Application of pagbag8 gene in regulating poplar growth and development

By overexpressing the PagBAG8 gene, the development of poplar wood tissue and leaves was regulated, which solved the problem of unclear molecular mechanism of poplar wood formation and achieved growth inhibition and wood quality improvement in poplar.

CN120648744BActive Publication Date: 2025-11-04ZHEJIANG FORESTRY UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511157858.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-08-19
Publication Date
2025-11-04
Estimated Expiration
2045-08-19

AI Technical Summary

Technical Problem

Current research on the function of BAG family genes in poplar is scarce, the molecular mechanism of wood formation is unclear, and there is a lack of effective gene regulation methods to improve the quality of poplar wood.

Method used

By overexpressing the PagBAG8 gene, the development of poplar wood and leaves is regulated. An overexpression vector is constructed using the nucleotide sequence of the PagBAG8 gene (such as SEQ ID NO:1) and transformed into poplar trees to achieve genetic engineering improvement.

Benefits of technology

It significantly inhibits poplar growth, reduces plant height, ground diameter, internode length and leaf area, regulates xylem width, cell layer number and cellulose content, and provides specific molecular targets to improve poplar wood quality.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120648744B_ABST
    Figure CN120648744B_ABST
Patent Text Reader

Abstract

This invention discloses PagBAG8 The application of genes in regulating the growth and development of poplar trees belongs to the field of forestry bio-genetic engineering technology. PagBAG8 The application of genes in regulating the growth and development of poplar trees, the PagBAG8 The nucleotide sequence of the gene is shown in SEQ ID NO:1, and the gene utilizes the described... PagBAG8 The method for genetically breeding transgenic poplar trees includes the following steps: cloning poplar trees. PagBAG8 Genes; the aforementioned PagBAG8 Genes are linked to a vector to obtain an overexpression vector; the overexpression vector is transformed into Agrobacterium to obtain Agrobacterium culture; the Agrobacterium culture is then used to infect poplar leaves to obtain... PagBAG8 Gene overexpression in plants. This invention provides a new option for regulating poplar growth and development, and offers potential targets for molecular breeding improvement of poplar traits.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of forestry bioengineering, and particularly relates to PagB AG8 Application of a gene in regulating growth and development of a poplar. BACKGROUND

[0002] Wood, as an important renewable resource, plays an irreplaceable role in the fields of construction, papermaking, energy and the like, and its formation process involves a series of complex biological processes such as plant vascular tissue development and secondary cell wall synthesis, and is precisely regulated by a variety of genes and molecular mechanisms. The BAG (Bcl-2-associated athanogene) protein family, as an evolutionarily conserved chaperone cofactor, is widely involved in processes such as plant growth and development, stress response and programmed cell death, and the BAG domain at the C-terminus can interact with heat shock proteins, and the IQ motif unique to plants can also participate in signal transduction by binding to calmodulin. The functions in model plants such as Arabidopsis and rice have been partially elucidated.

[0003] Poplar, as an important fast-growing timber tree species, the study of its wood formation mechanism is of great significance for genetic improvement of forest trees. At present, some key genes involved in wood formation have been identified in poplar, such as SND1 of the NAC family and MYB46 of the MYB family, but the functional research on BAG family genes in poplar is still relatively scarce, and the specific mechanism has not been clarified, and the function and molecular regulation network of the related genes still need to be analyzed.

[0004] Therefore, in-depth exploration of the influence of poplar BAG family genes, especially the members highly expressed in xylem, on wood formation, clarification of the key biological processes and interacting proteins regulated thereby, can provide new theoretical basis for analyzing the molecular mechanism of wood formation, and lay a foundation for improving the wood quality of poplar through genetic engineering means. SUMMARY

[0005] The application aims to provide PagB AG8 Application of a gene in regulating growth and development of a poplar, which provides a new option for regulating growth and development of a poplar, and clarifies PagB AG8 The gene can specifically regulate xylem development and leaf development of a poplar, which provides a theoretical basis for the regulatory role in growth and development of woody plants, and provides a potential target for molecular breeding improvement of poplar traits.

[0006] To solve the above technical problems, the technical solutions adopted by the application are as follows:

[0007] PagB AG8 The application of the gene in regulating growth and development of a poplar, wherein PagB AG8 The nucleotide sequence of the gene is shown as SEQ ID NO: 1.

[0008] Preferably, the expression level of the gene is regulated by regulating PagB AG8 The expression level of the gene regulates the development of the xylem and / or the development of the leaves of the poplar.

