byproducts, but rather a class of RNA molecules that play important roles in cells. circRNA is an endogenous non-coding RNA. Unlike traditional linear RNA, it lacks a 5' cap and a 3' poly(A) tail, forming a closed circular structure through backsplicing of exon sequences. It is highly stable and resistant to degradation, exhibiting exceptional conservation in most species, but also showing tissue specificity and expression specificity at different developmental stages. As an important regulatory factor in the human genome, circRNA is closely related to the malignant transformation of tumors. Current research indicates that circRNA is becoming an important potential diagnostic, prognostic, and therapeutic target for leukemia.

[0004] The research progress of circular RNA in the occurrence and development of leukemia[1] disclosed that: by screening gene chips, high expression levels of circRNAs in AML were identified, including hsa_circ_0004277, hsa_circ_00750, etc. It was found that the expression levels of these circRNAs in AML showed corresponding dynamic changes with the evolution of AML. At the biological level, they have competitive or cleavage effects with homologous linear RNAs, and have high potential as prognostic indicators of AML.

[0005] The paper "Expression and Clinical Significance of MDM2 Circular RNA in Bone Marrow of Patients with Acute Myeloid Leukemia" [2] discloses that: upregulation of circ-MDM2 expression is a common event in AML patients, and the level of bone marrow circ-MDM2 has certain diagnostic value for AML and can be used as a potential biomarker to distinguish AML patients from the control group. circ-MDM2 expression is related to CEBPA mutation, but has no significant relationship with the patient's overall survival time and leukemia-free survival time.

[0006] The research progress of circular RNA in leukemia prognosis and imatinib resistance[3] disclosed that circ-VIM, circ-PVT1, circ-DLEU2, circ-ANAPC7, circ-PAN3, circ-HIPK2, hsa_circ_0004277, and hsa_circ_0075001 are used as diagnostic biomarkers or treatment targets for acute myeloid leukemia.

[0007] The paper "CircZBTB46 Protects Acute Myeloid Leukemia Cells from Ferroptotic Cell Death by Upregulating SCD" [4] published that: analysis of CircRNA microarray datasets revealed differentially expressed CircRNAs in AML patients. Among them, circZBTB46 was significantly upregulated in AML patients and AML cells. Further analysis showed that the expression level of circZBTB46 was closely related to the disease stage of AML patients, and showed high sensitivity and specificity in AML diagnosis, and is expected to become a potential biomarker for AML diagnosis.

[0008] The paper "Deregulation of CircANXA2, Circ0075001, and CircFBXW7 Gene Expressions and Their Predictive Value in Egyptian Acute Myeloid Leukemia Patients" [5] describes the evaluation of the expression of circANXA2, circ0075001, and circFBXW7 genes in AML patients and their relationship with clinical, cytogenetic, and overall survival outcomes, emphasizing the diagnostic role and prognostic impact of the three circular RNAs in AML.

[0009] The article "A novel circular RNA (hsa_circ_0000370) increases cell viability and inhibits apoptosis of FLT3-ITD-positive acute myeloid leukemia cells by regulating miR-1299 and S100A7A" [6] discloses that a novel circular RNA circ_0000370 is significantly elevated in FLT3-ITD+AML and promotes AML cell proliferation, thus playing a pro-cancer role. Bioinformatics prediction and in vitro experiments confirmed that circ_0000370 exerts its biological function through the miR-1299 / S100A7A axis.

[0010] In summary, most research focuses on exploring the pathogenesis of AML and investigating the association between circular RNA and AML. However, at present, the clinical treatment of NPM1-mutant leukemia still faces the challenge of relapse and refractory disease, and finding new therapeutic targets is an urgent clinical need. The role of circular RNA hsa_circ_0008135 in NPM1-mutant acute myeloid leukemia has not yet been reported.

[0011] References:

[0012] [1] Ma Wenjuan, Zhao Chuan, Chen Che. Research progress on the role of circular RNA in the occurrence and development of leukemia [J]. Basic Medicine and Clinical Practice, 2019(4):4. DOI:CNKI:SUN:JCYL.0.2019-04-024.

[0013] [2] Zhao Qian, Wu Delong, Su Xiaoyu, et al. Expression and clinical significance of MDM2 circular RNA in bone marrow of patients with acute myeloid leukemia [J]. Journal of Jiangsu University (Medical Edition), 2021, 31(6):6. DOI:10.13312 / j.issn.1671-7783.y210073.

[0014] [3] Research progress on the role of circular RNA in leukemia prognosis and imatinib resistance

[0015] [4]CircZBTB46 Protects Acute Myeloid Leukemia Cells from FerroptoticCell Death by Upregulating SCD

[0016] [5]Deregulation of CircANXA2,Circ0075001,and CircFBXW7 GeneExpressions and Their Predictive Value in Egyptian Acute Myeloid LeukemiaPatients

[0017] [6]A novel circular RNA(hsa_circ_0000370) increases cell viability and inhibits apoptosis of FLT3-ITD-positive acute myeloid leukemia cells byregulating miR-1299and S100A7A Summary of the Invention

[0018] To address the problems existing in the prior art, this application studied and identified hsa_circ_0008135 as the differentially expressed circular RNA between NPM1-mutant AML patients and non-NPM1-mutant AML patients; knockdown of hsa_circ_0008135 inhibits OCI-AML3 cell proliferation, while overexpression of hsa_circ_0008135 promotes OCI-AML3 cell proliferation; knockdown of hsa_circ_0008135 promotes intracellular ferroptosis in OCI-AML3 cells; and overexpression of hsa_circ_0008135 inhibits intracellular ferroptosis in OCI-AML3 cells; the specific technical solution of this invention is as follows:

[0019] The first aspect involves studying differentially expressed circular RNAs between NPM1-mutant AML patients and non-NPM1-mutant AML patients.

[0020] (i) Screening for differentially expressed circular RNAs between NPM1-mutant AML patients and non-NPM1-mutant AML patients using databases.

[0021] circRNA expression microarray data of NPM1-mutant AML patients (3 cases), non-NPM1-mutant AML patients (3 cases), and healthy controls (4 cases) were downloaded from GEO (GSE94591) to identify differentially expressed circRNAs between NPM1-mutant AML patients and non-NPM1-mutant AML patients. Results: Compared with the circRNAs of non-NPM1-mutant AML patients, four circRNAs were significantly highly expressed in NPM1-mutant AML patients, including hsa_circ_0008135.

[0022] The differentially expressed circRNAs between NPM1-mutant AML patients and healthy controls were identified. The results showed that 137 circRNAs were significantly highly expressed in NPM1-mutant AML patients compared with those in healthy controls, including hsa_circ_0008135. Therefore, hsa_circ_0008135 was selected for subsequent experiments.

[0023] (II) Verify using clinical samples whether hsa_circ_0008135 is a differentially expressed circular RNA in NPM1-mutant AML patients and non-NPM1-mutant AML patients.

[0024] Clinical samples were tested using qRT-PCR;

[0025] Conclusion: The expression level of hsa_circ_0008135 in NPM1-mutant acute myeloid leukemia (AML) patients (n=23) was significantly higher than that in non-NPM1-mutant AML patients (n=49).

[0026] Secondly, we examined the differential expression of hsa_circ_0008135 in seven types of myeloid leukemia cells.

[0027] Conclusion: Compared with six myeloid leukemia cell lines (NB4, THP-1, HL-60, U937, OCI-AML2, and KG-1α), hsa_circ_0008135 was relatively highly expressed in OCI-AML3, a leukemia cell line naturally carrying the NPM1 gene mutation.

