Penicillium decumbens strain C01 and application thereof
By isolating and purifying Penicillium decumbent C01 and fermenting it to produce antibacterial active substances, the problems of insignificant effect and poor stability of natural antibacterial agents have been solved, and effective antibacterial and preservative properties against a variety of microorganisms have been achieved, making it suitable for food, health products and daily chemical products.
Patent Information
- Application Number
- CN202511156922.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-19
- Publication Date
- 2025-10-17
- Estimated Expiration
- 2045-08-19
AI Technical Summary
Existing natural antibacterial agents have problems with insignificant effects and poor stability in cosmetics, and traditional antibacterial agents may be irritating to the skin, which limits their application in cosmetics.
Penicillium decumbentum C01 was isolated and purified, and antibacterial active substances were produced through fermentation. The antibacterial active substances with excellent antibacterial properties were prepared by ethyl acetate extraction and concentration.
The fermentation product of Penicillium procumbentum C01 has a significant antibacterial effect on a variety of bacteria and fungi, and remains active at high temperatures. It is suitable for food, health products and daily chemical products, providing excellent preservative properties.
Smart Images

Figure CN120648574B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of microbial technology, in particular to a strain of Penicillium decumbens C01 and its application. BACKGROUND
[0002] With the progress and development of society, the pace of daily life has generally accelerated, and people are also facing increasingly serious skin problems, such as dryness, aging, acne, and dull skin. Cosmetics for different skin problems are also increasing. In order to ensure product quality stability and safety, bacteriostatic agents are often added to cosmetics, considering the bacteriostatic effect of bacteriostatic agents, environmental safety, and non-interference with other ingredients in the product.
[0003] The traditional bacteriostatic agent in the prior art has high irritation, for example, in cosmetics, some bacteriostatic agents may irritate the skin, and in severe cases, they may cause pore blockage or chronic poisoning of the mucous membrane, leading to allergic dermatitis of the skin, or cause photosensitivity reactions, and even have a risk of carcinogenesis. At present, natural bacteriostatic active ingredients are favored by more and more people due to their small irritation, good permeability, high safety, and significant efficacy, and are extremely potential cosmetic additives.
[0004] However, natural bacteriostatic agents have the problem of insufficient effect, such as poor stability of plant-derived bacteriostatic active ingredients, and the inability of plant essential oil bacteriostatic agents to be miscible with water, which limits the application of natural preservatives. Therefore, in order to meet the broad market application prospect of natural bacteriostatic agents, it is urgent to isolate and obtain microorganisms producing high bacteriostatic active substances. Some microbial fermentation products have excellent bacteriostatic effect and are mild and non-irritating, which is of great significance for the development of food, health products, and daily chemical products. SUMMARY
[0005] The purpose of the present application is to overcome the shortcomings of the prior art and provide a strain of Penicillium decumbens C01 producing high bacteriostatic active substances. The strain is isolated and purified from soil samples collected from the Guangzhou South China National Botanical Garden, and has been preserved in the Guangdong Provincial Microbial Culture Collection Center, with the preservation number GDMCC NO.66456.
[0006] In a first aspect, the present application provides a strain of Penicillium decumbens (C01), which has been preserved in the Guangdong Provincial Microbial Culture Collection Center on June 4, 2025, with the preservation number GDMCC NO.66456 and the preservation address being No. 59 Building, 5th Floor, Guangzhou City, People's Martyrs Road, 100. Penicillium decumbens
[0007] In a second aspect, the present application provides the use of the Penicillium decumbens C01 of the first aspect in the preparation of bacteriostatic active substances.
[0008] In a third aspect, the present application provides a preparation method of the Penicillium decumbens C01 for fermenting and producing the bacteriostatic active substance, comprising the following steps:
[0009] S1, seed liquid culture: the frozen strain C01 is activated, and after activation, the culture medium block containing the colony is picked and added to the PDB liquid culture medium for culture to obtain a seed liquid;
[0010] S2, solid fermentation: the seed liquid is uniformly coated on the solid fermentation medium for fermentation;
[0011] S3, after the fermentation is completed, the solid fermentation medium covered with mycelium is crushed, equal volume of ethyl acetate is added for ultrasonic-assisted extraction, and then the extraction is carried out at room temperature, and after extraction, suction filtration is carried out to obtain an extract and a solid part;
[0012] S4, the extract is collected for concentration treatment to obtain the bacteriostatic active substance.