[0009] Preferably, the growth and development of the plant is retarded, the plant height, ground diameter and internode length are reduced, the stem xylem width is reduced, and the cellulose synthesis is reduced by overexpressing the gene. PagB AG8 Preferably, the leaf area of the plant is reduced and the leaf length-width ratio is reduced by overexpressing the gene.

[0010] PagB AG8

[0011] The application also provides an overexpression vector for regulating the growth and development of a poplar, wherein the overexpression vector comprises the gene. PagB AG8

[0012] The application also provides a strain for regulating the growth and development of a poplar, wherein the strain comprises the overexpression vector.

[0013] The application also provides a method for cultivating a transgenic poplar by using the gene, comprising the following steps: PagB AG8

[0014] S1, cloning the poplar gene; PagB AG8

[0015] S2, connecting the gene to a vector to obtain an overexpression vector; PagB AG8

[0016] S3, transforming the overexpression vector obtained in S2 to Agrobacterium to obtain an Agrobacterium bacterial solution;

[0017] S4, infecting the poplar leaves with the Agrobacterium bacterial solution obtained in S3 to obtain a gene overexpression plant. PagB AG8

[0018] Preferably, the cloning of the poplar gene in S1 is specifically performed as follows: PagB AG8

[0019] extracting the total RNA of the poplar, reverse transcribing the total RNA into cDNA as a template, and performing PCR amplification by using primers PagB AG8 -CDS-F and PagB AG8 -CDS-R to obtain the gene. PagB AG8

[0020] Preferably, the nucleotide sequence of the primer PagB AG8 -CDS-F is shown in SEQ ID NO. 2, and the nucleotide sequence of the primer PagB AG8 -CDS-R is shown in SEQ ID NO. 3.

[0021] ​​​​​​​​​Compared with the prior art, the application has the following advantages and technical effects:

[0022] The application discloses PagB AG8 The application discloses PagB AG8 The application discloses Figure 1 The application discloses The application discloses

[0023] The application discloses The application discloses The application discloses

[0024] The application discloses PagB AG8 The application discloses Figure 2 The application discloses The application discloses

[0025] The application discloses PagB AG8 The application discloses Figure 3 The application discloses The application discloses

[0026] The application discloses PagB AG8 The application discloses Figure 4 The application discloses The application discloses

[0027] The application discloses PagB AG8 The application discloses Figure 4 The application discloses Figure 4 The application discloses Figure 4 The application discloses Figure 4 The application discloses PagB AG8 The application discloses Figure 5 The application discloses The application discloses

[0028] The application discloses PagB AG8 The application discloses Figure 5 The application discloses Figure 5 The application discloses Figure 6 The application discloses The application discloses

[0029] The application discloses PagB AG8 The application discloses Figure 6 The application discloses Figure 6 The application discloses Figure 6 The application disclosesFigure 6 In this context, C represents the plant height statistics. Figure 7 In this context, D represents the ground diameter statistics.

[0030] Figure 8 TBO staining results for transverse sections of stem internode tissue from transgenic and WT plants, scale bar 500 μm;

[0031] Figure 8 The results show the statistical findings on xylem width and cell layer number of transgenic and WT plants. Figure 8 In the image, A is a cross-section of the 11th internode tissue of the stem, with a scale bar of 200 μm. Figure 8 In this context, B represents the width of the xylem, and n=50. Figure 9 In this context, C represents the number of xylem cell layers, n=100;

[0032] Figure 9 The images show electron microscopy scans of transgenic and WT plants. Figure 9 In the figure, A represents cell wall observation, with magnifications of 180x (scale bar = 300μm) and 800x (scale bar = 50μm). Figure 10 In the diagram, B represents the cloud and rain distribution, n=500;

[0033] Figure 11 The results of staining a cross section of tissue from the 11th internode of the stem;

[0034] Figure 11 The results are for fiber separation and cell length measurement, among which, Figure 11 In the figure, A represents the microscopic observation results of wood fiber cells and phloem fiber cells, with a scale bar of 200 μm. Figure 11 In this context, B represents the length of the wood fiber cell, and n=500. Figure 12 In this context, C represents the length of phloem fiber cells, and n=300;

[0035] Figure 12 The results show the total area and aspect ratio of the blades. Figure 12 In the image, A represents the leaf scan result, and the scale bar is 5cm. Figure 12 In the figure, B represents the total leaf area statistics for leaves 1 to 15. PagB AG8 In this context, C represents the average length-to-width ratio of the first to the 15th leaves. Detailed Implementation

[0036] The technical solution of the present invention will be further described below with reference to the accompanying drawings and embodiments.

