Method for efficiently expressing FAD-dependent glucose dehydrogenase in pichia pastoris

Abstract

The invention discloses a method for efficiently expressing FAD-dependent glucose dehydrogenase in pichia pastoris. The method comprises the following steps: (1) constructing a recombinant plasmid containing a promoter, a signal peptide, a glucose dehydrogenase gene and a purification tag; the nucleotide sequence of the signal peptide is as shown in SEQ ID No.2; (2) transforming the recombinant plasmids into host bacteria pichia pastoris to obtain recombinant pichia pastoris engineering bacteria capable of expressing FAD-dependent glucose dehydrogenase; and (3) carrying out fermentation culture, separation and purification on the recombinant pichia pastoris engineering bacteria to obtain the FAD-dependent glucose dehydrogenase. According to the invention, the expression level and the final yield of the FAD-GDH are obviously improved.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and in particular to a method for efficiently expressing FAD-dependent glucose dehydrogenase in Pichia pastoris. Background Art

[0002] Glucose dehydrogenase (GDH) is an important oxidoreductase that catalyzes the oxidation of glucose to gluconolactone. GDH has a wide range of applications, including blood glucose monitoring, biofuel cells, implantable cardiac pacemakers, and industrial glucose monitoring. Depending on the cofactor attached, GDH can be divided into three types: NAD-GDH, PQQ-GDH, and FAD-GDH.

[0003] In the field of blood glucose testing, traditional glucose oxidase (GOD) uses oxygen as an electron acceptor, so changes in the oxygen partial pressure in the sample may affect the accuracy of the test results. However, GDH does not use oxygen as an electron acceptor, so the test results are not limited by dissolved oxygen and have a smaller error. The advantages of FAD-GDH are particularly obvious: Stability and substrate specificity: FAD-GDH outperforms NAD-GDH and PQQ-GDH in both stability and substrate specificity. NAD-GDH's cofactor NAD is loosely bound to GDH, easily detaching during catalysis, resulting in poor stability in blood glucose monitoring applications. PQQ-GDH's primary challenge is poor substrate specificity, while FAD-GDH performs better in these areas.

[0004] Catalytic efficiency: FAD-GDH has high catalytic efficiency and is tightly bound to the cofactor FAD, making it a new and efficient diagnostic enzyme in clinical testing of blood glucose indicators.

[0005] Thermal and pH stability: FAD-GDH has better thermal and pH stability than other types of GDH, which makes it more reliable in industrial applications.

[0006] According to current literature reports, the expression level of FAD-dependent glucose dehydrogenase from Aspergillus terreus is relatively high, reaching 260,000 U / mL. However, there is still a large gap between its expression level and that of PQQ-dependent GDH. The expression level of PQQ-GDH can reach 1,530,000 U / mL, which is 5 times that of FAD-dependent GDH.

[0007] Therefore, optimizing the heterologous expression system, increasing the yield of FAD-GDH, and reducing production costs are of great significance for improving its performance in the field of blood glucose monitoring.

[0008] Genetic engineering can optimize protein and enzyme production efficiency through several strategies, including gene cloning and expression vector construction. This involves amplifying the corresponding enzyme gene and constructing an inducible expression vector, which is then transformed into host cells. The correct transformants are then screened to obtain genetically engineered strains. Codon optimization involves optimizing the codons of genes based on the codon preference of the host microorganism to improve their expression efficiency in the host. Promoter optimization involves modifying promoters to increase protein and enzyme expression levels. For example, removing the cre site in a promoter through overlap extension PCR and constructing a dual-promoter system can reduce the inhibition of gene transcription by carbon metabolites, thereby enhancing exogenous gene expression. Screening and optimization of genetically engineered strains can yield recombinant strains with higher and more stable enzyme activity. For example, after prolonged induction culture in a 10 L fermenter, enzyme activity can reach high levels.

