Short-chain non-coding RNA molecular tool vector expression system and application thereof

By using the endothelial-specific promoter of the ICAM2 gene and the intron 2 region of the rpl13a gene as the backbone sequence, a molecular tool vector was constructed to solve the problems of accuracy and low efficiency of endothelial-specific snoRNA overexpression, and achieve efficient and stable expression in endothelial cells.

CN120648752APending Publication Date: 2025-09-16THE AFFILIATED HOSPITAL OF SOUTHWEST MEDICAL UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510874984.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2024-07-18
Filing Date
2025-06-27
Publication Date
2025-09-16

AI Technical Summary

Technical Problem

In the existing technology, endothelial-specific snoRNA overexpression has the problems of poor accuracy and low efficiency, especially because common promoters such as U6 or CMV promoters cannot accurately express snoRNA in specific organs, resulting in widespread expression throughout the body and requiring further processing to form mature snoRNA.

Method used

The endothelial-specific promoter sequence of the ICAM2 gene and the intron 2 region of SNORD32A in the rpl13a gene were used as backbone sequences to construct a molecular tool vector. SNORD15A, SNORD118 and Dsred sequences were inserted through homologous recombination technology to achieve precise, efficient and stable overexpression of snoRNA.

Benefits of technology

It achieves precise, efficient and stable overexpression of short-chain non-coding RNA, including snoRNA, and specifically initiates high expression in endothelial cells, avoiding the problem of widespread expression throughout the body.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120648752A_ABST
    Figure CN120648752A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of biology, in particular to a short-chain non-coding RNA molecular tool vector expression system and application thereof. The molecular tool vector expression system comprises an endothelial specific gene promoter sequence and a skeleton sequence for expressing short-chain non-coding RNA including snoRNA, the endothelial specific gene promoter sequence is derived from an ICAM2 gene, and the skeleton sequence is derived from a No.2 intron region of SNORD32A in an rpl13a gene; a traditional U6 or CMV promoter is replaced with an endothelial specific promoter derived from the ICAM2 gene, expression of short-chain non-coding RNA can be specifically started, a skeleton sequence derived from a second intron region in the rpl13a gene is designed, the skeleton sequence can be promoted to have a plurality of splicing sites, and the splicing sites can be used for promoting the expression of the short-chain non-coding RNA. Therefore, accurate, efficient and stable overexpression of the short-chain non-coding RNA including the snoRNA can be realized.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority to Chinese patent application No. 202410963945.7 filed on July 18, 2024, the entire contents of which are incorporated herein by reference. Technical Field

[0003] The present application relates to the field of biotechnology, and in particular to a short-chain non-coding RNA molecular tool vector expression system and its application. Background Art

[0004] Noncoding RNA (ncRNA) is a type of RNA molecule that is transcribed from DNA but not translated into protein. It primarily includes microRNA (miRNA), transfer RNA (tRNA), long noncoding RNA (lncRNA), circular RNA (circRNA), small nuclear RNA (snRNA), small nucleolar RNA (snoRNA), and piwi-interacting RNA (piRNA). Among these, small nucleolar RNAs (snoRNAs) are a class of medium-length noncoding RNAs, typically ranging from 60 to 300 nt in length. SnoRNAs primarily direct site-specific modification of nucleotides within target RNAs through short base-pairing regions. SnoRNAs are widely present in the nucleolus of eukaryotic cells and play a crucial role in rRNA modification. Current research indicates that snoRNAs also participate in the modification of tRNA and mRNA. Furthermore, current research indicates that many snoRNAs are not only dysregulated in tumors, but their expression levels are correlated with clinical prognosis. Among these studies, the overexpression of endothelial-specific snoRNAs is particularly prominent. The main process currently used for overexpressing snoRNA vectors is: first, directly PCR amplify the mature snoRNA sequence from cells, construct it into a vector containing a U6 or CMV promoter, and finally use this virus to infect human umbilical vein endothelial cells to achieve endothelial-specific high expression of snoRNA.

[0005] However, current research on endothelial-specific snoRNA overexpression faces the following difficulties: First, the promoters of common high-expression vectors are all U6 promoters or CMV promoters. These promoters are difficult to accurately express snoRNA in a certain organ type and can only express snoRNA widely throughout the body, resulting in actual expression effects that do not match expectations; second, because snoRNA is mainly encoded by the intron regions of protein-coding genes and non-protein-coding genes, the introns released during gene splicing need to be further processed to form mature snoRNA. Therefore, based on the above two points, the current stable overexpression of snoRNA suffers from poor accuracy and low efficiency. Summary of the Invention

[0006] The present application provides a molecular tool vector expression system and its application to solve the following technical problem: how to achieve accurate and efficient stable overexpression of snoRNA.

[0007] In the first aspect, the present application provides a molecular tool vector expression system, which includes an endothelial-specific gene promoter sequence and a backbone sequence for expressing snoRNA, wherein the endothelial-specific gene promoter sequence is derived from the ICAM2 gene, and the backbone sequence is derived from the intron 2 region of SNORD32A in the rpl13a gene.