[0037] Unless otherwise defined, the technical or scientific terms used in this invention shall have the ordinary meaning as understood by one of ordinary skill in the art to which this invention pertains.

[0038] Source of experimental materials:

[0039] 1xTAE electrophoresis buffer (1 L): 50xTAE stock solution (US EVERBRIGHT #DZ8039) 20 mL, add 980 mL of deionized water to 1 L.

[0040] 1% agarose gel: 50 mL of 1xTAE solution, add 0.5 g of agarose powder (Bioweste Agarose), microwave oven to completely melt, add 1 μL of nucleic acid dye (GelRed, Vazyme) and mix, pour into the mold, insert the comb to leave the hole, and cool before use.

[0041] GUS buffer (1 L) formula: mix 0.2 M NaH2PO497.5 mL, 0.2 M Na2HPO4152.5 mL, 0.2% Triton-100 2 mL, 100 mM K3Fe(CN)620 mL and 100 mM K4Fe(CN)620 mL, and dilute to 1 L with deionized water, store at 4°C in the dark.

[0042] GUS staining solution formula: add 0.05218 g of X-Gluc (dissolved in DMSO to prepare a 1 mM solution) to 100 mL of GUS buffer, and use it immediately.

[0043] Tobacco suspension formula (100 mL): 1 M MES 1 mL, 1 M MgCl21 mL, 20 μM AS, dilute to 100 mL with deionized water, and use it immediately.

[0044] WPM suspension (1 L) formula: WPM 2.4 g, MES 0.5 g, 2,4-D 1 mg / L, KT 0.1 mg / L, sucrose 20 g, 100 μM AS, adjust pH to 5.9 with NaOH solution, sterilize at 121°C for 20 min, and add 100 μM acetosyringone after cooling to 40°C.

[0045] LB medium (1 L): Tryptone (OXOID #LP0042) 10 g, yeast extract (OXOID #LP0021) 5 g, sodium chloride (NaCl, Shanghai Test) 5 g, solid LB medium also needs to add agar powder 7.8 g (Agar, Shanghai Shenguo #A505255), dilute with deionized water, sterilize in a pressure sterilizer at 121°C for 20 min.

[0046] Formula for 1 / 2 MS rooting medium (1L): MS 519 2.2g, MES 0.5g, NAA 0.05mg / L, IBA 0.02mg / L, sugar 20g, deionized water to 1L, pH adjusted to 5.9 with NaOH solution, add 7.8g agar powder, autoclave at 121℃ for 20min, cool to 40℃ and add 200mg termethin.

[0047] Co-culture medium (1L) formula: WPM L449 2.4g, MES 0.5g, sugar 20g, deionized water to 1L, pH adjusted to 5.9 with NaOH, plant gel 3.2g, autoclave at 121℃ for 20min, and add 100μM acetylsyl syringone after cooling to 40℃.

[0048] Differentiation screening medium (1L) formulation: WPM L449 2.4g, MES 0.5g, NAA 0.1mg / L, 6-BA 0.5mg / L, sugar 20g, deionized water to a final volume of 1L, pH adjusted to 5.9 with NaOH solution, 3.2g plant gel added, autoclaved at 121℃ for 20min, cooled to 40℃ and then added 200mg termethin and 1.5mg hygromycin or 1.5mg G418.

[0049] The formula for callus induction medium (1L) is as follows: WPM L449 2.4g, MES 0.5g, 2,4-D 2mg / L, NAA 0.1mg / L, KT 0.1mg / L, sugar 20g, add water to make up to 1L, adjust the pH to 5.9 with NaOH solution, add 3.2g of plant gel, and autoclave at 121℃ for 20min.

[0050] Unless otherwise specified, the materials, reagents, enzymes, competent cells, plasmids, and instruments used in this invention are all conventional experimental materials in the field and can be purchased through commercial channels.

[0051] Example 1

[0052] Total RNA was extracted from 84K poplar trees, and cDNA was obtained using a reverse transcription kit. PCR amplification was performed using designed specific primers. PagB AG8 The full-length gene sequence was obtained, and the PCR product was cloned into a vector to construct an overexpression vector. The correctness of the overexpression vector was verified by bacterial testing and sequencing. The cloning primers were: PagB AG8 -CDS-F and PagB AG8 -CDS-R. PagB AG8 The nucleotide sequence of the gene is shown in SEQ ID NO.1. PagB AG8 The nucleotide sequence of -CDS-F is shown in SEQ ID NO.2.PagB AG8 The nucleotide sequence of CDS-R is shown as SEQ ID NO. 3.