[0009] Currently, there is no report on improving the expression and final yield of FAD-dependent glucose dehydrogenase protein by optimizing the signal peptide. Summary of the Invention

[0010] The purpose of the present invention is to provide a method for efficiently expressing FAD-dependent glucose dehydrogenase in Pichia pastoris, which significantly improves the expression level and final yield of FAD-GDH.

[0011] The technical solution adopted by the present invention to solve its technical problem is: A method for efficiently expressing FAD-dependent glucose dehydrogenase in Pichia pastoris comprises the following steps: (1) constructing a recombinant plasmid comprising a promoter, a signal peptide, a glucose dehydrogenase gene, and a purification tag; the nucleotide sequence of the signal peptide is shown in SEQ ID No. 2; (2) Transforming the recombinant plasmid into the host bacteria Pichia pastoris to obtain a recombinant Pichia pastoris engineered to express FAD-dependent glucose dehydrogenase; (3) The recombinant Pichia pastoris was fermented, cultured, separated and purified to obtain FAD-dependent glucose dehydrogenase.

[0012] Preferably, the glucose dehydrogenase gene is the gene with NCBI number: XM_025599163.

[0013] Preferably, the purification tag is a 6xHis, 10xHis, His-Trp or Cys-His tag.

[0014] Preferably, the promoter is AOX1 promoter.

[0015] Preferably, in step (1), the original plasmid vector for constructing the recombinant plasmid is pPIC9K plasmid.

[0016] Preferably, the host strain Pichia pastoris is Pichia pastoris GS115.

[0017] A recombinant plasmid for efficiently expressing FAD-dependent glucose dehydrogenase, wherein the recombinant plasmid is a recombinant pPIC9K plasmid comprising a promoter, a signal peptide, a glucose dehydrogenase gene, and a purification tag; The promoter is AOX1 promoter; The glucose dehydrogenase gene is the gene with the NCBI number: XM_025599163; The nucleotide sequence of the signal peptide is shown in SEQ ID No. 2.

[0018] The beneficial effects of the present invention are as follows: the present invention optimizes the signal peptide and utilizes a new signal peptide formed by connecting the pre portion of the OST signal peptide and the pro portion of the α-factor signal peptide, thereby significantly improving the expression level of FAD-GDH, and improving the purification level through screening of purification tags, thereby ultimately improving the yield. DETAILED DESCRIPTION

[0019] The present invention is described below through specific examples to make the technical solution of the present invention easier to understand and grasp, but the present invention is not limited thereto. The methods, means, equipment and steps well known to those skilled in the art are not described in detail in order to highlight the main purpose of the present invention. The molecular biology experimental methods not specifically described in the following examples are all carried out with reference to the specific methods listed in the book "Molecular Cloning Laboratory Manual" (3rd edition) by J. Sambrook, or in accordance with the kits and product instructions; the reagents and materials, unless otherwise specified, can be obtained from commercial channels.

[0020] Experimental materials and reagents: Strains and vectors Escherichia coli DH5α and Pichia pastoris GS115 were purchased from Qingke Biotechnology Co., Ltd.; the recombinant plasmid pPIC9K-GDH was synthesized by Qingke Biotechnology Co., Ltd.

[0021] Enzymes and kits High-fidelity enzyme (2 × KeyPo Master Mix), plasmid extraction kit, gel recovery kit, seamless cloning kit (ClonExpress II One Step Cloning Kit), PCR product purification kit, restriction endonuclease Dpn I and Sac I were all purchased from Takara.

[0022] culture medium LB medium: 5 g / L yeast extract, 10 g / L peptone, 10 g / L sodium chloride, pH 7.0. For solid medium, add 20 g / L agar powder. Sterilize by high-pressure steam at 121°C for 20 min.

[0023] YPD medium: 10 g / L yeast extract, 20 g / L peptone, 20 g / L glucose. For solid medium, add 20 g / L agar powder. Sterilize by high-pressure steam at 115°C for 30 min.

[0024] MD medium: 20 g / L glucose, 10 g / L ammonium sulfate, 3.4 g / L YNB. ​​Add 20 g / L agar powder when preparing solid medium. Sterilize at 115°C for 30 min. After sterilization, add 0.2% 500× biotin.