[0008] Optionally, the nucleotide sequence of the endothelial-specific gene promoter sequence is shown in SEQ ID NO.1.

[0009] Optionally, the backbone sequence includes, in sequence, an upstream sequence of intron region No. 2, intron region No. 2, and a downstream sequence of intron region No. 2, wherein the upstream sequence is a sequence of a preset length upstream of the 5' end of intron region No. 2, and the downstream sequence is a sequence of the preset length from SNORD32A to downstream of the 3' end of intron region No. 2.

[0010] Optionally, the preset length is 30 bp.

[0011] Optionally, the nucleotide sequence of the upstream sequence is shown as SEQ ID NO.2, the nucleotide sequence of the intron region No. 2 is shown as SEQ ID NO.3, and the nucleotide sequence of the downstream sequence is shown as SEQ ID NO.4.

[0012] Optionally, the nucleotide sequence of the backbone sequence is shown as SEQ ID NO.5.

[0013] In a second aspect, the present application provides a molecular tool vector having the molecular tool vector expression system described in the first aspect.

[0014] Optionally, the tool carrier includes at least one of the following:

[0015] Eukaryotic expression vectors, lentiviral vectors, adenoviral vectors and retroviral vectors.

[0016] In a third aspect, the present application provides a method for preparing the molecular tool carrier according to the second aspect, the method comprising:

[0017] Using the HUVEC cell genome as a template and the first amplification primer set for PCR amplification, followed by purification, to obtain the ICAM2 fragment;

[0018] The ICAM2 fragment and the adeno-associated virus vector with a CMV promoter are subjected to a first double enzyme digestion, followed by purification and T4 ligase ligation to obtain a first recombinant plasmid;

[0019] Using the mouse BC16 cell genome as a template and using the second amplification primer set for PCR amplification, followed by purification, a DNA sequence overexpressing short noncoding RNA including SNORD32A was obtained;

[0020] Performing a second double enzyme digestion on the DNA sequence overexpressing the short non-coding RNA including SNORD32A and the first recombinant plasmid, followed by purification and T4 ligase ligation to obtain a second recombinant plasmid;

[0021] Using homologous recombination technology, the SNORD15A, SNORD118 and Dsred sequences were respectively inserted into the second recombinant plasmid, and then sequenced and screened to obtain a molecular tool vector;

[0022] Wherein, the first amplification primer set has a first enzyme cleavage site set, and the first enzyme cleavage site set is the same as the enzyme cleavage site of the first double enzyme digestion;

[0023] The second amplification primer set has a second enzyme cleavage site set, and the second enzyme cleavage site set is the same as the enzyme cleavage site of the second double enzyme digestion;

[0024] The first restriction enzyme cleavage site group and the second restriction enzyme cleavage site group are different.

[0025] Optionally, the first restriction enzyme cleavage site group includes an Avr II site and a BspE I site; the second restriction enzyme cleavage site group includes an ECOR I site and an Eag I site.

[0026] The above technical solution provided by the embodiment of the present application has the following advantages compared with the prior art:

[0027] An embodiment of the present application provides a molecular tool vector expression system, which includes an endothelial-specific gene promoter sequence and a backbone sequence for expressing short-chain non-coding RNA, including snoRNA, wherein the endothelial-specific gene promoter sequence is derived from the ICAM2 gene, and the backbone sequence is derived from the intron 2 region of the rpl13a gene. Compared with traditional molecular tool vectors that overexpress snoRNA, the use of the endothelial-specific promoter derived from the ICAM2 gene instead of the traditional U6 or CMV promoter can specifically promote the expression of short-chain non-coding RNA, including snoRNA. In addition, the design is derived from the intron 2 region of the rpl13a gene. Since there are natural splice site sequences on both sides of the intron 2 region, the backbone sequence can be promoted to have multiple splice sites. Without introducing additional nucleic acid base sequences, the backbone sequence can be promoted to efficiently express short-chain non-coding RNA, including snoRNA, thereby achieving accurate and efficient stable overexpression of short-chain non-coding RNA, including snoRNA. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate embodiments consistent with the present application and, together with the description, serve to explain the principles of the present application.

[0029] In order to more clearly illustrate the embodiments of the present application or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, for ordinary technicians in this field, other drawings can be obtained based on these drawings without any creative work.