[0013] Preferably, in the step S1, the culture temperature is 25-30℃, the culture rotation speed is 180-220 rpm, and the culture time is 12-18 h.
[0014] Preferably, in the step S2, the fermentation temperature is 25-30℃, and the fermentation time is 5-7 days.
[0015] Preferably, in the step S3, the ultrasonic power is 200-600 w, the ultrasonic time is 15-50 min, the extraction time at room temperature is 1-3 h.
[0016] Preferably, in the step S3, the solid part is added with equal volume of ethyl acetate for extraction at room temperature for 1-3 h, and then suction filtration is carried out, and the extraction is repeated for 2-3 times, and then the extract is combined.
[0017] In a fourth aspect, the present application provides a product comprising the Penicillium decumbens C01 of the first aspect.
[0018] In a fifth aspect, the present application provides the use of the Penicillium decumbens C01 of the first aspect in the preparation of food, health care products or daily chemical products, wherein the Penicillium decumbens C01 of the first aspect is fermented to prepare the bacteriostatic active substance, and then the bacteriostatic active substance is applied to the preparation of food, health care products or daily chemical products.
[0019] In a sixth aspect, the present application provides the use of the bacteriostatic active substance prepared by the method of the third aspect in the preparation of food, health care products or daily chemical products.
[0020] Compared with the prior art, the present application has the following beneficial effects:
[0021] The inventors of the present application isolated and purified a Penicillium decumbens C01 from a soil sample collected in the garden of Guangzhou South China Botanical Garden.
[0022] 1. The bacteriostatic test results show that the bacteriostatic active substance produced by the fermentation of the Penicillium decumbens C01 isolated from the soil sample has good bacteriostatic effect on Staphylococcus epidermidis, Staphylococcus aureus, Escherichia coli, Propionibacterium acnes, Candida albicans and Pseudomonas aeruginosa, and the diameters of the bacteriostatic rings of the above six indicator bacteria are all greater than 13 mm.
[0023] 2. The minimum bacteriostatic concentration test results show that the fermentation product of the strain C01 has excellent bacteriostatic performance, and the minimum inhibitory concentration (MIC) of the fermentation product on Staphylococcus epidermidis, Staphylococcus aureus and Propionibacterium acnes is all below 25 μg / mL, the minimum inhibitory concentration (MIC) on Escherichia coli is below 100 μg / mL, the minimum inhibitory concentration (MIC) on Candida albicans is below 50 μg / mL, and the minimum inhibitory concentration (MIC) on Pseudomonas aeruginosa can reach below 12.5 μg / mL.
[0024] 3. The heat resistance test results show that after the bacteriostatic active substance produced by the Penicillium decumbens C01 in the present application is treated at 80℃ and 60℃ for 40 min, it still has excellent bacteriostatic performance on Propionibacterium acnes and Pseudomonas aeruginosa, indicating that the bacteriostatic active substance prepared in the present application has high-temperature resistance characteristics.
[0025] 4. The preservative test results show that the viable bacterial count of the bacterial group and the fungal group shows a downward trend at 6h; the viable bacterial count of each group is not higher than 80 CFU / mL at 7 days; the viable bacterial count of the bacterial group and the fungal group is 0 at 14 to 28 days, indicating that the test substance passes the test and has excellent preservative effect. Therefore, the bacteriostatic active substance produced by the fermentation of the Penicillium decumbens C01 can be used as a bacteriostatic and preservative raw material, and has excellent preservative performance when applied to the preparation of food, health products or daily chemical products, and has broad application prospects and important transformation research value.