[0025] BMGY medium: 10 g / L yeast extract, 20 g / L peptone, 10 g / L glycerol, 3.7 g / L K₂HPO₄, 11.8 g / L KH₂PO₄, 3.4 g / L YNB, 10 g / L ammonium sulfate. Sterilize at 115°C for 30 min. After sterilization, add 0.2% 500× biotin.

[0026] BMMY medium: 10 g / L yeast extract, 20 g / L peptone, 3 g / L K₂HPO₄, 11.8 g / L KH₂PO₄, 3.4 g / L YNB, 10 g / L ammonium sulfate. Sterilize at 115°C for 30 min. After sterilization, add 0.2% 500× biotin.

[0027] BSM medium: calcium sulfate 0.93 g / L, potassium sulfate 18.2 g / L, magnesium sulfate heptahydrate 14.9 g / L, potassium hydroxide 4.13 g / L, glycerol 40 g / L, 85% phosphoric acid 26.7 mL / L.

[0028] PTM1: copper sulfate 6 g / L, sodium iodide 0.08 g / L, manganese sulfate monohydrate 3 g / L, sodium molybdate dihydrate 0.2 g / L, boric acid 0.02 g / L, cobalt chloride 0.5 g / L, zinc chloride 20 g / L, ferrous sulfate heptahydrate 65 g / L, biotin 0.2 g / L, sulfuric acid 5 mL / L.

[0029] Example 1: Construction of recombinant expression vectors containing different signal peptides The complete amino acid sequence of FAD-GDH (NCBI: XM_025599163) was reverse-translated according to the Pichia pastoris codon table, and the corresponding nucleic acid sequence was optimized for GC content and secondary structure. EcoRI and NotI restriction sites were added before and after the sequence. This sequence was synthesized and ligated into the corresponding sites of pPIC9K via EcoRI and NotI to generate the pPIC9K-GDH plasmid.

[0030] SEQ ID No.1 (OST signal peptide, ATGAGGCAGGTTTGGTTCTCTTGGATTGTGGGATTGTTCCTATGTTTTTTCAACGTGTCTTCTGCT) were synthesized respectively. SEQ ID No.2 (OST signal peptide + α-factor signal peptide pro part; ATGAGGCAGGTTTGGTTCTCTTGGATTGTGGGATTGTTCCTATGTTTTTTCAACGTGTCTTTCTGCTGCTCCAGTCAACACTACAACAGAAGATGAAACGGCACAAATTCCGGCTGAAGCTGTCA TCGGTTACTTAGATTTAGAAGGGGGATTTCGATGTTGCTGTTTTGCCATTTTCCAACAGCACAAATAACGGGTTATTGTTTATAAATACTACTATTGCCAGCATTGCTGCTAAAGAAGAAGGGGTATCTTTGGATAAAAGAGAGGCTGAAGCT), Three signal peptide sequences, SEQ ID No. 3 (α-factor signal peptide pre part; ATGAGATTTCCTTCAATTTTTACTGCAGTTTTATTCGCAGCATCCTCCGCATTAGCT), replaced the original α-factor signal peptide on pPIC9K-GDH, i.e., bp 949 to 1215; and obtained pPIC9K-OST-GDH (SEQ ID No. 1 signal peptide), pPIC9K-OST-PRO-GDH (SEQ ID No. 2 signal peptide), and pPIC9K-PRE-GDH (SEQ ID No. 3 signal peptide), respectively.

[0031] Example 2: Construction of Pichia pastoris producing glucose dehydrogenase containing different signal peptides The activated Escherichia coli carrying different signal peptide plasmids were inoculated into LB liquid culture medium containing AMP resistance (final concentration 50 ug / L). After constant temperature cultivation at 37°C for 12-16 hours, 2 mL of bacterial liquid was taken and the corresponding plasmids were extracted using a plasmid extraction kit according to the instructions.