[0030] Figure 1 The plasmid map of the pscAAV-ICAM2-SNORD32A molecular tool vector provided in the examples of this application;

[0031] Figure 2 Schematic diagram of the process for transforming the plasmid pscAAV-CMV-GFP into molecular tool vectors of pscAAV-ICAM2-GFP and pscAAV-ICAM2-SNORD32A by molecular biological means provided in the examples of the present application;

[0032] Figure 3 This is a diagram showing the effect of the specific detection promoter ICAM2 specifically promoting GFP protein expression provided in the examples of the present application;

[0033] Figure 4 This is a diagram showing the effect of the PCR detection molecular tool vector provided in the embodiment of the present application in overexpressing SNORD32A in cells through ICAM2;

[0034] Figure 5 This is a graph showing the results of the PCR detection molecular tool vector overexpressing various other snoRNA and GFP random gene fragments provided in the examples of this application;

[0035] Figure 6 This is a diagram showing the actual effect of the molecular tool vector provided in the examples of this application on the high expression of SNORD32A in endothelial cells and cardiomyocytes;

[0036] Figure 7 This is a diagram showing the actual results of PCR detection of high expression of SNORD32A by the molecular tool vector provided in the examples of this application;

[0037] Figure 8 A schematic flow chart of a method for preparing a molecular tool carrier provided in an embodiment of the present application. DETAILED DESCRIPTION

[0038] To make the purpose, technical solutions, and advantages of the embodiments of this application more clear, the technical solutions in the embodiments of this application will be clearly and completely described below in conjunction with the drawings in the embodiments of this application. Obviously, the described embodiments are part of the embodiments of this application, not all of the embodiments. Based on the embodiments in this application, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of this application.

[0039] Various embodiments of the present application may be presented in the form of a range; it should be understood that the description in the form of a range is only for convenience and brevity and should not be understood as a rigid limitation on the scope of the present application; therefore, the range description should be considered to have specifically disclosed all possible sub-ranges and single numerical values ​​within the range; for example, the range description from 1 to 6 should be considered to have specifically disclosed sub-ranges, such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6, etc., as well as single numbers within the range, such as 1, 2, 3, 4, 5 and 6, which apply regardless of the range; in addition, whenever a numerical range is indicated in this document, it is meant to include any cited number (fractional or integer) within the indicated range.

[0040] As used herein, the terms "including," "comprising," and the like mean "including but not limited to." Relational terms such as "first" and "second" are used solely to distinguish one entity or operation from another, and do not necessarily require or imply any actual relationship or order between these entities or operations. "And / or" describes the association relationship between associated objects, indicating that three relationships can exist. For example, "A and / or B" can mean: A exists alone, A and B exist at the same time, and B exists alone; where A and B can be singular or plural. "At least one" means one or more, "plurality" means two or more; "at least one," "at least one of the following" or similar expressions refers to any combination of these items, including any combination of single or plural items; for example, "at least one of a, b, or c" or "at least one of a, b, and c" can all mean: a, b, c, ab (i.e., a and b), ac, bc, or abc, where a, b, and c can each be single or plural. Unless otherwise specified, all raw materials, reagents, instruments and equipment used in this application can be purchased from the market or prepared by existing methods.

[0041] It should be noted that, with respect to the prior art described in the background art, the inventors of the present application have discovered that the current main process for overexpressing short-chain non-coding RNAs, including snoRNA, has two major disadvantages: (1) From a cellular level, in the process of using molecular tool vectors containing U6 or CMV promoters to package viruses to infect endothelial cells, the non-specificity of U6 or CMV promoters may affect the subsequent infection efficiency and even greatly reduce the infection efficiency; (2) From an animal level, due to the organ diversity of mice, it is difficult to ensure that the virus can be specifically expressed in endothelial cells.

[0042] An embodiment of the present application provides a molecular tool vector expression system, which includes an endothelial-specific gene promoter sequence and a backbone sequence for expressing short-chain non-coding RNA including snoRNA, wherein the endothelial-specific gene promoter sequence is derived from the ICAM2 gene, and the backbone sequence is derived from the intron 2 region of SNORD32A in the rpl13a gene.

[0043] It should be noted that the intron 2 region may include the entire intron 2 region, and may also include the upstream sequence of the intron 2 region and the downstream sequence of the intron 2 region.

[0044] In some optional embodiments, the nucleotide sequence of the endothelial-specific gene promoter sequence is shown as SEQ ID NO.1.

[0045] In these embodiments, the specific nucleotide sequence of the endothelial-specific gene promoter sequence is clarified, which can further specifically initiate the expression of the backbone sequence to achieve accurate and efficient stable overexpression of short-chain non-coding RNA including snoRNA.

[0046] In some optional embodiments, the backbone sequence includes, in sequence, an upstream sequence of intron region No. 2, intron region No. 2, and a downstream sequence of intron region No. 2, wherein the upstream sequence is a sequence of a preset length upstream of the 5' end of intron region No. 2, and the downstream sequence is a sequence of the preset length from SNORD32A to downstream of the 3' end of intron region No. 2.

[0047] In these embodiments, the backbone sequence may include, in sequence, the upstream sequence of intron region 2, the intron region 2, and the downstream sequence of intron region 2, and the upstream sequence is a sequence of a preset length upstream of the 5' end of intron region 2 of SNORD32A in the rpl13a gene, and the downstream sequence is a sequence of a preset length downstream of the 3' end of intron region 2 in the rpl13a gene. This can clarify the source of the backbone sequence and the specific splicing sites in the backbone sequence, thereby enabling the backbone sequence to efficiently express short-chain non-coding RNAs including snoRNA without introducing additional nucleic acid base sequences.