[0053] SEQ ID NO. 1 :

[0054] ATGAAAAGCTCAACTTCAAAAGGTACAGAGACAAGGGAGTTTAACTACAGGGAGATAGACTGGGAACTTAGGCCTGGTGGCATGCTTGTTCAAAAGAGAGATGTTGGGGTTGGCTCTTCTGGGCCTATGATCAAGATCAAGGTCTCTCATGGCTCATGTCACTATGATACTGATGTCCCTGCTCAATCCACTTTTGGGGATTTGAAAAAGGTTCTTGCCAATGAGACTGGTTTGGAGCCTAAAGAGCAGAGATTATTGTTTAGAGGCAAAGAAAGGGAGAATGATGAATATTTGCACATGGTAGGTGTAAAAGACATGTCAAAGGTGATACTTTTTGAGGATCCAGCTAGCAAAGAGAGGAAGCTCGAGGAGATGAAGAGAAATCAGGGTACGTTTGAAGCCTATGAAGCTGTTTCCAGAGTGAGGGCAGAGGTTGATAAACTTTGCGAGAAGGTTGTTGCATTGGAGACAACATTTTGCAGTGGCACCGCGATTGCAGACAAAGAATTTGTTGTCTTGACAGAATTGCTTATGATACAGTTGCTTAAATTGGATTCAATTGAGGCAAATGGAGAAGCAAAAGTGCAGAGAAGGATTGAGGTTCGTCGAATCCAGAGCTTTGTGGACACTCTTGACAATTTGAAAGCAAGAAACTCTAACCCCTTCAGCAATAGTAGCAATGCAGTATCGGTGACGACCAAATGGGAGACATTTGCGTCTGGAGTTGGAAGCCTGAGTGCCCCAGTTCCAATACAATCTGCCACTAAAGTAACTCAGGACTGGGAGCTGTTTGACTAA.

[0055] SEQ ID NO. 2:

[0056] GGGGACAAAGTTTGTACAAAAAAGCAGGCTCGATGAAAAGCTCAACTTCAAAAGGTACAG.

[0057] SEQ ID NO. 3:

[0058] GGGGACCACTTTGTACAAGAAAGCTGGGTCTTAGTCAAACAGCTCCCAGTCC.

[0059] In 100 μL of PCR tube, the components required for polymerase chain reaction were added, and the cloning template was the cDNA of 84K poplar. PCR amplification was performed. The PCR reaction program was as follows: initial denaturation at 95 °C for 3 min; denaturation at 95 °C for 15 s; annealing at 72 °C for 15 s; extension at 55 °C for 2 min; 30 cycles; final extension at 72 °C for 5 min. After amplification, the PCR product was used for subsequent experimental analysis.

[0060] Reaction system: 2x Phanta Flash Master Mix 10 μL; PagB AG8 CDS-F (10 μM) 0.5 μL; PagB AG8 CDS-R (10 μM) 0.5 μL; cDNA template 1 μL; sterile water added to 20 μL.

[0061] After PCR product amplification, the amplification product was detected by agarose gel electrophoresis and recovered to obtain PagB AG8 The CDS fragment of the gene. 1% agarose gel was prepared with 1x TAE, and a middle hole comb was inserted. 4 μL 6x Loading buffer (Novozyme, P022-01, Nanjing) was added to the PCR reaction system. After the agarose gel was solidified, 5 μL DL2000 DNA Marker (Novozyme, MD102-01, Nanjing) was spotted, and 20 μL PCR reaction solution was spotted in each hole for agarose gel electrophoresis. The gel was placed under a UV transilluminator to observe and record the position and size of the DNA band. The gel was cut and the amplified fragment was recovered and stored at -20 °C for standby.

[0062] The recovered product of the E. coli gene was subjected to BP ligation reaction with the intermediate vector pDONR207. The DH5α competent cells were transformed PagB AG8 to obtain plasmids. The constructed pDONR207- PagB AG8 vector stably expressed in E. coli had Gen resistance.

[0063] BP reaction system: PagB AG8Gel recovery product 1-7 μL (150 ng); pDONR207 vector 1 μL (150 ng); BP Clonase TM II Mix 2 μL; TE buffer added to 10 μL.