[0028] Thirdly, the effect of knocking down hsa_circ_0008135 on the proliferation of OCI-AML3 cells.

[0029] (I) Effect of CCK8 assay on the effect of hsa_circ_0008135 knockdown on OCI-AML3 cell proliferation

[0030] The relative absorbance of OCI-AML3 cells with knocked-down hsa_circ_0008135 was detected using CCK8 assay.

[0031] Conclusion: Knockdown of hsa_circ_0008135 in OCI-AML3 cells significantly inhibited proliferation.

[0032] (II) Effect of EdU-detected knockdown of hsa_circ_0008135 on OCI-AML3 cell proliferation

[0033] EdU detection was performed on OCI-AML3 cells with hsa_circ_0008135 knockdown. + Cell percentage.

[0034] Results: Knockdown of EDU in HSA_circ_0008135 OCI-AML3 cells + The percentage of cells decreased significantly.

[0035] (III) Effect of knockdown of hsa_circ_0008135 on OCI-AML3 cell proliferation as detected by colony formation assay

[0036] Results: OCI-AML3 cells with knocked-down hsa_circ_0008135 had smaller cell colonies and a significantly reduced colony formation rate.

[0037] In summary: knocking down hsa_circ_0008135 inhibits the proliferation of OCI-AML3 cells.

[0038] Fourthly, the effect of overexpression of hsa_circ_0008135 on the proliferation of OCI-AML3 cells.

[0039] (I) Effect of CCK8 assay on the proliferation of OCI-AML3 cells overexpressed with hsa_circ_0008135

[0040] Conclusion: Overexpression of hsa_circ_0008135 promotes the proliferation of OCI-AML3 cells.

[0041] (II) Effect of EdU detection on the proliferation of OCI-AML3 cells overexpression of hsa_circ_0008135

[0042] Results: EDU in OCI-AML3 cells overexpressing hsa_circ_0008135 + The percentage of cells increased significantly.

[0043] (III) Effects of overexpression and knockdown of hsa_circ_0008135 on the proliferation of OCI-AML3 cells.

[0044] Results: OCI-AML3 cells overexpressing hsa_circ_0008135 showed larger cell colonies and a significantly increased colony formation rate.

[0045] In summary: Overexpression of hsa_circ_0008135 promotes the proliferation of OCI-AML3 cells.

[0046] Fifthly, the effect of knocking down hsa_circ_0008135 on intracellular ferroptosis in OCI-AML3 cells.

[0047] (I) Effect of knockdown of hsa_circ_0008135 on intracellular iron level in OCI-AML3 cells. Detection of iron level in OCI-AML3 cells with knockdown of hsa_circ_0008135.

[0048] Conclusion: Knockdown of hsa_circ_0008135 significantly increases the relative iron level in OCI-AML3 cells.

[0049] (II) Effect of knockdown of hsa_circ_0008135 on intracellular ROS levels in OCI-AML3 cells. ROS levels in OCI-AML3 cells with knockdown of hsa_circ_0008135 were detected using ROS detection.

[0050] Conclusion: Knockdown of hsa_circ_0008135 promotes ROS expression in OCI-AML3 cells.

[0051] (III) Effects of knockdown of hsa_circ_0008135 on SLC7A11 protein levels in OCI-AML3 cells

[0052] Western blotting was used to detect the level of SLC7A11 protein in OCI-AML3 cells with knockdown of hsa_circ_0008135.

[0053] Conclusion: Knocking down hsa_circ_0008135 inhibits SLC7A11 protein expression in OCI-AML3 cells.

[0054] In summary: Knockdown of hsa_circ_0008135 promotes intracellular ferroptosis in OCI-AML3 cells.

[0055] Sixth aspect: The effect of overexpression of hsa_circ_0008135 on intracellular ferroptosis in OCI-AML3 cells.

[0056] (I) Effect of overexpression of hsa_circ_0008135 on intracellular iron levels in OCI-AML3 cells

[0057] Conclusion: Overexpression of hsa_circ_0008135 can significantly inhibit the relative iron level in OCI-AML3 cells.

[0058] (II) Effect of overexpression of hsa_circ_0008135 on intracellular ROS levels in OCI-AML3 cells Conclusion: Overexpression of hsa_circ_0008135 inhibits intracellular ROS expression in OCI-AML3 cells.

[0059] (III) Effects of overexpression of hsa_circ_0008135 on SLC7A11 protein levels in OCI-AML3 cells

[0060] Conclusion: Overexpression of hsa_circ_0008135 promotes SLC7A11 protein expression in OCI-AML3 cells.

[0061] In summary: Overexpression of hsa_circ_0008135 inhibits intracellular ferroptosis in OCI-AML3 cells.

[0062] The seventh aspect, the effect of circular RNA on OCI-AML3 cell proliferation as disclosed in references [1], [4] and [6]

[0063] (I) Detection of the expression levels of hsa_circ_0004277 and hsa_circ_00750 in 7 myeloid leukemia cell lines as disclosed in reference [1].

[0064] The expression levels of hsa_circ_0004277 and hsa_circ_00750 in OCI-AML3, OCI-AML2, KG-1α, THP-1, HL-60, U937 and NB4 cell lines were detected by qRT-PCR.

[0065] Results: Compared with OCI-AML3 cells carrying NPM1-mA, there was no difference in hsa_circ_0004277 expression in NB4, THP-1, HL-60, U937, OCI-AML2 and KG-1α cells.

[0066] Conclusion: The expression of the two circRNAs hsa_circ_0004277 and hsa_circ_00750 in NPM1-mutant acute myeloid leukemia (AML) was not statistically different from that in non-NPM1-mutant AML. Furthermore, the expression of hsa_circ_0004277 and hsa_circ_00750 in NPM1-mutant AML was not statistically different from that in healthy controls. This indicates that hsa_circ_0004277 and hsa_circ_00750 are not specifically expressed in NPM1-mutant leukemia, therefore no further research is needed.

[0067] (II) Effect of CCK8 assay on the proliferation of OCI-AML3 cells overexpressed with circ_ZBTB46 (described in reference [4]).

[0068] Conclusion: Knockdown and overexpression of circ_ZBTB46 had no effect on the proliferation of OCI-AML3 cells.

[0069] (III) Effect of CCK8 assay on the proliferation of OCI-AML3 cells overexpressed with hsa_circ_0000370 (mentioned in reference [6]).

[0070] Conclusion: Knockdown and overexpression of hsa_circ_0000370 had no effect on the proliferation of OCI-AML3 cells.

[0071] Compared with the prior art, the beneficial effects of this application are as follows:

[0072] This application is the first to discover a differentially expressed circular RNA, hsa_circ_0008135, in NPM1-mutant AML patients and non-NPM1-mutant AML patients. Knockdown of hsa_circ_0008135 inhibits OCI-AML3 cell proliferation, overexpression of hsa_circ_0008135 promotes OCI-AML3 cell proliferation, knockdown of hsa_circ_0008135 promotes intracellular ferroptosis in OCI-AML3 cells, and overexpression of hsa_circ_0008135 inhibits intracellular ferroptosis in OCI-AML3 cells, providing a possible new therapeutic target for the clinical treatment of NPM1-mutant AML. Attached Figure Description

[0073] Figure 1 Differentially expressed circRNAs between NPM1-mutant AML patients and non-NPM1-mutant AML patients, among which,

[0074] A is a volcano plot showing differentially expressed circRNAs between NPM1-mutant AML patients and non-NPM1-mutant AML patients. NPM1-mutant AML patients are represented by "NPM1". + This indicates that non-NPM1-mutant AML patients use "NPM1" - "express,

[0075] B is a volcano plot showing differentially expressed circRNAs between NPM1-mutant AML patients and healthy controls. NPM1-mutant AML patients are represented by "NPM1". + The term "HCs" indicates that healthy controls are represented by this designation.