[0048] It should be noted that before primary mRNAs are translated into proteins, they must first be modified and edited. In normal splicing, specialized protein and RNA complexes (called spliceosomes) attach to these primary mRNAs. This results in specific regions of the RNA transcript (introns) being removed, while the flanking sequences (exons) are spliced ​​together. This intron splicing process is a key step in regulating gene expression in eukaryotes, and the GU-AG rule is the most classic signal for splice sites.

[0049] In addition, the intron that is about to be cut out needs to have three main sequence components. These three main sequence components include: (1) a 5' splice site with a consensus sequence of AG|GUAAGU; (2) a 3' splice site starting with an 11-nucleotide polypyrimidine fragment followed by NCAG|G; (3) somewhere between the two, there is a branch point adenine, usually within the YNCURAY sequence (Y is pyrimidine, N is any nucleotide, and R is purine). Splicing is actually a collection of two consecutive ester exchange reactions, and it is necessary to surround and bend the RNA autonomously or by a protein factor called snRNP to bring the reaction sites physically close. Therefore, the upstream and downstream sequences of the backbone sequence provided in this application can clearly be deduced from the regions shown in SEQ ID NO.2 and SEQ ID NO.4 that the backbone sequence has multiple natural splice site sequences, and these natural splice site sequences are conducive to the efficient expression of snoRNA by the backbone sequence.

[0050] In some optional embodiments, the preset length is 30 bp.

[0051] In these embodiments, the preset length can be 30 bp, which can further clarify the specific splicing sites in the backbone sequence.

[0052] In some optional embodiments, the nucleotide sequence of the upstream sequence is shown as SEQ ID NO.2, the nucleotide sequence of the intron region No. 2 is shown as SEQ ID NO.3, and the nucleotide sequence of the downstream sequence is shown as SEQ ID NO.4.

[0053] In some optional embodiments, the nucleotide sequence of the backbone sequence is shown as SEQ ID NO.5.

[0054] In these embodiments, under the premise of controlling the preset length to 30bp, the specific nucleotide sequences of the upstream sequence, intron 2 region and downstream sequence in the backbone sequence are further refined, so that the expression region and other functional regions of short-chain non-coding RNA including snoRNA in the backbone sequence can be clarified. In addition, the specific splicing site can also be clarified, thereby enabling the backbone sequence to efficiently express short-chain non-coding RNA including snoRNA without introducing additional nucleic acid base sequences.

[0055] Figure 1 The plasmid map of the pscAAV-ICAM2-SNORD32A molecular tool vector provided in the examples of the present application is exemplarily shown;

[0056] Based on a general inventive concept, such as Figure 1As shown, an embodiment of the present application provides a molecular tool vector having the molecular tool vector expression system.

[0057] The molecular tool vector is implemented based on the above-mentioned molecular tool vector expression system. The specific composition and information of the molecular tool vector expression system can be referred to the above-mentioned embodiments. Since the molecular tool vector adopts part or all of the technical solutions of the above-mentioned embodiments, it has at least all the beneficial effects brought about by the technical solutions of the above-mentioned embodiments, which will not be described one by one here.

[0058] In some optional embodiments, the tool carrier includes at least one of the following:

[0059] Eukaryotic expression vectors, lentiviral vectors, adenoviral vectors and retroviral vectors.

[0060] In these embodiments, the tool vector may include at least one of a eukaryotic expression vector, a lentiviral vector, an adenoviral vector, and a retroviral vector, and may cover most biological molecule vectors, so that the molecular tool vector expression system can be used in various expression systems such as ordinary eukaryotic expression, lentiviral expression, adenoviral expression, retroviral expression, and prokaryotic expression.

[0061] Figure 2 The following is a schematic diagram of a process for converting the plasmid pscAAV-CMV-GFP into molecular tool vectors pscAAV-ICAM2-GFP and pscAAV-ICAM2-SNORD32A by molecular biological means, as provided in an embodiment of the present application;

[0062] Figure 8 The following is a schematic flow chart of a method for preparing a molecular tool carrier provided in an embodiment of the present application;

[0063] like Figure 2 and Figure 8 As shown, based on a general inventive concept, the present embodiment provides a method for preparing the molecular tool carrier, the method comprising:

[0064] S1. Using the HUVEC cell genome as a template and using the first amplification primer set, PCR amplification was performed, followed by purification to obtain an ICAM2 fragment;

[0065] S2. The ICAM2 fragment is subjected to a first double enzyme digestion with an adeno-associated virus vector having a CMV promoter, followed by purification and T4 ligase ligation to obtain a first recombinant plasmid;