[0032] The extracted plasmid was linearized using a single enzyme digestion system as shown in the table. The reaction system was prepared according to the table, gently mixed, briefly centrifuged, and incubated at 37°C for 2 hours. After linearization, the linearized product was purified using a PCR product purification kit and its nucleic acid concentration was determined before electroporation into Pichia Pastoris GS115 competent cells.

[0033] Epi-plasmid enzyme digestion system .

[0034] The GS115 strain was streaked and activated on a non-resistant YPD plate and incubated in an incubator at 30°C overnight. This was used to generate competent Pichia Pastoris GS115 cells. The linearized plasmid was introduced into Pichia Pastoris GS115 by electroporation. The cells were then plated on MD plates containing G418 resistance (final concentration 25 μg / L) and incubated in an inverted manner at 30°C for 3-4 days. The resulting single colonies were Pichia pastoris strains producing glucose dehydrogenase containing different signal peptides and were designated WCG-OST, WCG-OST-PRO, WCG-PRE, and the original signal peptide strain, WCG.

[0035] Example 3: Expression of glucose dehydrogenase under different signal peptides Glucose dehydrogenase-producing Pichia pastoris containing different signal peptides was streaked on a YPD solid medium containing G418 resistance and inverted cultured at 30°C for 2-3 days.

[0036] Pick a single colony into a 5 mL YPD tube and culture overnight at 30°C and 200 rpm.

[0037] Inoculate all the bacterial liquid in the test tube into 100 mL of BMGY medium and culture at 30°C and 200 rpm until the OD600 reaches 4.

[0038] Use a 50mL sterile centrifuge tube and centrifuge at 3500 rpm to collect all the bacteria in the BMGY medium. Resuspend the cells in BMMY medium and transfer them to 30 mL of BMMY medium (control OD600 = 10-12). Pichia pastoris strains with different signal peptides were maintained at the same concentration in BMMY. Methanol was added to the medium to a final concentration of 1%. Incubate at 30°C, 250 rpm. Methanol was added every 24 hours to a final concentration of 1%. Methanol induction was terminated after 72 hours. The fermentation broth was centrifuged at 8000 rpm for 10 minutes, and the supernatant was collected.

[0039] The fermentation supernatant was microfiltered using a 0.22 μm hollow fiber microfiltration system, and the filtrate was collected.

[0040] Purification was performed using a Ni-IDA metal chelate ion gel column with the following buffers: Buffer A: 20 mM Tris-HCl, 0.5 M NaCl, 0 mM imidazole, pH 8.0; Buffer B: 20 ​​mM Tris-HCl, 0.5 M NaCl, 500 mM imidazole, pH 8.0. The loading flow rate was 0.5 mL / min, and the reequilibration flow rate was 0.5 mL / min.

[0041] The ratio of buffer B to buffer A was adjusted to adjust the imidazole concentration. The imidazole concentrations were 25, 50, 100, 150, 250, and 500 mM, respectively, for elution at a flow rate of 0.5 mL / min.

[0042] Example 4: Construction of glucose dehydrogenase-producing plasmids containing different purification tags The complete amino acid sequences of SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 6, and SEQ ID NO. 7 were reverse-translated according to the Pichia pastoris codon table, and the corresponding nucleic acid sequences were optimized for GC content and secondary structure. EcoRI and NotI restriction sites were added before and after the sequences. These sequences were synthesized and ligated into the corresponding sites of pPIC9K-OST-PRO-GDH via EcoRI and NotI, respectively, to obtain the corresponding plasmids pPIC9K-OST-PRO-GDH-HIS6, pPIC9K-OST-PRO-GDH-HIS10, pPIC9K-OST-PRO-GDH-HisTrp, and pPIC9K-OST-PRO-GDH-CysHis.

[0043] Example 5: Construction of Pichia pastoris producing glucose dehydrogenase containing different purification tags The difference between this embodiment and embodiment 2 is that: Activate Escherichia coli containing plasmids pPIC9K-OST-PRO-GDH-6HIS, pPIC9K-OST-PRO-GDH-10HIS, pPIC9K-OST-PRO-GDH-HisTrp, and pPIC9K-OST-PRO-GDH-CysHis.