[0076] C is a Venn diagram showing the intersection of differentially expressed circRNAs in different groups;

[0077] Figure 2 Schematic diagram of hsa_circ_0008135;

[0078] Figure 3 A statistical graph showing the difference in hsa_circ_0008135 expression between clinical samples of NPM1-mutated AML patients and non-NPM1-mutated AML patients detected by qRT-PCR. Clinical samples of NPM1-mutated AML patients are represented as NPM1-mutated, and clinical samples of non-NPM1-mutated AML patients are represented as NPM1-unmutated.

[0079] Figure 4 The expression level of hsa_circ_0008135 in seven types of leukemia cells was detected by qRT-PCR.

[0080] Figure 5 The qRT-PCR method confirmed the effectiveness of knocking down and overexpressing hsa_circ_0008135.

[0081] The left side shows a statistical chart confirming the effect of knocking down hsa_circ_0008135. shcircRNA#1 and shcircRNA#2 are OCI-AML3 cells in groups 1 and 2 with hsa_circ_0008135 knocked down, respectively. shNC is OCI-AML3 cells, serving as the control group.

[0082] The right side is a statistical chart confirming the effect of overexpressing hsa_circ_0008135. circRNA represents the OCI-AML3 cell group overexpressing hsa_circ_0008135, and Vector represents OCI-AML3 cells transfected with Vector as a control group.

[0083] Figure 6The statistical graph shows the relative absorbance values ​​of OCI-AML3 cells with knocked-down hsa_circ_0008135 after culturing for 0, 1, 2, 3, and 4 days, compared with the control. In the graph, OCI-AML3 cells with knocked-down hsa_circ_0008135 in groups 1 and 2 are represented by shhsa_circ_0008135#1 and shhsa_circ_0008135#2, respectively, and the control group is represented by shNC.

[0084] Figure 7 The statistical graph shows the relative absorbance values ​​of OCI-AML3 cells overexpressing hsa_circ_0008135 compared to the control after culturing for 0, 1, 2, 3, and 4 days. The OCI-AML3 cell group overexpressing hsa_circ_0008135 is represented by hsa_circ_0008135, and the control group is represented by Vector.

[0085] Figure 8 After 3 hours of culture, under a fluorescence microscope, images of OCI-AML3 cells with knocked-down hsa_circ_0008135 and controls stained with DAPI, EDU, and Merge (left) and EDU. + A statistical chart of cell percentages (right);

[0086] Figure 9 After 3 hours of culture, OCI-AML3 cells overexpressing hsa_circ_0008135 were photographed under a fluorescence microscope with DAPI, EDU, and Merge staining (left) and EDU staining. + A statistical chart of cell percentages (right);

[0087] Figure 10 Under an inverted microscope, the colony morphology (left) and colony formation rate of OCI-AML3 cells with knocked-down hsa_circ_0008135 and the control group are statistically shown (right).

[0088] Figure 11 Under an inverted microscope, the colony morphology (left) and colony formation rate of OCI-AML3 cells overexpressing hsa_circ_0008135 and the control group are statistically shown (right).

[0089] Figure 12 A statistical chart of relative iron levels in OCI-AML3 cells with knocked-down hsa_circ_0008135;

[0090] Figure 13 A statistical graph of relative iron levels in OCI-AML3 cells overexpressing hsa_circ_0008135;

[0091] Figure 14Statistical graph of relative ROS levels in OCI-AML3 cells with knockdown of hsa_circ_0008135;

[0092] Figure 15 Statistical graph of relative ROS levels in OCI-AML3 cells overexpressing hsa_circ_0008135;

[0093] Figure 16 A statistical chart of the relative expression of SLC7A11 protein in OCI-AML3 cells with knockdown of hsa_circ_0008135;

[0094] Figure 17 A statistical graph showing the relative expression of SLC7A11 protein in OCI-AML3 cells overexpressing hsa_circ_0008135;

[0095] Figure 18 Statistical graph of hsa_circ_0004277 expression level in seven myeloid leukemia cells detected by qRT-PCR method;

[0096] Figure 19 Statistical graph of hsa_circ_00750 expression level in seven myeloid leukemia cells detected by qRT-PCR method;

[0097] Figure 20 A statistical graph showing the relative absorbance values ​​of OCI-AML3 cells with knocked-down circ_ZBTB46 after culturing for 0, 1, 2, 3, and 4 days, compared to the control.

[0098] Figure 21 A statistical graph showing the relative absorbance values ​​of OCI-AML3 cells overexpressing circ_ZBTB46 compared to the control after culturing for 0, 1, 2, 3, and 4 days.

[0099] Figure 22 A statistical graph showing the relative absorbance values ​​of OCI-AML3 cells with knocked-down hsa_circ_0000370 after culturing for 0, 1, 2, 3, and 4 days, compared to the control.

[0100] Figure 23 A statistical graph showing the relative absorbance values ​​of OCI-AML3 cells overexpressing hsa_circ_0000370 compared to the control after culturing for 0, 1, 2, 3, and 4 days.

[0101] in Figures 1-23 middle,

[0102] *, **, ***, and **** represent P<0.05, P<0.01, P<0.001, and P<0.0001, respectively, indicating that the difference between the two groups is statistically significant. Detailed Implementation

[0103] The following embodiments are used to illustrate the present invention, but are not intended to limit the scope of the invention. Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art.

[0104] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0105] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0106] biomaterials

[0107]

[0108] Reagents and Materials

[0109]

[0110]

[0111] instrument

[0112]

[0113] Reagent preparation

[0114] 12% separating gel preparation (15 mL): 4.9 mL ddH2O, 6.0 mL 30% acrylamide, 3.8 mL 1.0 M Tris-HCl (pH 8.8), 150 μL 10% SDS, 150 μL 10% AP and 6 μL TEMED, mix well;

[0115] 5% stacking gel preparation (5 mL): 3.5 mL ddH2O, 830 μL 30% acrylamide, 630 μL 1.0 M Tris-HCl (pH 6.8), 50 μL 10% SDS, 50 μL 10% AP and 5 μL TEMED, mix well.

[0116] Protein lysis buffer: prepared by RIPA lysis buffer and protease inhibitor PMSF at a ratio of 100:1.

[0117] Transfer buffer: Dissolve 14.4 g of glycine, 3.05 g of Tris-base and 200 mL of methanol in 800 mL of ddH2O and store at 4 °C.

[0118] Example 1: Analysis of hsa_circ_0008135 expression in NPM1-mutant AML patients

[0119] I. Methods

[0120] circRNA expression microarray data of NPM1-mutant AML patients (3 cases), non-NPM1-mutant AML patients (3 cases), and healthy controls (4 cases) were downloaded from GEO (GSE94591). Differentially expressed circRNAs between NPM1-mutant AML patients and non-NPM1-mutant AML patients were identified using the R package "limma". Differentially expressed circRNAs between NPM1-mutant AML patients and healthy controls were also identified. The data were visualized using GraphPad Prism (Version 7.00) software.