[0066] S3. Using the mouse B16 cell genome as a template and the second amplification primer set, PCR amplification is performed, followed by purification, to obtain DNA sequences of short noncoding RNAs including overexpressed snoRNAs;

[0067] S4. performing a second double enzyme digestion on the DNA sequence of the short non-coding RNA including the overexpressed snoRNA and the first recombinant plasmid, followed by purification and T4 ligase ligation to obtain a second recombinant plasmid;

[0068] S5. Using homologous recombination technology, the SNORD15A, SNORD118 and Dsred sequences were inserted into the second recombinant plasmid, and then sequenced and screened to obtain a molecular tool vector;

[0069] Wherein, the first amplification primer set has a first enzyme cleavage site set, and the first enzyme cleavage site set is the same as the enzyme cleavage site of the first double enzyme digestion;

[0070] The second amplification primer set has a second enzyme cleavage site set, and the second enzyme cleavage site set is the same as the enzyme cleavage site of the second double enzyme digestion;

[0071] The first restriction enzyme cleavage site group and the second restriction enzyme cleavage site group are different.

[0072] This method is a method for preparing the above-mentioned molecular tool carrier. The specific information of the molecular tool carrier can be referred to the above-mentioned embodiment. Since this method adopts part or all of the technical solutions of the above-mentioned embodiment, it has at least all the beneficial effects brought by the technical solutions of the above-mentioned embodiment, which will not be repeated here.

[0073] It should be noted that the adeno-associated virus vector with a CMV promoter can be the plasmid pscAAV-GFP.

[0074] It should be noted that the SNORD15A, SNORD118 and Dsred sequences were designed to verify that the backbone sequence of overexpressed snoRNA can be applied to other snoRNAs and short non-coding RNAs. Therefore, the universality of the molecular tool vector can be clarified based on these three examples.

[0075] In some optional embodiments, the first restriction enzyme cleavage site group includes an AvrII site and a BspEI site; the second restriction enzyme cleavage site group includes an ECORⅠ site and an EagⅠ site.

[0076] In these embodiments, the first restriction enzyme cleavage site group may include an AvrII site and a BspEI site, and the second restriction enzyme cleavage site group may include an ECORⅠ site and an EagⅠ site, which can be used to promote the DNA sequences of ICAM2 fragments and short-chain non-coding RNAs including overexpressed snoRNA to enter corresponding plasmid vectors based on high-fidelity PCR technology, so as to ultimately achieve accurate and efficient stable overexpression of short-chain non-coding RNAs including snoRNA.

[0077] The present application is further described below with reference to specific examples. Experimental methods in the following examples where specific conditions are not specified are generally measured in accordance with industry standards; if there are no corresponding industry standards, they are carried out in accordance with common international standards, conventional conditions, or conditions recommended by the manufacturer.

[0078] Example 1

[0079] The endothelial-specific gene promoter sequence was designed based on the human ICAM2 gene, with a size of 0.33 Kb. The specific steps are as follows:

[0080] According to the Genebank gene database, the transcription start site of the human ICAM2 gene was analyzed, and the endothelial-specific gene promoter was screened according to the characteristic sequence of the molecular biology promoter transcriptional regulation of gene expression. The specific nucleotide sequence of the screened endothelial-specific gene promoter sequence is:

[0081] CCAGGCATGACTCCAACAATGCATCCCATGGGATTTGGGGTTCCCCAGATCTGGGGCTTGTAGGCCTGACTCTCCCCTGTGCACACGTCTCATACACGCATGCGTGCACCCATTGCCTGCCCCGCCCCTTGCACAGGGAGTCAGCAGGGAGGACTGGGTTATGCCCTGCTTATCAGCAGCTTCCCAGCTTCCCTGCC TGGATTCTTAGAGGCCTGGGGTCCTAGAACGAGCTGGTGCACGTGGCTTCCCAAAGATCTCTCAGATAATGAGAGGAAATGCAGTCATCAGTTTGCAGAAGGCTAGGGATTCTGGGCCATAGCTCAGACCTGCGCCCACCATCTCCCTCCAGGCAGCCCTTGGCTGGTCCCTGCGAGCCCGTGGAGACTGCCAG(SEQ ID NO.1).

[0082] In addition, the backbone sequence was designed based on the intron 2 region of the mouse rpl13a gene, the 30 bp upstream of the 5' end of the exon in this region, and the 30 bp from the intron 2 region to the 5' end of exon 3. The specific steps are as follows:

[0083] According to the Ensemble gene database, the intron 2 region of rpl13a in the maternal gene of SNORD32A was determined, and then the expression backbone sequence was designed based on the rules and principles of gene alternative splicing regulation.