[0064] pDONR207- eYGFP was obtained by BP reaction. E. coli After the plasmid, it was used for LR connection reaction with the final vector pK2GW7-eYGFP, and after 1h reaction at room temperature (25℃), it was used for transformation PagB AG8 DH5a competent cells, 35S: PagB AG8 Plasmid. The completed pK2GW7-eYGFP vector stably expressed after the E. coli has Spec resistance.

[0065] LR reaction system: pDONR207- PagB AG8 vector 1-7 μL (150 ng); pK2GW7-eYGFP vector 1 μL (150 ng); LR Clonase TM II Mix 2 μL; TE buffer added to 10 μL.

[0066] The correct eYGFP- PagB AG8 plasmid was stored at -20℃ for subsequent Agrobacterium genetic transformation.

[0067] Plasmid extraction and sequencing: positive monoclonal colonies were picked and inoculated in LB liquid medium containing the corresponding antibiotic, and cultured at 37℃ overnight. The plasmid extraction kit (Hailing, NG218S) was used according to the instructions to extract, determine the plasmid concentration and quality, and store at -20℃ for standby.

[0068] Agrobacterium GV3101 transformation:

[0069] Agrobacterium transformation: the extracted correct plasmid was added to Agrobacterium GV3101 competent cells (purchased from Shanghai Weidi Biological Company, and the specific operation was referred to the instructions).

[0070] 84K poplar genetic transformation: after the PagB AG8 overexpression vector was transferred into Agrobacterium GV3101 strain, 84K poplar genetic transformation experiment was carried out. Healthy and strong sterile 84K tissue culture seedlings were selected as materials, and the leaf disc method was used to infect the leaves, and the target gene was transformed into the leaves to obtain overexpression plants.

[0071] Agrobacterium-mediated transformation of silver gland poplar 84K

[0072] (1) Bacterial solution preparation: Agrobacterium single colony was inoculated in LB liquid medium containing the corresponding antibiotic, and cultured at 28℃ overnight, and the culture was cultured to OD600 Values are 0.5. Centrifuge at 4000 rpm for 5 min, discard the supernatant, resuspend the bacteria in a flask with the WPM suspension, the OD of the resuspended bacteria is 0.6, and stand by. 600

[0073] (2) Infection and co-culture: Make a wound on the fresh leaf along the vein position with a sterile blade, then put the wounded leaf into the resuspended bacteria solution for complete infection and soaking for 15 min, shake the bacteria solution gently during the process to ensure the full contact between the leaf and the Agrobacterium. After the infection is completed, take out the leaf and place it on a sterile filter paper, and absorb the surface bacteria solution, ready for the next step.

[0074] Place the leaf with absorbed surface bacteria solution on the plate of co-culture medium. Culture in the dark for about 2 days. During this period, observe whether there are colonies on the edge of the leaf to ensure the effect of co-culture, but avoid large area of bacterial plaque. Then transfer the co-cultured leaf to the differentiation medium, replace the medium every three weeks, and continue for about 6 weeks to induce the differentiation of adventitious buds on the leaf.

[0075] (3) Rooting culture of adventitious buds. Cut the adventitious buds and insert them into the 1 / 2 MS rooting medium with corresponding resistance, and culture under light for 7-15 days until the adventitious buds root. After growing for one month, the tissue culture seedlings can be used for subculture, and the transgenic plants can be screened and identified.

[0076] The tissue culture seedlings obtained by genetic transformation are inserted into the 1 / 2 MS rooting medium. Since the 35S:: overexpression vector is fused with fluorescent protein, strong green fluorescence can be observed under ultraviolet irradiation, which can be used to preliminarily identify whether the 35S:: overexpression vector is integrated into the 84K genome. PagB AG8 PagB AG8 Select the tissue culture seedlings with fluorescence and number them OE#1, OE#2, OE#3, etc. in sequence for DNA and RNA level identification.

[0077] DNA extraction and detection: Refer to the CTAB method for DNA extraction; refer to the Biotophet RNA extraction kit for RNA extraction.

[0078] RNA reverse transcription: RNA reverse transcription is performed using the Aikuer Evo M-MLV reverse transcription kit (#AG11728). The extracted RNA sample needs to be removed of genomic DNA before reverse transcription to synthesize cDNA.

[0079] gDNA removal reaction system: 5x gDNA Clean Reaction Mix 2 μL; Total RNA 1000 ng; RNase-free water added to 10 μL, reaction at 42°C for 2 min.