[0044] The linearized plasmid was introduced into Pichia Pastoris GS115 by electroporation, and the obtained single colonies were Pichia pastoris producing glucose dehydrogenase containing different purification tags, which were named WCG-OST-PRO-6x, WCG-OST-PRO-10x, WCG-OST-PRO-HisTrp and WCG-OST-PRO-CysHis, respectively.

[0045] The rest is consistent with Example 2.

[0046] Example 6: Expression of glucose dehydrogenase under different purification tags The method is consistent with Example 3.

[0047] Example 7: 5 L tank fermentation of Pichia pastoris containing glucose dehydrogenase The Pichia pastoris containing recombinant glucose dehydrogenase is inoculated into a fermentation culture medium using glycerol as a carbon source for cultivation; the process comprises the following steps: The Pichia pastoris containing recombinant glucose dehydrogenase was inoculated into 5 mL of YPD liquid culture medium and cultured under shaking conditions of 30° C. and 220 rpm for 16 hours to prepare primary seeds.

[0048] Strain culture stage The inoculation volume was 10%, and the fermentation medium was BSM medium, with 4.5 mL PTM1 per liter of fermentation broth. The culture was cultured with aeration and agitation for about 18 hours at a temperature of 30°C, a stirring speed of 350-950 rpm, a pH of 5.0, and a ventilation rate of 2.0 vvm, with the dissolved oxygen maintained above 20% by coupling the rotation speed, and the pH was adjusted with concentrated ammonia solution; Carbon source feeding stage When glycerol was exhausted during the fermentation process, a 50 wt% glycerol aqueous solution containing 12 mL / L PTM1 was added at a rate of 15 mL / h / L for 4 hours. The dissolved oxygen was maintained above 20% by coupling the speed, and the pH was maintained at 5.0 by concentrated ammonia. Starvation feeding stage When OD600 ≈ 180, stop adding glycerol until the glycerol in the culture medium is exhausted; Induction expression stage The temperature was lowered to 29°C, and methanol containing 14 mL / LPTM1 was added at a rate of 7.4 mL / L / h. The pH was controlled at 5.0. The dissolved oxygen content in the fermentation broth was greater than 20% by speed coupling. Samples were taken every 12 hours to detect OD600. The activity of the expressed glucose dehydrogenase was measured every 12 hours. Fermentation was stopped when the enzyme activity no longer increased.

[0049] Example 8: Comparison of the relative activities of GDH from different sources against different substrates The purified enzyme sample was mixed with phenazine methosulfate (final concentration 0.6 mM) and dichloroindoxyl (final concentration 0.06 mM) in 10 mM phosphate buffer (pH 6.5).

[0050] The corresponding substrate (final concentration 10 mM) was then added to initiate the reaction; The second step is to monitor the decrease in the absorbance of dichloroindoxyl at a wavelength of 600 nm.

[0051] The amount of enzyme that reduces 1 mmol of dichloroindoxyl per minute (equivalent to oxidizing 1 mmol / min of substrate) is defined as 1 unit of dehydrogenase activity.

[0052] The substrates are: glucose, xylose, maltose, cellobiose, lactose, mannose, fructose, allose, galactose and sucrose.

[0053] The enzyme activity of glucose substrate was defined as 100%, and the relative enzyme activities under different substrates were compared.

[0054] The enzymatic activity of the glucose dehydrogenase obtained in Example 3 was measured, and the protein expression level was measured. The results are as follows: .