[0084] The specific nucleotide sequence of the upstream sequence in the backbone sequence is:

[0085] CGGCCATTGTGGCCAAGCAGGTACTTCTGG(SEQ ID NO.2);

[0086] The specific nucleotide sequence of the intron 2 region in the backbone sequence is:

[0087] GTAAGTTTCATTCACCATTTACCTTTGCCTGGGAGTCCATGATGAGCAACACTC

[0088] ACCATCTTTCGTTTGAGTCTCACGACTGTGAGATCAACCCATGCACCGCTC

[0089] TGAGACTCGCCAGCCCCTGCTTTCTTGGGACCCCTGGCCTAAAAATACTTTTGG

[0090] AGCAAGAGATCTGCCTTCCAAGAGGCTTTGCTGACTAATCTCCAACTCCCTGTTAACTCTAG (SEQ ID NO. 3), wherein the bold and underlined wavy regions are replaceable regions and can be replaced with any mature snoRNA or DNA fragment;

[0091] The specific nucleotide sequence of the downstream sequence in the backbone sequence is:

[0092] GCCGGAAGGTGGTGGTCGTACGCTGTGAAG (SEQ ID NO. 4).

[0093] Therefore, the specific nucleotide sequence of the backbone sequence is:

[0094] CGGCCATTGTGGCCAAGCAGGTACTTCTGGGTAAGTTTCATTCACCATTTACCTTTGCCTGGGAGTCCATGATGAGCAACACTCACCATCTTCGTTTGAGTCTCACGACTGTGAGATCAACCCATGCACCGCTCTGAGACT CGCCAGCCCCTGCTTTCTTGGGACCCCTGGCCTAAAAATACTTTTGGAGCAAGAGATCTGCCTTCCAAGAGGCTTTGCTGACTAATCTCCAACTCCCTGTTAACTCTAGGCCGGAAGGTGGTGGTCGTACGCTGTGAAG(SEQ ID NO.5).

[0095] Example 2

[0096] Based on the endothelial-specific gene promoter sequence and backbone sequence prepared in Example 1, the following operations were further performed:

[0097] like Figure 2 As shown, the specific molecular tool vector is constructed as follows:

[0098] 1. Overexpression promoter modification:

[0099] The promoter CMV of the plasmid pscAAV-GFP was replaced with the epidermal-specific gene promoter sequence ICAM2Promoter. The specific steps are as follows:

[0100] Based on high-fidelity PCR technology, PCR amplification was performed using the human HUVEC cell genome as a template and a first amplification primer set {including the first amplification upstream primer: F: ATACCTAGGCCAGGCATGACTCCAACAATGC, (with an Avr II site), the first amplification downstream primer: R: ATATCCGGATCTCTGGCAGTCTCCACG, (with a BspE I site)} (the specific amplification procedure is shown in Table 1). The PCR product was then subjected to agarose gel electrophoresis and gel recovery and purification to obtain the ICAM2 fragment.

[0101] Table 1 PCR amplification procedure for the first amplification primer set:

[0102]

[0103] The ICAM2 fragment and the adeno-associated virus vector with a CMV promoter were subjected to a first double enzyme digestion (the enzyme digestion sites were Avr II and BspE I, and the specific enzyme digestion system is shown in Table 2), and then the target fragment was recovered using Gel Extraction Kit D2500. The specific steps were performed according to the kit instructions. Then use T4 ligase to connect the above-mentioned enzyme-cut ICAM2 fragment to the linear PscAAV-GFP vector. The specific connection system is shown in Table 3. The resulting connection product is transformed into Stbl3 competent cells. The specific operation is: take out the competent cells from the -80℃ refrigerator and thaw on ice; take 10μL of the connection product and add it to 100μL of the competent cells, mix gently, let it stand on ice for 30min, heat shock at 42℃ for 70s, then ice bath for 1min, add 900μL of antibiotic-free LB liquid culture medium, shake it on a 37℃ constant temperature shaker for 1h, the speed is about 220rpm, centrifuge it on a desktop centrifuge for 1min, take 100μL and apply it on the LB solid culture medium containing ampicillin resistance, stand it upright for 5min until all the liquid is absorbed, put it upside down in a 37℃ bacterial incubator, and leave it overnight for 12h~14h. Check the transformation results the next day. Then screen the positive colonies through colony PCR and send them to Qingke Company for sequencing and identification. The following is a successful construction. Figure 2 The first recombinant plasmid shown is pscAAV-ICAM2-GFP;

[0104] Table 2 The first double enzyme digestion system:

[0105]

[0106]

[0107] The reaction temperature of the first double enzyme digestion system is 37° C., and the reaction needs to be carried out in a PCR instrument for 1 hour.

[0108] Table 3 T4 ligation system for the first enzyme digestion product:

[0109] ICAM2 sequence after enzyme digestion 37.5ng PscAAV-GFP linearized plasmid after enzyme digestion 50ng 10xT4 DNA Ligase buffer 2μL T4DNAligase 1 μL Nuclease-freewater Make up to 20 μL

[0110] The first digestion product needs to be kept at 4°C overnight.