[0026] Biological material preservation
[0027] A strain of Penicillium decumbens C01, which is classified and named as Penicillium decumbens , was preserved in the Guangdong Microbial Culture Collection Center on June 4, 2025, with the preservation number GDMCC NO.66456 and the preservation address being No. 59 Building, 5th Floor, 100 Middle Liangma Street, Guangzhou. BRIEF DESCRIPTION OF DRAWINGS
[0028] Figure 1 is a colony morphology diagram of the Penicillium decumbens C01;
[0029] Figure 2Phylogenetic tree of Penicillium decumbens C01
[0030] Figure 3 Figure of partial antibacterial effect of antibacterial active substance of Penicillium decumbens C01 in Example 4; wherein SE represents Staphylococcus epidermidis, SA represents Staphylococcus aureus, EC represents Escherichia coli, and PA represents Propionibacterium acnes. DETAILED DESCRIPTION
[0031] In order to better illustrate the purposes, technical solutions and advantages of the present application, the present application will be further described below in combination with specific examples.
[0032] Other materials, reagents and the like used in the examples can be obtained from commercial channels unless otherwise specified.
[0033] Culture medium involved in the present application:
[0034] PDA culture medium: 20 g / L glucose, 12 g / L potato infusion powder, 10 g / L yeast infusion powder, 20 g / L agar, distilled water, and natural pH.
[0035] PDB liquid culture medium: 20 g / L glucose, 12 g / L potato infusion powder, 10 g / L yeast infusion powder, distilled water, and natural pH.
[0036] Solid fermentation culture medium: PDA culture medium.
[0037] The above culture media all need to undergo a sterilization step, and the sterilization condition is 121℃ for 20 min.
[0038] Example 1: Isolation, purification and screening of strains
[0039] Soil samples were collected from the area of South China Botanical Garden, Guangzhou, Guangdong Province, China. 10 g of the collected soil sample was weighed and added with 90 mL of sterile water, and then cultured at room temperature with 150 rpm shaking for 30 min. After that, 100 μL of the suspension was taken and subjected to 10-fold gradient dilution to obtain a dilution solution. 100 μL of the dilution solution with a dilution factor of 10 -4 , 10 -5 , 10 -6 were respectively spread on PDA culture medium, and then cultured at 28℃. The culture was observed every day, and single mold colonies were picked and transferred to new PDA plates. Plate streaking method was used for repeated isolation and purification to obtain purified strains and record the numbers. The strains were transferred to PDB liquid culture medium for liquid culture, and then the bacterial liquid was obtained and added with sterile glycerol to prepare a strain cryopreservation solution containing 30% glycerol, which was stored in a refrigerator at -80℃.
[0040] The isolated strains of mold were subjected to antibacterial activity screening. The specific steps were as follows: each mold strain was cultured in PDB liquid culture at 28°C and 200 rpm for overnight, then 1% of the inoculum was uniformly coated on PDA plates, and the plates were cultured at 28°C for 5 days. After fermentation, the obtained product was collected, crushed, and then extracted with an equal amount of ethyl acetate twice. After each extraction for 2 h, the mixture was filtered. The obtained ethyl acetate extract was concentrated to completely remove the solvent, and then 10 mg / ml of the sample was prepared for agar diffusion antibacterial experiment to determine the antibacterial activity against two common opportunistic pathogens, Escherichia coli and Propionibacterium acnes. The preliminary screening experiment showed that mold C01 had obvious antibacterial activity against Escherichia coli and Propionibacterium acnes, so the strain was identified and subjected to subsequent verification experiment.
[0041] Example 2: Strain identification
[0042] Morphological characteristics: after the strain C01 was cultured in PDA medium at 28°C for 4-6 days, the colony was round, expanded, and the aerial hyphae were flocculent. The sporulation surface was gray-green, the back was light yellow, and the texture was felt-like (as shown in Figure 1 ). Microscopic examination showed that there were conidial phialides and conidia, and the hyphae were septate.
[0043] Molecular biology method identification: 18S rRNA identification was performed. The genomic DNA of the strain C01 was extracted according to the operation instruction of the fungal genomic DNA extraction kit, and used as a template for PCR amplification of 18S rRNA using universal primers (NS1: 5'-GTAGTCATATGCTTGTCTC-3'(SEQ.ID.NO.2), FUNG: 5'-ATTCCCCGTTACCCGTTG-3'(SEQ.ID.NO.3)). The obtained sequence information (SEQ.ID.NO.1) was subjected to sequence alignment and homology analysis in the NCBI database, and a phylogenetic tree was constructed using MEGA 12 software; the phylogenetic tree is shown in Figure 2 . The results showed that the strain C01 was clustered with Penicillium decumbens , and the sequence homology was 98.52%. Combined with the morphological characteristics, the strain C01 was determined to be Penicillium decumbens, and was named as Penicillium decumbens .