[0121] II. Results

[0122] like Figure 1 As shown in A, compared with the circRNAs of non-NPM1 mutant AML patients, four circRNAs were significantly highly expressed in NPM1 mutant AML patients: hsa_circ_0008135, hsa_circ_0012717, hsa_circ_0082353, and hsa_circ_0027506.

[0123] like Figure 1 As shown in B, compared with the circRNAs of healthy controls, 137 circRNAs were significantly highly expressed in NPM1 mutant AML patients, including hsa_circ_0008135;

[0124] like Figure 1 As shown in C, hsa_circ_0008135 belongs to... Figure 1 A is one of the four relatively highly expressed circRNAs, and it belongs to Figure 1 hsa_circ_0008135 was selected as one of the 137 relatively highly expressed circRNAs in B for subsequent experiments.

[0125] The structural diagram of hsa_circ_0008135 is shown below. Figure 2 As shown, the sequence is: >hsa_circ_0008135|NM_001145722|HOMER3

[0126] GGGCCAAACCAGTGCTCCTGCCACCTCTCTGGCTGCCCCCTAGAGCCTGCCCATCCCAGCCTGACCAAGTTCCAGCCAGGGAGCAGCCAATCTTCAGCACACGGGGCGCACGTGTTCCAAATTGACCCAGCCACCAAGCGAAACTGGATCCCAGCGGGCAAGCACGCACTCACTGTCTCCTATTTC TACGATGCCACCCGCAATGTGTACCGCATCATCAGCATCGGAGGCGCCAAGGCCATCATCAACAGCACTGTCACTCCCAACATGACCTTCACCAAAACTTCCCAGAAGTTCGGGCAGTGGGCCGACAGTCGCCAACACAGTCTACGGCCTGGGCTTTGCCTCTGAACAGCATCTGACACAG(SEQ ID NO:1)

[0127] Structural description: Hsa_circ_0008135 is located on chromosome 19p13.11 (chr19:19049161-19049858) and is an exon-type circular RNA. The background gene for hsa_circ_0008135 is HOMER3, which is derived from the backsplicing of the HOMER3 transcript (NM_001145722) and has a sequence length of 370 bp.

[0128] Example 2: qRT-PCR detection of differences in hsa_circ_0008135 gene expression levels in clinical samples

[0129] To investigate the differential expression of hsa_circ_0008135 in NPM1-mutant AML and non-NPM1-mutant AML, qRT-PCR was used to detect the differential expression of hsa_circ_0008135 in bone marrow clinical samples from NPM1-mutant AML patients and non-NPM1-mutant AML patients.

[0130] I. Methods

[0131] 1. Extract primary leukemia cells from clinical bone marrow samples from patients.

[0132] Clinical bone marrow samples were collected from 23 NPM1-mutant AML patients and 49 non-NPM1-mutant AML patients.

[0133] Take a 15mL centrifuge tube, add a mononuclear cell separation medium equal in volume to the bone marrow sample, and carefully aspirate the bone marrow sample onto the surface of the mononuclear cell separation medium using a pipette. Centrifuge at room temperature for 1000 rpm for 30 min. After centrifugation, carefully remove the centrifuge tube and observe it. It is found that the bone marrow sample in the tube is clearly divided into four layers. Carefully aspirate the second layer from the top, a ring-shaped white mononuclear cell layer, along the inner wall of the centrifuge tube using a pipette and transfer it to a new centrifuge tube. Add 8mL of PBS solution, mix well, and centrifuge at room temperature for 2000 rpm for 10 min. Discard the supernatant and repeat the above operation three times. Finally, add 200μL of PBS to resuspend the cell pellet to obtain a primary leukemia cell suspension.

[0134] 2. RNA extraction

[0135] Collect leukemia cells in the logarithmic growth phase, centrifuge at 500 rpm for 5 min, discard the supernatant, wash three times with pre-chilled PBS, and centrifuge at 3000 rpm for 3 min; then discard the supernatant and add 1 mL to the cell pellet. RNA extraction reagent TRIzol was used. After thorough vortexing, the mixture was incubated on ice for 10 min. Then, 200 μL of chloroform was added, and the mixture was inverted several times to mix. After incubation on ice, the mixture was centrifuged at 12,000 g at 4 °C for 15 min. The supernatant was transferred to a pre-chilled new enzyme-free EP tube, and an equal volume of isopropanol to chloroform was added. The mixture was incubated on ice and centrifuged at 12,000 g at 4 °C for 10 min. The supernatant was discarded, and 1 mL of freshly prepared 75% ethanol solution was added to wash the precipitate. The precipitate was centrifuged at 12,000 g at 4 °C for 15 min. The supernatant was discarded, and the mixture was allowed to stand for 3-5 minutes until the ethanol had completely evaporated. Then, an appropriate amount of RNase-free double-distilled water was added to dissolve the precipitate. Finally, the RNA concentration and purity were determined using a NanoDrop One micro spectrophotometer.

[0136] 3. Reverse transcription

[0137] Prepare the reverse transcription system according to Table 1 and perform reverse transcription.

[0138] Table 1. Reverse Transcription Reaction System

[0139]

[0140] Reaction procedure: 37℃×15min, 85℃×5s, cool at 4℃. Store cDNA at -20℃.

[0141] 4. qRT-PCR

[0142] Prepare the qRT-PCR reaction system according to Table 2 and perform real-time quantitative PCR reaction.

[0143] Table 2. qRT-PCR reaction system

[0144]

[0145] Reaction program: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 10 s, 58℃ annealing for 30 s, repeated 40 times, followed by 72℃ extension for 10 s. Using 2... –ΔΔCt The relative quantitative values ​​were calculated. Primers for each gene were synthesized by Shanghai Sangon Biotech Co., Ltd., and their sequences are shown in Table 3.

[0146] Table 3. qRT-PCR primer sequences

[0147]

[0148] II. Results

[0149] like Figure 3 As shown, the expression level of hsa_circ_0008135 in NPM1-mutant acute myeloid leukemia (AML) patients (n=23) was significantly higher than that in non-NPM1-mutant AML patients (n=49).

[0150] Example 3: Culture of 7 types of myeloid leukemia cells

[0151] The culture medium required for the growth of OCI-AML3 and OCI-AML2 cells was prepared by mixing RPMI-1640 medium, Australian fetal bovine serum and penicillin-streptomycin solution (100 U / mL) in a ratio of 100:10:1 and cultured in an incubator at 37°C and 5% CO2. The cells were passaged every 2-3 days on average to maintain logarithmic growth.

[0152] The culture medium required for the growth of KG-1α cells, THP-1 cells, HL-60 cells, U937 cells, and NB4 cells was prepared by mixing RPMI-1640 medium, South American fetal bovine serum, and penicillin-streptomycin solution (100 U / mL) in a ratio of 100:10:1 and cultured in an incubator at 37°C and 5% CO2. The cells were passaged every 1-2 days on average to maintain logarithmic growth.

[0153] Example 4: Detection of hsa_circ_0008135 expression level in 7 myeloid leukemia cell lines I. Methods

[0154] The expression level of hsa_circ_0008135 in OCI-AML3, OCI-AML2, KG-1α, THP-1, HL-60, U937 and NB4 cell lines was detected by qRT-PCR method as described in Example 2.