[0055] The original WCG strain contained the α-factor signal peptide, which consists of two parts: pre and pro. When the pro portion of the α-factor signal peptide was removed, a comparison of the enzyme activity and expression levels between the WCG-PRE and WCG strains revealed a decrease in protein expression. However, when the OST signal peptide replaced the entire α-factor signal peptide as the pre signal peptide, a comparison of the enzyme activity between the WCG-OST and WCG strains revealed that the OST signal peptide alone increased enzyme activity by approximately 20%. Finally, the strain WCG-OST-PRO, which linked the OST signal peptide to the pro portion of the α-factor signal peptide, showed significant improvements in enzyme activity and protein expression, with enzyme activity increasing by 2.3-fold and protein expression increasing by 2.96-fold compared to the strain containing only the OST signal peptide, WCG-OST. This makes it more suitable as an expression strain than other recombinant strains.

[0056] The enzyme activity of the glucose dehydrogenase obtained in Example 6 was measured, and the protein expression level was measured. Before the start of purification, the enzyme activity was measured to control the initial amount of enzyme protein to be close to that of the purified product, so that the purification effect was compared based on the protein recovery rate. The results are as follows: .

[0057] It is not difficult to see from the above experiments that different purification tags have obvious differences in the final purification efficiency. By comparing the protein recovery rate after purification, it can be found that the recovery rate of His-Trp-tag is higher than that of the other three purification tags, and it is more suitable for purification.

[0058] According to the experiment in Example 7, WCG-OST-PRO-HisTrp and WCG were fermented in 5L tanks, and the results were as follows: .

[0059] It is not difficult to see from the above experiments that compared with the initial strain, the activity of WCG-OST-PRO-HisTrp was significantly improved throughout the fermentation process, with protein expression increased by 237% and enzyme activity increased by 289%.

[0060] According to the experiment in Example 8, the relative activities of WCG-OST-HisTrp, WCG-OST-CysHis and a commercial enzyme on different substrates were determined.

[0061] Here are the results: WCG-OST-HisTrp ; WCG-OST-CysHis ; A commercial enzyme .

[0062] It is not difficult to see from the above experiments that, by comparison with commercial enzymes, the GDH expressed in the WCG-OST-HisTrp and WCG-OST-CysHis strains mentioned in the patent is inactive towards maltose, cellobiose, lactose, fructose, allose, galactose and sucrose. At the same time, its selectivity for mannose is close to that of the commercial enzyme, and its selectivity for xylose is better than that of the commercial enzyme.