[0080] ​​Reverse transcription reaction system: 10 μL of the reaction solution from the previous step; 4 μL of 5×Evo M-MLV RT Reaction Mix; 6 μL of RNase free water. 37 °C, 15 min; 85 °C, 5 s, 4 °C cooling.

[0081] The cDNA obtained above was subjected to quantitative PCR analysis. Before the quantitative PCR reaction, the primers were designed through the NCBI website PagB AG8 Specific fluorescent quantitative primers, the length of the amplified sequence was controlled within the range of 150 bp-250 bp, and the UBQ quantitative reaction was used as a control for experimental results.

[0082] The quantitative primer sequences are shown in SEQ ID NO. 4-SEQ ID NO. 7.

[0083] UBQ-F: SEQ ID NO. 4: 5'-GACTTTGACCGGAAAGACCA-3'.

[0084] UBQ-R: SEQ ID NO. 5: 5'-GGAGACGAAGGACAAGGTGA-3'.

[0085] PagB AG8 -Quantitative-F:

[0086] SEQ ID NO. 6: 5'-GCAGAGAAGGATTGAGGTTC-3'.

[0087] PagB AG8 -Quantitative-R:

[0088] SEQ ID NO. 7: 5'-CCCATTTGGTCGTCACCGAT-3'.

[0089] The quantitative PCR reaction program was as follows: 95 °C, 1 min; 95 °C, 10 s; 57 °C, 10 s, 72 °C extension for 20 s, 45 cycles; melting curve determination from 65 °C to 95 °C. Each reaction was set with 4 repeated times. According to the data reliability analyzed by the melting curve and the amplification curve, the expression amount of the target gene was calculated by the method.

[0090] Real-time fluorescent quantitative PCR reaction system: 5 μL of 2×SYBR Green Pro Taq HS Premix; 0.2 μL of Primer F (10 μM); 0.2 μL of Primer R (10 μM); 1 μL of cDNA template; sterile water added to 10 μL.

[0091] Subcellular localization: construction of subcellular localization vector

[0092] Gateway method to construct pMDC43- GFP green fluorescent protein tag PagB AG8 Gateway adapter sequence includes forward adapter (SEQ ID NO. 2) and reverse adapter (SEQ ID NO. 3), Gateway experiment includes BP and LR reaction, as described above. The constructed vector is transformed into Agrobacterium GV3101 (pSoup-p19) (purchased from Shanghai Weidi Biological Company, specific operation according to the instruction), and the Agrobacterium is suspended to OD600 = 1.0. The nucleic acid marker type tobacco leaf is injected into the leaf from the back of the leaf, and cultured in the dark for 1 day and then cultured under light for 2 days, so that pMDC43- PagB AG8 The vector is transiently expressed in tobacco, and the green fluorescent signal distribution in the leaf is observed under the laser confocal microscope after culture. The nucleic acid marker type tobacco cell nucleus emits red fluorescence under the RFP channel.

[0093] The experimental results are as follows:

[0094] Figure 1 The results of tissue-specific expression pattern analysis are shown in Figure 1 .

[0095] As can be seen from PagB AG8 , PagB AG8 the expression amount of the gene in different tissues of 84K poplar is different, and the expression amount in the stem tissue is higher than that in other tissues, especially in the 5th-11th internodes, and the expression amount in the root is the lowest.

[0096] Figure 2 The results of specific expression analysis in the stem are shown in Figure 2 .

[0097] As can be seen from PagB AG8 , PagB AG8 the expression amount in the xylem is higher, indicating that the gene is more active in the vascular tissue of poplar. This result further confirms that PagB AG8 the gene may play an important role in the xylem of poplar and affect the formation of poplar wood.

[0098] Figure 3 The results of subcellular localization analysis are shown in Figure 3 .

[0099] As can be seen from PagB AG8 , green fluorescent signals are found to be obviously concentrated in the nucleus and cytoplasm regions, which are highly coincident with the position of the nuclear marker, indicating that PagB AG8 the protein mainly functions in the nucleus and cytoplasm, and PagB AG8As a molecular chaperone protein, its main function is to assist protein correct folding, assembly, transport and degradation, mediate the correct assembly of other proteins, and play an important role in maintaining protein homeostasis.

[0100] Figure 4 Overexpression plant identification analysis, 84K poplar genetic transformation process as shown in Figure 4 .

[0101] From PagB AG8 It can be seen that the genetic transformation process includes four main steps: tissue infection, induction of differentiation of buds, resistance screening, and rooting culture. Through Agrobacterium infection of 84K leaves and callus, the differentiation medium is used to induce the growth of adventitious buds, and the fluorescent adventitious buds are inserted into the rooting medium to grow, and new stable genetically transgenic plants are obtained.