[0155] II. Results

[0156] like Figure 4As shown, hsa_circ_0008135 was expressed to varying degrees in all leukemia cell lines. Compared with OCI-AML3 cells carrying NPM1-mA, hsa_circ_0008135 was significantly underexpressed in NB4, THP-1, HL-60, U937, OCI-AML2, and KG-1α cells (P values ​​were 0.001, 0.01, 0.01, 0.05, 0.01, and 0.01, respectively).

[0157] III. Conclusion

[0158] Compared with six myeloid leukemia cell lines, including NB4, hsa_circ_0008135 is relatively highly expressed in OCI-AML3, a leukemia cell line naturally carrying the NPM1 gene mutation.

[0159] Example 5: Knockdown of hsa_circ_0008135 and confirmation of its effect

[0160] I. Method to knock down hsa_circ_0008135

[0161] Lentiviral infection of OCI-AML3 cells and screening for cell lines stably infected with shhsa_circ_0008135: First, cells in logarithmic growth phase were collected and seeded into new 24-well plates, ensuring a density of 1 × 10⁶ cells per well. 5 10 cells; then, add 25–60 μL of a 1×10⁻⁶ titer to each well. 8 TU / mL virus solution and 20 μL HitransGP were added, and the cell suspension was prepared to 500 μL per well using cell culture medium and thoroughly mixed. After incubation at 37℃ and 5% CO2 for 48–72 hours, cell status and fluorescence intensity were observed, and the culture dishes and fresh culture medium were replaced. Finally, when the infection efficiency reached 80%, 2 μg / mL puromycin was added for selection. Stable cell lines were obtained after 7–14 days and continued to be expanded for subsequent experiments.

[0162] The control group consisted of OCI-AML3 cells infected with shNC, which are represented by shNC in the attached figure;

[0163] The sample was divided into two groups: OCI-AML3 cells with knocked-down hsa_circ_0008135, group 1 and group 2, which are represented by shcircRNA#1 and shcircRNA#2 in the figure, respectively.

[0164] The sequences of the lentivirus and shNC used to knock down hsa_circ_0008135 are shown in the table below:

[0165]

[0166] II. qRT-PCR confirms the effect of knocking down hsa_circ_0008135

[0167] Following the method in Example 2, the effect of knocking down hsa_circ_0008135 was confirmed by qRT-PCR.

[0168] III. Results

[0169] like Figure 5 As shown on the left, compared with the control group, the relative expression of hsa_circ_0008135 in OCI-AML3 cells knocked down in groups 1 and 2 was significantly reduced, with P values ​​less than 0.01.

[0170] Example 6: Overexpression of hsa_circ_0008135 and confirmation of its effect

[0171] I. Overexpression of hsa_circ_0008135 method

[0172] OCI-AML3 cells were seeded into 6-well plates, ensuring a cell count of 102. 6 / wells; transfect OCI-AML3 cells with the overexpression plasmid or its control vector using Lipofectamine 2000, ensuring thorough mixing of the transfection mixture and cell suspension, and then incubate in a cell culture incubator for 12-72 hours for subsequent experiments.

[0173] The control group consisted of Vector-transfected OCI-AML3 cells, represented by Vector in the attached figure;

[0174] The sample group consisted of OCI-AML3 cells transfected with the overexpression plasmid, represented by circRNA in the attached figure; the sequences of the overexpression hsa_circ_0008135 plasmid and vector are shown in the table below:

[0175]

[0176] II. qRT-PCR confirms the efficacy of overexpression of hsa_circ_0008135

[0177] Following the method in Example 2, the effect of overexpressing hsa_circ_0008135 was confirmed by qRT-PCR.

[0178] III. Results

[0179] like Figure 5 As shown on the right, compared with the control group, the relative expression of hsa_circ_0008135 in OCI-AML3 cells that have been treated with hsa_circ_0008135 was significantly increased (P < 0.001).

[0180] Example 7: Effect of CCK8 assay on the effect of hsa_circ_0008135 knockdown on OCI-AML3 cell proliferation

[0181] I. Methods

[0182] The relative absorbance of OCI-AML3 cells with knocked-down hsa_circ_0008135 was measured according to the method described in the CCK8 kit instructions.

[0183] In a 96-well plate, according to 10 3 Cells were seeded into the control group, and groups 1 and 2 of OCI-AML3 cells with knocked-down hsa_circ_0008135, respectively, with a cell suspension of 100 μL / well. Each sample was set up with 6 replicates and placed in a cell culture incubator (37℃, 5% CO2). On days 0, 1, 2, 3, and 4 of culture, the cell plates were removed, and 10 μL of CCK8 reagent was added to each well under dark conditions. After gently tapping to mix, the cells were placed in the cell culture incubator and cultured for another 3 hours. The absorbance value of each well at a wavelength of 450 nm was measured, and the corresponding cell proliferation curves were plotted.

[0184] The method for obtaining OCI-AML3 cells with knocked-down hsa_circ_0008135 was the same as in Example 5; the control group consisted of OCI-AML3 cells stably infected with shNC.

[0185] II. Results

[0186] like Figure 6 As shown, after 4 days of culture, compared with the control group, the relative absorbance values ​​of OCI-AML3 cells with knocked-down hsa_circ_0008135 in groups 1 and 2 were significantly reduced, with P values ​​less than 0.001.

[0187] III. Conclusion

[0188] CCK8 assay results confirmed that the proliferation of OCI-AML3 cells with knockdown of hsa_circ_0008135 was significantly inhibited.

[0189] Example 8: Effect of CCK8 assay on the proliferation of OCI-AML3 cells overexpressed with hsa_circ_0008135

[0190] I. Methods

[0191] The proliferation of OCI-AML3 cells overexpressing hsa_circ_0008135 was detected using CCK8 assay, the same method as in Example 7; the OCI-AML3 cells overexpressing hsa_circ_0008135 were obtained using the same method as in Example 6; the control group consisted of OCI-AML3 cells transfected with Vector.

[0192] II. Results

[0193] like Figure 7 As shown, after 4 days of culture, the relative absorbance of OCI-AML3 cells overexpressing hsa_circ_0008135 was significantly increased compared with the control group (P < 0.01).

[0194] III. Conclusion

[0195] CCK8 assay results confirmed that OCI-AML3 cells overexpressing hsa_circ_0008135 showed significantly increased proliferation.

[0196] Example 9: EdU assay of the effect of knockdown of hsa_circ_0008135 on the proliferation of OCI-AML3 cells

[0197] EDU was detected in OCI-AML3 cells with knockdown of hsa_circ_0008135 according to the method described in the EdU kit instructions. + Cell percentage.

[0198] I. Methods

[0199] The control group cells, the OCI-AML3 cell group with hsa_circ_0008135 knocked down #1 group, and the OCI-AML3 cell group with hsa_circ_0008135 knocked down #2 group were divided into three groups, each with 10 cells. 6 Cells were seeded into 6-well plates, and the cell suspension in each well was prepared to 2 mL using cell culture medium. 2 mL of pre-prepared 2×EdU working solution was added to the same volume of cell suspension, and the plates were incubated at 37°C with 5% CO2 for 3 h. Cells were collected and centrifuged at room temperature (800 rpm × 5 min). Cells were washed three times with pre-chilled 1×PBS (2000 rpm × 3 min). The cell pellet was resuspended in 200 μL of PBS, thoroughly mixed, and evenly spread onto slides placed in the 6-well plates. The plates were then dried at room temperature. Immunostaining fixation solution was added, and the plates were incubated at room temperature for 15 min. 1 mL of pre-chilled PBS was added to wash the slides three times (5 min each time). Residual PBS on the slides was carefully aspirated, and 200 μL of PBS-Triton X-100 was added. The plates were incubated at room temperature for 20 min. Residual PBS on the slides was carefully aspirated, and 600 μL of Click reaction solution was added. The plates were incubated in the dark at room temperature for 30 min.