[0044] The 18S rRNA sequence of the strain is shown in SEQ ID NO. 1:
[0045] TATTCCCCTCGGTTTCCGTGCCACCATGGTAGGCCACTATCCTACCATCGAAAGTTGATAGGGCAGAAATTTGAATGAACCATCGCCGGCGCAAGGCCATGCGATTCGTTAAGTTATTATGATTCACCAAGGAGCCCCGAAGGGCGTTGGTTTTTTATCTAATAAATACACCCCTTCCTGAAGTCGGGGTTTTTAGCATGTATTAGCTCTAGAATTACCACAGGTATCCATGTAGTAAGGTACTATCAAATAAACGATAACTGATTTAATGAGCCATTCGCAGTTTCACAGTATAAAGTGCTTATACTTAGACATGCATGGCTTAATCTTTGAGACAATTTTTTGACTACATG.
[0046] Example 3 Preparation of the bacteriostatic active substance
[0047] The preparation method of the bacteriostatic active substance ① specifically comprises the following steps:
[0048] S1, seed liquid culture: the frozen strain C01 is activated, and after activation, a culture medium block with a colony area of 1 cm 2 is taken into 200 mL PDB liquid culture medium, and cultured at 28°C and 200 rpm for 16 h to obtain a seed liquid;
[0049] S2, solid fermentation: 5% (volume / mass ratio) of the seed liquid is uniformly coated on the solid fermentation medium, and the solid fermentation medium is fermented at 28°C in the dark for 6 days;
[0050] S3, after the fermentation is completed, the solid fermentation medium covered with mycelium is crushed, and an equal volume of ethyl acetate is added, and ultrasonic-assisted extraction is performed at an ultrasonic power of 400 w for 40 min. After ultrasonic-assisted extraction, the extraction liquid and the solid part are obtained by suction filtration after soaking extraction at room temperature for 2 h. The solid part is added with an equal volume of ethyl acetate at room temperature, and static extraction is performed for 2 h, and suction filtration is performed, and the step is repeated for 3 times. The extraction liquids obtained after all the extractions are combined;
[0051] S4, the combined extraction liquid is concentrated to completely remove the solvent to obtain the bacteriostatic active substance.
[0052] Bacteriostatic active substance ②: the difference compared with the preparation steps of bacteriostatic active substance ① is only that the commercially available Penicillium decumbens (purchased from Beina Biotechnology, product number BNCC185808) is used instead of Penicillium decumbens C01 in the present application to prepare the bacteriostatic active substance through seed liquid culture, solid fermentation and other steps, and other steps and parameters are consistent with bacteriostatic active substance ①.
[0053] Example 4: Bacteriostatic test
[0054] Test substance: the bacteriostatic active substance ① and bacteriostatic active substance ② prepared in Example 3 were respectively dissolved in methanol to a concentration of 10 mg / mL, then filtered with a 0.2 μm filter membrane to remove bacteria to obtain a test solution for bacteriostatic experiment;
[0055] Indicator bacteria: Staphylococcus epidermidis, Staphylococcus aureus, Escherichia coli, Propionibacterium acnes, Candida albicans and Pseudomonas aeruginosa were selected; Staphylococcus epidermidis, Staphylococcus aureus, Escherichia coli, Propionibacterium acnes, Candida albicans and Pseudomonas aeruginosa were inoculated in their suitable culture medium for activation and culture to obtain logarithmic expectation bacteria suspension;
[0056] The specific steps of the bacteriostatic test are as follows:
[0057] The test used double-layer agar diffusion method, 10 mL of sterilized 1% water agar medium was poured into a sterile plate, and then the Oxford cup was placed after it was solidified; 200 μL of indicator bacteria solution was added to 20 mL of nutrient agar medium at about 50°C, and mixed well, wherein the final concentration of indicator bacteria was 4 x 10 7 CFU / mL, and the mixed nutrient agar medium containing indicator bacteria was poured into a sterile plate; after the nutrient agar medium was completely solidified, the Oxford cup was taken out, and 100 μL of test substance was added in the sample well, and the blank control group was replaced with an equal amount of methanol; Staphylococcus epidermidis, Staphylococcus aureus, Escherichia coli and Pseudomonas aeruginosa were placed at 36°C for static culture for 24 h, Propionibacterium acnes was placed in an anaerobic incubator at 36°C for culture for 24 h, Candida albicans was placed at 28°C for static culture for 72 h, and the diameter of the bacteriostatic ring was measured; three parallel experiments were set for each indicator bacteria, and three directions were measured for each bacteriostatic ring, and the data was presented as an average value.