[0111] 2. Construction of special expression vectors for short non-coding RNA including snoRNA:

[0112] Based on high-fidelity PCR technology, PCR amplification was performed using the mouse BC16 cell genome as a template and the second amplification primer set {including the second amplification upstream primer: F: CAGTGAATTCCGGCCATTGTGGCCAAGC (with ECORⅠ site), the second amplification downstream primer: R: CATACGGCCGCTTCACAGCGTACGACCAC (with EagⅠ site)} (the specific amplification procedure is shown in Table 4). The PCR product was then subjected to agarose gel electrophoresis, and the target fragment was recovered using Gel Extraction Kit D2500. The specific steps were performed according to the instructions of the kit to obtain the DNA sequence of short-chain non-coding RNA including overexpressed snoRNA.

[0113] Table 4 PCR amplification program for the second amplification primer set

[0114]

[0115] The DNA sequence of the short non-coding RNA including the overexpressed snoRNA was subjected to a second double enzyme digestion with the first recombinant plasmid (the enzyme digestion sites were ECORⅠ and EagⅠ, and the specific enzyme digestion system is shown in Table 5). The target fragment was then recovered using the Gel Extraction Kit D2500. The specific steps were performed according to the instructions of the kit. Then use T4 ligase to connect the above-mentioned enzyme-cut ICAM2 fragment to the linear PscAAV-GFP vector. The specific connection system is shown in Table 6. The resulting connection product is transformed into Stbl3 competent cells. The specific operation is: take out the competent cells from the -80℃ refrigerator and thaw on ice; take 10μL of the connection product and add it to 100μL of the competent cells, mix gently, let it stand on ice for 30min, heat shock at 42℃ for 70s, then ice bath for 1min, add 900μL of antibiotic-free LB liquid culture medium, shake it on a 37℃ constant temperature shaker for 1h, the speed is about 220rpm, centrifuge it on a desktop centrifuge for 1min, take 100μL and apply it on the LB solid culture medium containing ampicillin resistance, stand it upright for 5min until all the liquid is absorbed, put it upside down in a 37℃ bacterial incubator, and leave it overnight for 12h~14h. Check the transformation results the next day. Then screen the positive colonies through colony PCR and send them to Qingke Company for sequencing and identification. The following is a successful construction. Figure 2 The second recombinant plasmid shown is pscAAV-ICAM2-SNORD32A;

[0116] Table 5 Second double enzyme digestion system

[0117]

[0118] The reaction temperature of the second double enzyme digestion system is 37° C., and the reaction needs to be carried out in a PCR instrument for 1 hour.

[0119] Table 6 Second enzyme digestion product T4 ligation system

[0120]

[0121] The second digestion product needs to be incubated at 4°C overnight.

[0122] Based on the construction process of the second recombinant plasmid described above and homologous recombination technology, SNORD15A was inserted into the second recombinant plasmid through the ECORⅠ site and the EagⅠ site. The specific process is as follows:

[0123] According to the NCBI gene database, the SNORD15A sequence was determined, and then the expression backbone sequence was designed based on the rules and principles of gene alternative splicing regulation.

[0124] The sequence of SNORD15A is:

[0125] CTTCGATGAAGAGGTGATGACGAGTCTGAGTAGGAAGTGTTGTCTTTGTCC AAGATGCCTCACTATGCTGCGTTCTGTGGCACAGCTGAAAGCACTGTGGTCAAA AGAAACTTCCTAAAGATGACCAAGAGGCATTTGTCTGAGAAGG;

[0126] The specific nucleotide sequence of the upstream sequence in the backbone sequence is:

[0127] CGGCCATTGTGGCCAAGCAGGTACTTCTGG(SEQ ID NO.2);

[0128] The specific nucleotide sequence of the intron 2 region in the backbone sequence is:

[0129] The bold and underlined regions are directly replaced by the sequence of SNORD15A in SEQ ID NO. 3.

[0130] The specific nucleotide sequence of the downstream sequence in the backbone sequence is:

[0131] GCCGGAAGGTGGTGGTCGTACGCTGTGAAG (SEQ ID NO. 4).

[0132] Therefore, the specific nucleotide sequence of the backbone sequence containing SNORD15A is:

[0133]

[0134] Based on the construction process of the second recombinant plasmid described above and homologous recombination technology, SNORD118 was inserted into the second recombinant plasmid through the ECORⅠ site and the EagⅠ site. The specific process is as follows:

[0135] According to the NCBI gene database, the SNORD118 sequence was determined, and then the expression backbone sequence was designed based on the rules and principles of gene alternative splicing regulation.