[0200] Remove the remaining Click reaction solution from the slide under light-protected conditions, add 1 mL of PBS solution, and let stand for 5 min. Remove the remaining PBS from the slide, add 500 μL of DAPI staining solution, and stain at room temperature for 15 min under light-protected conditions. Mount the slide with blocking solution, observe and photograph it under a fluorescence microscope, and then store it at 4℃ in the dark.

[0201] The method for obtaining OCI-AML3 cells with knockdown of hsa_circ_0008135 is described in Example 5; the control group was OCI-AML3 cells infected with shNC.

[0202] II. Results

[0203] like Figure 8 As shown, compared with the control group, the EDU of OCI-AML3 cells with knocked-down hsa_circ_0008135 in groups 1 and 2 was significantly lower. + The percentage of cells decreased significantly, with P values ​​all less than 0.01.

[0204] III. Conclusion

[0205] EDU assay results confirmed that the proliferation of OCI-AML3 cells with knockdown of hsa_circ_0008135 was significantly inhibited.

[0206] Example 10: EdU detection of the effect of overexpression of hsa_circ_0008135 on the proliferation of OCI-AML3 cells

[0207] I. Methods

[0208] EdU detection was performed on OCI-AML3 cells overexpressing hsa_circ_0008135. The EdU detection method is described in Example 9; the method for obtaining OCI-AML3 cells overexpressing hsa_circ_0008135 is described in Example 6.

[0209] II. Results

[0210] like Figure 9 As shown, compared with the control group, the EDU of OCI-AML3 cells overexpressing hsa_circ_0008135 in groups 1 and 2 was significantly higher. + The percentage of cells increased significantly.

[0211] III. Conclusion

[0212] EDU assay results confirmed that OCI-AML3 cells overexpressing hsa_circ_0008135 showed significantly increased proliferation.

[0213] Example 11: Effect of knockdown of hsa_circ_0008135 on OCI-AML3 cell proliferation as detected by colony formation assay

[0214] I. Methods

[0215] Control group cells, OCI-AML3 cell group 1 with hsa_circ_0008135 knockdown, and OCI-AML3 cell group 2 with hsa_circ_0008135 knockdown were seeded at 300 cells / well in 24-well plates, and the culture volume was supplemented to 750 μL with an appropriate amount of RPMI 1640 containing 20% ​​FBS. Each group was replicated 3-5 times. 750 μL of pre-prepared 2.7% methylcellulose (sterile) was added to each well and mixed with a sterile pipette tip. The cells were cultured in a cell culture incubator for 7-14 days according to standard procedures. Cell growth was observed. After cell colonies formed, the colony morphology was observed under an inverted microscope and the number of clones was counted. The colony formation rate was calculated.

[0216] Clonal formation rate = (Number of clones formed / Number of cells inoculated) × 100%.

[0217] II. Results

[0218] like Figure 10 As shown, compared with the control group, the cell colonies of OCI-AML3 cells in groups 1 and 2 with knockdown of hsa_circ_0008135 were smaller and the colony formation rate was significantly reduced, with P values ​​less than 0.01.

[0219] III. Conclusion

[0220] Clonal formation assays confirmed that the proliferation of OCI-AML3 cells with knockdown of hsa_circ_0008135 was significantly inhibited.

[0221] Example 12: Effect of overexpression of hsa_circ_0008135 on the proliferation of OCI-AML3 cells in colony formation assay

[0222] I. Methods

[0223] The proliferation of OCI-AML3 cells overexpressing hsa_circ_0008135 was detected by clonogenic assay, and the clonogenic assay method is described in Example 11; the method for obtaining OCI-AML3 cells overexpressing hsa_circ_0008135 is described in Example 6.

[0224] II. Results

[0225] like Figure 11 As shown, compared with the control group, OCI-AML3 cells overexpressing hsa_circ_0008135 had larger colonies and a significantly increased colony formation rate, with P values ​​less than 0.01.

[0226] III. Conclusion

[0227] Clonal formation assays confirmed that OCI-AML3 cells overexpressing hsa_circ_0008135 showed significantly increased proliferation.

[0228] Based on the results of Examples 7-12: knockdown of hsa_circ_0008135 inhibited the proliferation of OCI-AML3 cells; overexpression of hsa_circ_0008135 promoted the proliferation of OCI-AML3 cells.

[0229] Example 13: Effect of knockdown of hsa_circ_0008135 on iron levels in OCI-AML3 cells

[0230] The iron levels of OCI-AML3 cells with knocked-down hsa_circ_0008135 were measured according to the instructions of the iron assay kit.

[0231] I. Methods

[0232] OCI-AML3 cells with knocked-down hsa_circ_0008135 and control cells (OCI-AML3 cells stably infected with shNC) in the logarithmic growth phase were seeded into six-well plates for cell culture. When the cells showed logarithmic growth, the cell suspension was transferred to a 1.5 mL EP tube and centrifuged at 1000 rpm for 5 min. The supernatant was discarded, and iron assay buffer was added to the EP tube. The cells were centrifuged at 16000 rpm for 10 min. The supernatant was transferred to a new 1.5 mL EP tube and incubated on ice. The supernatant and prepared standards were added to a 96-well plate. 5 μL of iron reducing agent was added to each well, and the plate was incubated at 37°C for 30 min. Then, 100 μL of iron assay reagent was added to each well, and the plate was incubated at 37°C for 60 min. The absorbance of each group was measured at 590 nm using a multi-mode microplate reader. The iron content of each group was determined according to the standard curve.

[0233] The methods for obtaining OCI-AML3 cells with knocked-down hsa_circ_0008135 and control cells are described in Example 5.

[0234] II. Results

[0235] like Figure 12 As shown, compared with the control group, the relative iron levels in OCI-AML3 cells with knocked-down hsa_circ_0008135 were significantly increased in groups 1 and 2, with P values ​​less than 0.001.

[0236] III. Conclusion

[0237] Knocking down hsa_circ_0008135 significantly increased the relative iron level in OCI-AML3 cells.

[0238] Example 14: Effect of overexpression of hsa_circ_0008135 on iron levels in OCI-AML3 cells

[0239] The iron levels in OCI-AML3 cells overexpressing hsa_circ_0008135 were measured according to the instructions of the iron assay kit.

[0240] I. Methods

[0241] OCI-AML3 cells overexpressing hsa_circ_0008135 and control cells (OCI-AML3 cells transfected with Vector) were seeded into six-well plates for cell culture. The method for detecting iron levels in OCI-AML3 cells is detailed in Example 13.

[0242] The methods for obtaining OCI-AML3 cells overexpressing hsa_circ_0008135 and control cells are described in Example 6.

[0243] II. Results

[0244] like Figure 13 As shown, compared with the control group, the relative iron level of the OCI-AML3 cell group overexpressing hsa_circ_0008135 was reduced.

[0245] III. Conclusion

[0246] Overexpression of hsa_circ_0008135 can reduce the relative iron level in OCI-AML3 cells.