[0058] The test results are shown in Figure 3 (only part of the experimental results are shown in the figure) and Table 1: the diameters of the bacteriostatic rings of bacteriostatic active substance ① on Staphylococcus epidermidis, Staphylococcus aureus, Escherichia coli, Propionibacterium acnes, Candida albicans and Pseudomonas aeruginosa were 19.03 mm, 17.50 mm, 13.87 mm, 18.31 mm, 16.25 mm and 23.83 mm respectively, indicating that the bacteriostatic active substance prepared by fermentation of Penicillium decumbens C01 has good bacteriostatic effect.
[0059] From the bacteriostatic effects of bacteriostatic active substance ① and bacteriostatic active substance ② on Staphylococcus epidermidis, Staphylococcus aureus, Escherichia coli, Propionibacterium acnes, Candida albicans and Pseudomonas aeruginosa in Table 1, it can be known that not all Penicillium obliquum has bacteriostatic effects on the above six bacteria, and the Penicillium obliquum C01 isolated in the application can ferment to produce active substances with good bacteriostatic performance.
[0060] Table 1 Bacteriostatic test data
[0061] Indicator bacteria Blank control Antibacterial active substance 1 Antibacterial active substance 2 Staphylococcus epidermidis - 19.03 - Staphylococcus aureus - 17.50 - Escherichia coli - 13.87 11.24 Propionibacterium acnes - 18.31 - Candida albicans - 16.25 - Pseudomonas aeruginosa - 23.83 -
[0062] Note: unit (mm), "-" represents no obvious bacteriostatic activity.
[0063] Example 5 Minimum inhibitory concentration (MIC) detection
[0064] Indicator bacteria: the logarithmic phase of Staphylococcus epidermidis, Staphylococcus aureus, Escherichia coli, Propionibacterium acnes, Candida albicans and Pseudomonas aeruginosa were selected; the indicator bacteria were diluted to 1×10 7 CFU / mL concentration for use;
[0065] Test substance: the bacteriostatic active substance ① prepared in Example 3 was first configured into a solution with a concentration of 20 mg / mL using DMSO, then filtered to remove bacteria using a 0.2 μm filter membrane, and then diluted to a concentration of 500, 400, 200, 100, 50, 25, 12.5 μg / mL of the test solution using nutrient broth medium for minimum inhibitory concentration (MIC) detection;
[0066] Experimental group: 100 μL of the test substance with concentrations of 500, 400, 200, 100, 50, 25, 12.5 μg / mL was added to the first to seventh rows of the 96-well plate in turn, respectively, 100 μL of the indicator bacteria was added to each well, and then mixed gently by blowing and sucking; blank control group: DMSO was added to each well of the eighth row of the 96-well plate according to the content of DMSO in each concentration of the test substance, and the nutrient broth medium was added to make up to 100 μL, then 100 μL of the indicator bacteria was added and mixed gently by blowing and sucking; three replicate wells were set for each indicator bacteria in each group; Staphylococcus epidermidis, Staphylococcus aureus, Escherichia coli, Pseudomonas aeruginosa and Candida albicans were cultured in a 30℃, 120 rpm shaker for 30 h, Propionibacterium acnes was cultured in an anaerobic bag in a 30℃, 120 rpm shaker for 30 h, whether each well was turbid was observed, the results were recorded, and the data were presented as an average value;
[0067] From the minimum inhibitory concentration (MIC) data of Table 2, it can be seen that the bacteriostatic active substance prepared by fermentation of the isolated Penicillium decumbens C01 from soil has a minimum inhibitory concentration (MIC) of 25 μg / mL or less for Staphylococcus epidermidis, Staphylococcus aureus and Propionibacterium acnes, a minimum inhibitory concentration (MIC) of 100 μg / mL or less for Escherichia coli, a minimum inhibitory concentration (MIC) of 50 μg / mL or less for Candida albicans, and a minimum inhibitory concentration (MIC) of 12.5 μg / mL or less for Pseudomonas aeruginosa, indicating that the fermentation product of strain C01 has excellent bacteriostatic performance on the above indicator bacteria.