[0102] Figure 5 Overexpression plant identification and RT-qPCR quantitative analysis, results as shown in PagB AG8 .

[0103] Extract the genomic DNA of the fluorescent strain for PCR reaction to amplify specific fragments, wild type 84K as negative control, 35S: PagB AG8 vector plasmid as positive control, the size of the target fragment is about 1000bp, to detect whether the 35S: Figure 5 vector sequence (A) is integrated in the genome PagB AG8 . Further analysis of the transcription level of the 10 overexpression Figure 5 gene positive transgenic plants, the results are as shown in PagB AG8 B, select the three strains with the highest expression PagB AG8 -OE#32, PagB AG8 -OE#61, PagB AG8 -OE#63.

[0104] Example 2

[0105] Poplar gene function verification, the specific test scheme is as follows: PagB AG8

[0106] The rooting culture of the test group is transplanted into the nutrient soil and continues to grow for 8-10 weeks. Soil watering is performed every three days to maintain good growth conditions, and the growth conditions of each group are consistent.

[0107] Transgenic and WT plant growth index determination: after the plants are cultured and grown in the greenhouse for 8-10 weeks, the phenotype is measured and recorded, including plant height, ground diameter, and internode number.

[0108] Transgenic and WT plant stem tissue section observation:

[0109] ​The cross-section of the cut stem was dyed with 0.1% toluidine blue (TBO), 1% phloroglucinol and whitening agent (CFW), and observed and photographed with a Leica DM6 B upright fluorescence microscope.

[0110] Scanning electron microscope observation: The tissue sections and fresh leaves were observed by using a Hitachi table scanning electron microscope TM4000, and photographs were taken under low and high magnification for comparative analysis.

[0111] Fiber cell isolation: The 12th internode stem segment of the plant was subjected to fiber isolation treatment, the epidermis and lignified stem segment were peeled off, cut into small pieces, and then placed in a 2 mL centrifuge tube. After adding an appropriate amount of isolation liquid, it was reacted in a metal bath at 60°C for 48h. After the bark and stem segment were completely dissociated into flocculent material, the isolation liquid was poured out by low speed centrifugation, and the residual isolation liquid was removed by washing with deionized water for 2-3 times. Then, deionized water was added to suspend the fiber cells for observation, and the microscope was used for observation.

[0112] Cell wall component analysis: The bark of the fresh plant sample was peeled off, classified and labeled, and then dried in an oven at 80°C for 72h until the weight was constant. Then, the dried stem segment was ground into powder by using a ball mill, and the sample was collected by sieving. The cellulose content was determined by anthrone method, and the final content was determined by enzyme labeling method. The cellulose content was determined by using M1733B kit of Mengxi Biology, and the specific test scheme was described in the kit instruction.

[0113] The width of xylem, cell layer number, and fiber cell length were measured by using ImageJ software on the photographed tissue section photographs.

[0114] The test results are as follows:

[0115] Figure 6 The phenotype analysis results of the transgenic plants are shown in Figure 6 .

[0116] As shown in PagB AG8 , the plant height of the overexpression lines PagB AG8 OE#61 and PagB AG8 OE#63 was significantly smaller than WT, which was reduced by 20.5% and 15.5% respectively. The ground diameter of the overexpression lines was significantly smaller than WT, and the average value was reduced by 23.0% and 16.1% respectively. The above results show that PagB AG8 plays an important role in the growth of poplar, and the overexpression of PagB AG8 inhibits the growth of poplar plants, resulting in significantly dwarf and thin plants.

[0117] Figure 7 The stem tissue section analysis of the transgenic plants is shown in Figure 7 .

[0118] As shown in Figure 8It can be seen from the TBO staining observation that the stem diameter of the overexpression lines OE#61 and OE#63 is smaller than that of WT. The results of the above plant phenotypic analysis show that the overexpression lines are shorter and thinner than WT, which corresponds to the section results.

[0119] Structural differences between different strains, such as Figure 8 As shown in Figure A, by measuring the xylem width and xylem cell layer number between the 11th internode of the stem, it was found that the xylem width of the overexpression lines OE#61 and OE#63 was significantly smaller than that of WT, decreasing by 27.0% and 13.3%, respectively; the xylem cell layer number was also smaller than that of WT, decreasing by 26.7% and 20.4%, respectively. Figure 8 B and Figure 9 (C in the middle).