[0247] Example 15: Effect of knockdown of hsa_circ_0008135 on ROS levels in OCI-AML3 cells

[0248] The ROS levels in OCI-AML3 cells with knocked-down hsa_circ_0008135 were measured according to the ROS kit instructions.

[0249] I. Methods

[0250] OCI-AML3 cells with knocked-down hsa_circ_0008135 and control cells (OCI-AML3 cells infected with shNC) in logarithmic growth phase were collected, mixed thoroughly, and transferred into 24-well plates. The plates were incubated at 37°C for 12 hours. The final concentration of DCFH-DA was prepared to 10 μmol / L. After centrifuging the cell suspension and discarding the supernatant, an appropriate volume of diluted DCFH-DA was added to the 24-well plates. The cells were then mixed thoroughly and incubated in the dark. Flow cytometry analysis was performed using an excitation wavelength of 488 nm and an emission wavelength of 525 nm, with FITC parameters used to detect DCF. The average fluorescence intensity of each group reflected the intracellular ROS level.

[0251] The methods for obtaining OCI-AML3 cells with knocked-down hsa_circ_0008135 and control cells are described in Example 5.

[0252] II. Results

[0253] like Figure 14 As shown, compared with the control group, the ROS level in OCI-AML3 cells with knocked-down hsa_circ_0008135 was significantly increased in groups 1 and 2, with P values ​​less than 0.01.

[0254] III. Conclusion

[0255] Knocking down hsa_circ_0008135 promotes ROS expression in OCI-AML3 cells.

[0256] Example 16: Effect of overexpression of hsa_circ_0008135 on ROS levels in OCI-AML3 cells

[0257] The ROS level in OCI-AML3 cells overexpressing hsa_circ_0008135 was detected according to the ROS kit instructions.

[0258] I. Methods

[0259] OCI-AML3 cells overexpressing hsa_circ_0008135 and control cells (OCI-AML3 cells transfected with Vector) were seeded into six-well plates for cell culture. For details on the detection of ROS level of OCI-AML3 cells, please refer to Example 15. The method for obtaining OCI-AML3 cells overexpressing hsa_circ_0008135 and control cells is described in Example 6.

[0260] II. Results

[0261] like Figure 15As shown, compared with the control group, the ROS level of OCI-AML3 cells overexpressing hsa_circ_0008135 was significantly reduced (P < 0.01).

[0262] III. Conclusion

[0263] Overexpression of hsa_circ_0008135 reduces intracellular ROS expression in OCI-AML3 cells.

[0264] Example 17: Effect of knockdown of hsa_circ_0008135 on SLC7A11 protein levels in OCI-AML3 cells

[0265] SLC7A11 protein level is a key molecule for ferroptosis. Western blotting was used to detect SLC7A11 protein level in OCI-AML3 cells.

[0266] I. Methods

[0267] 1. Protein Extraction: Collect appropriate amounts of well-maintained, logarithmic-phase OCI-AML3 cells with knocked-down hsa_circ_0008135 and control cells (OCI-AML3 cells infected with shNC) using centrifuge tubes. Centrifuge at 1,000 rpm for 5 min to remove the supernatant, add 1 mL of pre-chilled PBS to resuspend, centrifuge at 4,000 rpm for 5 min to remove the supernatant, repeat the washing 3 times, retain the cell pellet, add approximately 2-3 times the volume of protein lysis buffer (prepared by RIPA lysis buffer and protease inhibitor PMSF at a ratio of 100:1), mix thoroughly by pipetting; lyse cells on ice for 30 min, vortexing once every 5 min, repeat 6 times, centrifuge at 4℃ and 12,000 rpm for 30 min; transfer the supernatant solution to a pre-chilled new EP tube, which is the required total protein solution. Detect protein concentration using the BCA method. Add 5× loading buffer to the remaining protein sample, boil to denature, and store at -80℃.

[0268] The methods for obtaining OCI-AML3 cells with knocked-down hsa_circ_0008135 and control cells are described in Example 5.

[0269] 2. SDS-PAGE gel electrophoresis: Prepare a 12% separating gel and a 5% stacking gel. After slowly and evenly pouring the gels, slowly add an appropriate amount of anhydrous ethanol to the surface of the gel and let it stand at 37°C for 30 min. Discard the anhydrous ethanol, pour the prepared 5% stacking gel onto the completely solidified separating gel, insert the comb, and let it stand at 37°C for 30 min. Carefully remove the comb, add 1×SDS electrophoresis buffer to cover the sample wells. Add 50 μg of denatured protein sample to the sample wells, and add protein markers to the wells on both sides of the sample as molecular weight references. After filling the glass plate with electrophoresis buffer, separate the proteins by electrophoresis in two steps: Step 1: 80V, 150mA, 30 min; Step 2: 120V, 200mA, 60–90 min.

[0270] 3. Transfer: After electrophoresis, first cut an appropriate amount of gel and a matching polyvinylidene fluoride (PVDF) membrane according to the molecular weight of the protein to be tested. Soak the cut gel in pre-cooled wet transfer buffer. Soak the cut PVDF membrane in methanol for 15 seconds and wash with distilled water for 2 minutes. Then soak the PVDF membrane and filter paper in pre-cooled wet transfer buffer. Finally, place the sponge, filter paper, PVDF membrane and gel in sequence from the positive electrode to the negative electrode, and transfer the membrane by electrophoresis at a constant current of 210 mA.

[0271] 4. Blocking: After the transfer is complete, place the polyvinylidene fluoride membrane in a 5% protein blocking solution and block at room temperature for 2 hours.

[0272] 5. Antibody incubation: First, wash the membrane with TBST to remove any remaining blocking solution; after blotting the membrane with qualitative filter paper, place the membrane on a wax plate, add pre-diluted primary antibody working solution to evenly cover the polyvinylidene fluoride membrane, and incubate overnight at 4°C; after recovering the primary antibody working solution, wash the polyvinylidene fluoride membrane three times in TBST for 10 min each time; finally, add pre-diluted horseradish peroxidase-labeled secondary antibody to the polyvinylidene fluoride membrane, incubate at room temperature for 1 h, and wash three times with TBST for 10 min each time.

[0273] 6. Color Development: In a dark room, place the polyvinylidene fluoride film on a chemiluminescent plate, then add a pre-prepared chemiluminescent reagent to evenly cover the polyvinylidene fluoride film, and display the image in the imaging system.

[0274] II. Results

[0275] like Figure 16 As shown, compared with the control group, the SLC7A11 protein in OCI-AML3 cells with knockdown of hsa_circ_0008135 was significantly reduced in both groups 1 and 2.

[0276] III. Conclusion

[0277] Knocking down hsa_circ_0008135 inhibits SLC7A11 protein expression in OCI-AML3 cells.

[0278] Example 18: Effect of overexpression of hsa_circ_0008135 on SLC7A11 protein levels in OCI-AML3 cells

[0279] I. Methods

[0280] The samples were OCI-AML3 cells overexpressing hsa_circ_0008135 and control cells (OCI-AML3 cells transfected with Vector). For details on the detection of SLC7A11 protein level in OCI-AML3 cells, please refer to Example 17. The methods for obtaining OCI-AML3 cells overexpressing hsa_circ_0008135 and control cells are described in Example 6.

[0281] II. Results

[0282] like Figure 17 As shown, compared with the control group, the SLC7A11 protein level was significantly increased in the OCI-AML3 cell group overexpressing hsa_circ_0008135.