[0068] Table 2 Minimum inhibitory concentration (MIC) data
[0069]
[0070] Note: "+" is turbid, i.e. cannot inhibit the growth of the indicator bacteria, "-" is clear, i.e. can inhibit the growth of the indicator bacteria.
[0071] Example 6 Heat resistance test
[0072] Test substance: the bacteriostatic active substance ① prepared in Example 3 was dissolved in methanol to a concentration of 10 mg / mL, filtered with a 0.2 μm filter to remove bacteria, and the resulting test solution was used for the heat resistance test;
[0073] The foregoing test substances were respectively treated at 80°C and 60°C for 40 min, then cooled to room temperature, and the bacteriostatic test was performed according to the method of Example 4; the control group used an equal amount of methanol instead of the test substance, and each group had 3 parallel experiments, and the data were presented as the average value;
[0074] Indicator bacteria: logarithmic phase expected test bacterial suspension of Propionibacterium acnes and Pseudomonas aeruginosa was selected;
[0075] The experimental results show that after the bacteriostatic active substance ① was treated at 80°C and 60°C for 40 min, the bacteriostatic test was performed by the bacteriostatic test procedure described in Example 4, and the experimental results showed that the bacteriostatic active substance ① after the above two treatments had almost the same bacteriostatic circle diameters for Propionibacterium acnes and Pseudomonas aeruginosa as the data in Table 1 of Example 4, the bacteriostatic circle diameters for Propionibacterium acnes were 17.96 mm and 18.52 mm, respectively, and the bacteriostatic circle diameters for Pseudomonas aeruginosa were 24.02 mm and 23.79 mm, respectively, indicating that the bacteriostatic active substance produced by fermentation of Penicillium decumbens C01 still has excellent bacteriostatic performance after high temperature treatment, and has the characteristic of high temperature resistance.
[0076] Example 7 Anticorrosion test
[0077] Test substance: The bacteriostatic active substance ① prepared in Example 3 was dissolved in 1,3-butanediol to a mass fraction of 5%, filtered with a 0.2 μm filter membrane to remove bacteria, and a test solution was obtained;
[0078] The test substance was added as a natural preservative to cosmetics, and a preservative test was performed according to the microbial challenge test method of the known Cosmetic, Toiletry, and Fragrance Association (CTFA) and the United States Pharmacopoeia. The specific test procedure is as follows:
[0079] First, a certain amount of preservative-free mask liquid was prepared according to the basic formula, and ten portions were randomly divided into two groups, five portions in each group. The test substance was added to each group to make the mass fraction of bacteriostatic active substance ① in the mask liquid finally 0.1%. The test bacteria Staphylococcus epidermidis, Staphylococcus aureus, Escherichia coli, Candida albicans, and Pseudomonas aeruginosa in the logarithmic growth phase were diluted to 4×10 9 CFU / mL with PBS buffer, and then mixed with the mask liquid. The final concentration of bacteria in the mask liquid was 4×10 7 CFU / mL for the bacteria group, and the final concentration of fungi in the mask liquid was 4×10 6 CFU / mL for the fungi group. After mixing, the bacteria group was placed in a 36°C incubator for culture, and the fungi group was placed in a 28°C incubator for culture. The viable bacteria count was determined at 6h, 7d, 14d, and 28d after inoculation according to the colony count test method in Chapter 5 of the Cosmetic Safety Technical Specification 2015, to determine the preservative efficacy of the cosmetic. The judgment criteria are as follows: when the viable bacteria count of each sample after inoculation is reduced to not more than 0.1% of the initial concentration at 7d, and then gradually decreases, and there is no bacterial growth at 28d; the preservative is effective and passes the test. Otherwise, the preservative is ineffective and fails the test.