[0120] Electron microscopy results as follows Figure 9 As shown in A in the diagram. From PagB AG8 As shown in B, the cell wall thickness of the overexpression lines OE#61 and OE#63 was significantly smaller than that of WT, with an average reduction of 29.1% and 46.5%, respectively.

[0121] The results showed PagB AG8 The overexpression lines had thinner stems, narrower xylem widths, and fewer xylem cell layers than the WT lines. Scanning electron microscopy revealed reduced xylem cell wall thickness in the overexpression lines. These results indicate that overexpression... PagB AG8 Inhibiting the growth and development of xylem cells in poplar stems may affect the formation of poplar wood.

[0122] Figure 10 The effects on wood formation, the results are as follows Figure 10 As shown.

[0123] Depend on Figure 11 It can be seen that the fibers and vascular bundles of the overexpressing strains are lighter in color, indicating a weaker signal, while a stronger signal is observed in the fibers and vascular bundles of WT plants.

[0124] Fiber separation was performed on the 12th internode of the poplar stem, and the results were as follows: Figure 11 As shown.

[0125] The dissociated wood fiber cells and phloem fiber cells were used for fiber observation and analysis. Cell length was measured, and 500 wood fiber cells and 300 phloem fiber cells were counted. Figure 11 As shown in A in the diagram. From Figure 11 B and PagB AG8As shown in Fig. 6C, compared with WT, the length of xylem fiber cells and phloem fiber cells of overexpression lines OE#61 and OE#63 were significantly reduced, the average length of xylem fiber cells were reduced by 5.5% and 11.2% respectively, and the average length of phloem fiber cells were reduced by 4.2% and 12.0% respectively.

[0126] Figure 12 The influence on leaf development was shown in Fig. 6D. Figure 12

[0127] The morphology of leaf epidermal cells was observed by scanning electron microscope, as shown in Fig. 6A. As shown in Fig. 6B, the total leaf area of overexpression lines OE#61 and OE#63 were significantly reduced compared with WT, which were reduced by 47.7% and 50.1% respectively; the average length-width ratio of 15 leaves was calculated, the results showed that the length-width ratio of overexpression lines was reduced compared with WT, and the overall shape of the leaves appeared more round (Fig. 6C). Figure 12 Figure 12 ​

[0128] Finally, it should be noted that: the above examples are only used to illustrate the technical solutions of the present application rather than limiting it, although the present application has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that: it can still modify or equivalently replace the technical solutions of the present application, and these modifications or equivalent replacements also cannot make the modified technical solutions deviate from the spirit and scope of the technical solutions of the present application.​​​​

Claims

1. PagBAG8 The application of genes in regulating the growth and development of poplar, characterized in that, The PagBAG8 The nucleotide sequence of the gene is shown as SEQ ID NO:

1.

2. Use according to claim 1, characterized in that, By modulating PagBAG8 The expression level of the genes modulates poplar xylem development and / or leaf development.

3. Use according to claim 2, characterized in that, By overexpressing the PagBAG8 The plants grew slowly, the plant height, ground diameter and internode length were reduced, and the stem xylem width was reduced.

4. Use according to claim 2, characterized in that, By overexpressing said PagBAG8 genes the leaf area of the plants is reduced and the leaf length to width ratio is decreased.

5. A method of growing transgenic poplar trees using the method of claim 1. PagBAG8 A method of genetically engineering transgenic poplar trees, characterized by, comprising the following steps: S1, Cloning of Poplar PagBAG8 Genes; S2, the PagBAG8 gene is linked to a vector to obtain an expression vector; S3, transforming the overexpression vector obtained in S2 into Agrobacterium to obtain Agrobacterium bacterial liquid; S4, infecting the poplar leaves with the Agrobacterium liquid obtained in S3 to obtain PagBAG8 gene overexpression plants.

6. The method of claim 5, wherein, The S1 of the cloned poplar PagBAG8 The genetic manipulation is specifically The total RNA of poplar was extracted, and reverse transcribed into cDNA as a template, and PCR amplification was carried out by using primers PagBAG8 -CDS-F and PagBAG8 -CDS-R to obtain PagBAG8 the gene.

7. The method of claim 6, wherein, The nucleotide sequence of CDS-F is shown as SEQ ID NO.

2. PagBAG8 The nucleotide sequence of CDS-F is shown as SEQ ID NO.

2. PagBAG8 The nucleotide sequence of CDS-F is shown as SEQ ID NO. 2.