[0283] III. Conclusion

[0284] Overexpression of hsa_circ_0008135 promotes the level of SLC7A11 protein in OCI-AML3 cells.

[0285] The combined results of Examples 13-18 indicate that knockdown of hsa_circ_0008135 promotes intracellular ferroptosis in OCI-AML3 cells, while overexpression of hsa_circ_0008135 inhibits intracellular ferroptosis in OCI-AML3 cells.

[0286] Comparative Example 1: Detection of expression levels of hsa_circ_0004277 and hsa_circ_00750 in 7 myeloid leukemia cell lines as disclosed in reference [1].

[0287] I. Methods

[0288] The expression levels of hsa_circ_0004277 and hsa_circ_00750 in OCI-AML3, OCI-AML2, KG-1α, THP-1, HL-60, U937 and NB4 cell lines were detected by qRT-PCR as described in Example 2.

[0289] II. Results

[0290] like Figure 18As shown, hsa_circ_0004277 was expressed to varying degrees in all leukemia cell lines. Compared with OCI-AML3 cells carrying NPM1-mA, there was no difference in hsa_circ_0004277 expression in NB4, THP-1, HL-60, U937, OCI-AML2, and KG-1α cells.

[0291] like Figure 19 As shown, hsa_circ_00750 was expressed to varying degrees in all leukemia cell lines. Compared with OCI-AML3 cells carrying NPM1-mA, there was no difference in hsa_circ_00750 expression in NB4, THP-1, HL-60, U937, OCI-AML2, and KG-1α cells.

[0292] III. Conclusion

[0293] The expression of the two circRNAs hsa_circ_0004277 and hsa_circ_00750 mentioned in reference [1] was not significantly different among the seven myeloid leukemia cell lines. Moreover, the expression of the two circRNAs hsa_circ_0004277 and hsa_circ_00750 in NPM1 mutant acute myeloid leukemia was not statistically different from that in non-NPM1 mutant acute myeloid leukemia. This indicates that hsa_circ_0004277 and hsa_circ_00750 are not specifically expressed in NPM1 mutant leukemia, so no further research is needed.

[0294] Comparative Example 2: CCK8 assay of the effect of knockdown of circ_ZBTB46 (described in reference [4]) on the proliferation of OCI-AML3 cells

[0295] I. Methods

[0296] The proliferation of OCI-AML3 cells with knockdown of circ_ZBTB46 was detected using CCK8 assay, as described in Example 7; the method for obtaining OCI-AML3 cells with knockdown of circ_ZBTB46 was described in Example 5; the control group consisted of OCI-AML3 cells infected with siNC.

[0297] II. Results

[0298] like Figure 20 As shown, after culturing for 0, 1, 2, 3, and 4 days, there were no significant differences in the relative absorbance values ​​of OCI-AML3 cells with knocked-down circ_ZBTB46 compared to the control group.

[0299] III. Conclusion

[0300] CCK8 assay results confirmed that knocking down circ_ZBTB46 had no effect on the proliferation of OCI-AML3 cells.

[0301] Comparative Example 3: CCK8 assay to detect the effect of overexpression of circ_ZBTB46 (described in reference [4]) on the proliferation of OCI-AML3 cells

[0302] I. Methods

[0303] The proliferation of OCI-AML3 cells overexpressing circ_ZBTB46 was detected using CCK8 assay, as described in Example 8; the method for obtaining OCI-AML3 cells overexpressing circ_ZBTB46 was described in Example 6; the control group consisted of OCI-AML3 cells transfected with Vector.

[0304] II. Results

[0305] like Figure 21 As shown, after culturing for 0, 1, 2, 3, and 4 days, there was no significant difference in the relative absorbance values ​​of OCI-AML3 cells overexpressing circ_ZBTB46 compared to the control group.

[0306] III. Conclusion

[0307] CCK8 assay results confirmed that overexpression of circ_ZBTB46 had no effect on the proliferation of OCI-AML3 cells.

[0308] The combined results of Comparative Examples 2 and 3 indicate that circ_ZBTB46 has no effect on the proliferation of OCI-AML3 cells.

[0309] Comparative Example 4: CCK8 assay of the effect of knockdown of hsa_circ_0000370 (described in reference [4]) on the proliferation of OCI-AML3 cells.

[0310] I. Methods

[0311] The proliferation of OCI-AML3 cells with knockdown of hsa_circ_0000370 was detected using CCK8 assay, as described in Example 7; the method for obtaining OCI-AML3 cells with knockdown of hsa_circ_0000370 was described in Example 5; the control group consisted of OCI-AML3 cells infected with siNC.

[0312] II. Results

[0313] like Figure 22 As shown, after culturing for 0, 1, 2, 3, and 4 days, there were no significant differences in the relative absorbance values ​​of OCI-AML3 cells with knocked-down hsa_circ_0000370 compared to the control group.

[0314] III. Conclusion

[0315] CCK8 assay results confirmed that knocking down hsa_circ_0000370 had no effect on the proliferation of OCI-AML3 cells.

[0316] Comparative Example 5: CCK8 assay to detect the effect of overexpression of hsa_circ_0000370 (described in reference [6]) on the proliferation of OCI-AML3 cells.

[0317] I. Methods

[0318] The proliferation of OCI-AML3 cells overexpressing hsa_circ_0000370 was detected using CCK8 assay, as described in Example 8; the method for obtaining OCI-AML3 cells overexpressing hsa_circ_0000370 was described in Example 6; the control group consisted of OCI-AML3 cells transfected with Vector.

[0319] II. Results

[0320] like Figure 23 As shown, there were no significant differences in the relative absorbance values ​​of OCI-AML3 cells overexpressing hsa_circ_0000370 compared with the control group at 0, 1, 2, 3, and 4 days of culture.

[0321] III. Conclusion

[0322] CCK8 assay results confirmed that overexpression of hsa_circ_0000370 had no effect on the proliferation of OCI-AML3 cells.

[0323] The combined results of Comparative Examples 4 and 5 indicate that circ_ZBTB46 has no effect on the proliferation of OCI-AML3 cells.

[0324] Statistical analysis of the data in the above embodiments: Data processing was performed using the professional software GraphPadPrism 8.0.2. To meet statistical requirements, all data were expressed as mean ± standard deviation. One-way ANOVA and multiple tests were used to analyze the significance of differences between groups, and t-tests were used for comparing two groups. P < 0.05 indicated a statistically significant difference.

[0325] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. The use of a reagent for knocking down the expression level of hsa_circ_0008135 in the preparation of a product for treating acute myeloid leukemia with NPM1 mutation, characterized in that, The reagent is a lentivirus, and the RNA sequence of the lentivirus is shown as SEQ ID NO. 6 or SEQ ID NO.

7.

2. Use according to claim 1, wherein The expression of the hsa_circ_0008135 is significantly increased in the NPM1 mutant acute myeloid leukemia patient compared with the non-NPM1 mutant acute myeloid leukemia patient.

3. The use according to claim 1, wherein The expression of the hsa_circ_0008135 is significantly increased in the NPM1 mutant acute myeloid leukemia patient compared with the healthy control.

4. The use according to claim 1, wherein The reagent for knocking down the expression level of hsa_circ_0008135 significantly inhibits the proliferation of OCI-AML3 cells compared with the control.

5. The use according to claim 1, wherein the compound is ###0002### The reagent for knocking down the expression level of hsa_circ_0008135 significantly promotes ferroptosis in OCI-AML3 cells compared with the control.

Images