[0080] The results of the preservative test are shown in Table 3 (the data are presented as average values). At 6h, the viable bacteria count of both the bacteria group and the fungi group showed a downward trend. At 7d, the viable bacteria count of each group was not higher than 80 CFU / mL. At 14-28d, the viable bacteria count of both the bacteria group and the fungi group was 0, indicating that the test substance passed the test and had excellent preservative effect. It is shown that the bacteriostatic active substance produced by the fermentation of Plenodomus obliquus C01 can be used as a bacteriostatic preservative raw material, and has excellent preservative performance when applied to the preparation of food, health products, or daily chemical products, and has broad application prospects and important transformation research value.
[0081] Table 3: Preservative test data
[0082] Group 6h 7d 14d 28d Number of viable bacteria (CFU / mL) 5.12 x 10 5 ]]> 72 0 0 Number of viable fungi (CFU / mL) 3.06 x 10 5 ]] 40 0 0
[0083] Finally, it should be noted that the above examples are merely intended to illustrate the technical solutions of the present application and not to limit the protection scope of the present application. Although the present application has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present application can be modified or equivalently replaced without departing from the essence and scope of the technical solutions of the present application.
Claims
1. A strain of Penicillium decumbentum ( Penicillium decumbens ) C01, characterized in that Its deposit number is GDMCCNO.66456.
2. Use of the Penicillium procumbentum C01 as claimed in claim 1 in the preparation of antibacterial active substances.
3. A method for producing an antibacterial active substance by fermenting Penicillium procumbentum C01 according to claim 1, characterized in that: The following steps are involved: S1. Seed liquid culture: activating the frozen Penicillium procumbentum C01 as claimed in claim 1, selecting a culture block containing colonies after activation and adding it to PDB liquid culture medium for culture to obtain a seed liquid; S2, solid fermentation: the seed liquid is evenly coated on the solid fermentation medium for fermentation; S3. After the fermentation is completed, the solid fermentation medium covered with mycelium is crushed, and an equal volume of ethyl acetate is added for ultrasonic-assisted extraction. The mixture is allowed to stand at room temperature for extraction and then filtered to obtain an extract and a solid portion; S4. Collecting the extract and concentrating it to obtain the antibacterial active substance.
4. The method according to claim 3, characterized in that In the step S1, the culture temperature is 25-30° C., the culture speed is 180-220 rpm, and the culture time is 12-18 h.
5. The method according to claim 3, characterized in that In the step S2, the fermentation temperature is 25-30° C. and the fermentation time is 5-7 days.
6. The method according to claim 3, characterized in that In the step S3, the ultrasonic power is 200-600w, the ultrasonic time is 15-50min, and the extraction time at room temperature is 1-3h.
7. The method according to claim 3, characterized in that An equal volume of ethyl acetate is added to the solid portion in step S3, and the mixture is allowed to stand at room temperature for 1-3 hours before being filtered. The extraction is repeated 2-3 times and the extracts are combined.
8. A product, characterized in that The method comprises the Penicillium procumbentum C01 as claimed in claim 1.
9. The use of Penicillium procumbentum C01 in preparing daily chemical products according to claim 1, characterized in that: The antibacterial active substance is prepared by fermentation using the Penicillium procumbentum C01 as claimed in claim 1, and the antibacterial active substance is used in the preparation of daily chemical products.
10. Use of the method according to any one of claims 3 to 7 in the preparation of daily chemical products.
Citation Information
Patent Citations
Penicillium strain producing cellulase and application in cellulose enzymatic hydrolysis thereof
CN103045484A
Novel Fungi TG2 Having High Glycosylase Activity and Method for Producing Bioethanol Using the same
KR1020140141230A