[0063] SEQ ID NO.4: MMSKTYEYVICGGGTVGCVLASRLSQAGHSVLVVEAGPEDYNDKIMSPVAAPHLHGTEWEYNLMTAKQPGLGNRSVPNYVGKLLSGSSGINYGLWTRGHSVDYDSWAKAVGDERWNYANMLKFFKMAQTHHDPTGSPEKYGFSGPISTTAAARTYPLREQIRNAMLAAGLEYNPDTNGGSPLGFGPFTENWKDALRQPASKAYDLSKATVLTNSVIAQVDVDDSKTAIGITLTDGTQYTASREVLVTCGAIKSPQLLMLSGIGPQQHLAQHNIPIVADLPVGENYHDKISATFFWKLRNPEKGYALGSPLFNKPEFRHGNPIEWVATVPTPHAELIKAAQKDKIDAEDPYLQEPRGNVEVMVAYAPIAGGGSEFRVPMDGNHISSPVVLLLPTSRGSVTLASADPTADPVLDPRYLDTETDRAAIRAGMRVALRVMETDSAKEVIDGETPPPGHEPITSASSNADLDRRVQIVGSSFFQNGGTAAMGTVVDTQCRVKGVQNLRVCDASVLPLPLAGHYQAPMYAFGEAVADMLLAQHHHHHH SEQ ID NO.5: MMSKTYEYVICGGGTVGCVLASRLSQAGHSVLVVEAGPEDYNDKIMSPVAAPHLHGTEWEYNLMTAKQPGLGNRSVPNYVGKLLSGSSGINYGLWTRGHSVDYDSWAKAVGDERWNYANMLKFFKMAQTHHDPTGSPEKYGFSGPISTTAAARTYPLREQIRNAMLAAGLEYNPDTNGGSPLGFGPFTENWKDALRQPASKAYDLSKATVLTNSVIAQVDVDDSKTAIGITLTDGTQYTASREVLVTCGAIKSPQLLMLSGIGPQQHLAQHNIPIVADLPVGENYHDKISATFFWKLRNPEKGYALGSPLFNKPEFRHGNPIEWVATVPTPHAELIKAAQKDKIDAEDPYLQEPRGNVEVMVAYAPIAGGGSEFRVPMDGNHISSPVVLLLPTSRGSVTLASADPTADPVLDPRYLDTETDRAAIRAGMRVALRVMETDSAKEVIDGETPPPGHEPITSASSNADLDRRVQIVGSSFFQNGGTAAMGTVVDTQCRVKGVQNLRVCDASVLPLPLAGHYQAPMYAFGEAVADMLLAQHHHHHHHHHH SEQ ID NO.6: MMSKTYEYVICGGGTVGCVLASRLSQAGHSVLVVEAGPEDYNDKIMSPVAAPHLHGTEWEYNLMTAKQPGLGNRSVPNYVGKLLSGSSGINYGLWTRGHSVDYDSWAKAVGDERWNYANMLKFFKMAQTHHDPTGSPEKYGFSGPISTTAAARTYPLREQIRNAMLAAGLEYNPDTNGGSPLGFGPFTENWKDALRQPASKAYDLSKATVLTNSVIAQVDVDDSKTAIGITLTDGTQYTASREVLVTCGAIKSPQLLMLSGIGPQQHLAQHNIPIVADLPVGENYHDKISATFFWKLRNPEKGYALGSPLFNKPEFRHGNPIEWVATVPTPHAELIKAAQKDKIDAEDPYLQEPRGNVEVMVAYAPIAGGGSEFRVPMDGNHISSPVVLLLPTSRGSVTLASADPTADPVLDPRYLDTETDRAAIRAGMRVALRVMETDSAKEVIDGETPPPGHEPITSASSNADLDRRVQIVGSSFFQNGGTAAMGTVVDTQCRVKGVQNLRVCDASVLPLPLAGHYQAPMYAFGEAVADMLLAQHHHWHHH SEQ ID NO.7: .

[0064] The embodiment described above is only a preferred solution of the present invention and does not limit the present invention in any form. Other variations and modifications are possible without exceeding the technical solution described in the claims.

Claims

1. A method for efficiently expressing FAD-dependent glucose dehydrogenase in Pichia pastoris, characterized in that: The following steps are involved: (1) constructing a recombinant plasmid comprising a promoter, a signal peptide, a glucose dehydrogenase gene, and a purification tag; the nucleotide sequence of the signal peptide is shown in SEQ ID No. 2; (2) Transforming the recombinant plasmid into the host bacteria Pichia pastoris to obtain a recombinant Pichia pastoris engineered to express FAD-dependent glucose dehydrogenase; (3) The recombinant Pichia pastoris was fermented, cultured, separated and purified to obtain FAD-dependent glucose dehydrogenase.

2. The method according to claim 1, characterized in that The glucose dehydrogenase gene is a gene with the number NCBI: XM_025599163.

3. The method according to claim 1, characterized in that The purification tag is a 6xHis, 10xHis, His-Trp or Cys-His tag.

4. The method according to claim 1, wherein The promoter is AOX1 promoter.

5. The method according to claim 1, wherein In step (1), the original plasmid vector for constructing the recombinant plasmid is the pPIC9K plasmid.

6. The method according to claim 1, wherein The host strain Pichia pastoris is Pichia pastoris GS115.

7. A recombinant plasmid for highly efficient expression of FAD-dependent glucose dehydrogenase, characterized in that: The recombinant plasmid is a recombinant pPIC9K plasmid comprising a promoter, a signal peptide, a glucose dehydrogenase gene and a purification tag; The promoter is AOX1 promoter; The glucose dehydrogenase gene is the gene with the NCBI number: XM_025599163; The nucleotide sequence of the signal peptide is shown in SEQ ID No. 2.