[0136] The sequence of SNORD118 is:

[0137] ATCGTCAGGAGGTTAATCCTTACCTGTTCCTCCTTTCGGAGGGCAGTAGAA AATGATGATTGGAGCTTGCATGATCTGCTGATTAGCATTTCCATGCAATCAGGA CCTGACAACATCCTGGTTGCTCCTATCTGATT;

[0138] The specific nucleotide sequence of the upstream sequence in the backbone sequence is:

[0139] CGGCCATTGTGGCCAAGCAGGTACTTCTGG(SEQ ID NO.2);

[0140] The specific nucleotide sequence of the intron 2 region in the backbone sequence is:

[0141] The bold and underlined wavy areas are directly replaced by the bold and underlined wavy areas of SEQ ID NO. 3 with the sequence SEQ ID NO. 8;

[0142] The specific nucleotide sequence of the downstream sequence in the backbone sequence is:

[0143] GCCGGAAGGTGGTGGTCGTACGCTGTGAAG (SEQ ID NO. 4).

[0144] Therefore, the specific nucleotide sequence of the backbone sequence containing SNORD118 is:

[0145]

[0146] Based on the construction process of the second recombinant plasmid described above and homologous recombination technology, the Dsred sequence was inserted into the second recombinant plasmid through the ECORⅠ site and the EagⅠ site. The specific process is as follows:

[0147] According to the NCBI gene database, the Dsred sequence was determined, and then the expression backbone sequence was designed based on the rules and principles of gene alternative splicing regulation.

[0148] The sequence of Dsred is:

[0149] TGTCCCCCCAGTTCCAGTACGGCTCCAAGGCCTACGTGAAGCACCCCGCCGACATCCCCGACTACATGAAGCTGTCCTTCCCCGAGGGCT;

[0150] The specific nucleotide sequence of the upstream sequence in the backbone sequence is:

[0151] CGGCCATTGTGGCCAAGCAGGTACTTCTGG(SEQ ID NO.2);

[0152] The specific nucleotide sequence of the intron 2 region in the backbone sequence is:

[0153] The bold and underlined wavy areas are directly replaced by the bold and underlined wavy areas of SEQ ID NO.3 with the sequence SEQ ID NO.10;

[0154] The specific nucleotide sequence of the downstream sequence in the backbone sequence is:

[0155] GCCGGAAGGTGGTGGTCGTACGCTGTGAAG (SEQ ID NO. 4).

[0156] Therefore, the specific nucleotide sequence of the backbone sequence containing Dsred is:

[0157]

[0158] After these second recombinant plasmids are successfully constructed, sequencing screening is performed to confirm that the plasmid construction is correct, so as to obtain similar Figure 1 The molecular tool vector shown.

[0159] Related experiments and effect data:

[0160] 1. Based on the molecular tool vector obtained in Example 2, its effect of specifically promoting GFP protein expression was detected. The specific steps are as follows:

[0161] The constructed PscAAV-ICAM2-GFP first recombinant plasmid was transfected with a transfection reagent Transfected into 293T cells, 48 ​​hours after transfection, observed under a fluorescence microscope and took photos to record whether the 293T cells were fluorescent. The specific transfection process was as follows: first, 293T cells were plated in a 6-well plate; in 200 μL of Add 2 μg of PscAAV-ICAM2-GFP to the buffer for dilution and gently pipette to mix; add 4 μL of Mix gently by pipetting with a pipette tip; incubate at room temperature for 10 min; replace the cell culture medium in the 6-well plate with 2 mL of 1640 complete medium; add 200 μL of transfection complex dropwise to each well and distribute evenly; gently shake the culture plate horizontally back and forth and left and right, and incubate at 37°C; analyze 48 h or later.

[0162] The results are as follows Figure 3 As shown, the ICAM2 promoter can overexpress GFP protein in 293T cells, causing the cells to exhibit green fluorescence.

[0163] 2. Based on the molecular tool vector obtained in Example 2, PCR technology was used to detect its effect of overexpressing SNORD32A in cells through ICAM2. The specific steps are as follows:

[0164] First, the SNORD32A product was amplified according to the PCR program shown in Table 7, and then the PCR product was subjected to agarose gel electrophoresis and finally UV development.

[0165] Table 7 Detection PCR program

[0166]

[0167] The results are as follows Figure 4 As shown, this molecular tool vector can highly express SNORD32A in 293T cells.

[0168] 3. Based on the molecular tool vector obtained in Example 2, PCR technology was used to detect the overexpression of various other snoRNA and GFP random gene fragments. The specific steps are as follows:

[0169] First, SNORD15A, SNORD118, and Dsred products were amplified according to the PCR program shown in Table 8. These PCR products were then subjected to agarose gel electrophoresis and finally developed by UV.

[0170] Table 8 Detection PCR program

[0171]

[0172] The results are as follows Figure 5As shown, the backbone plasmid can not only specifically and highly express SNORNA sequences other than SNORD32A, SNOD15A, and SNORD118, but also can specifically and highly express some small DNA sequences similar to Dsred.

[0173] 4. Based on the molecular tool vector obtained in Example 2, the actual effect of the molecular tool vector on high expression of SNORD32A in endothelial cells and cardiomyocytes was investigated. The specific steps were as follows:

[0174] The constructed PscAAV-ICAM2-GFP first recombinant plasmid was packaged using adeno-associated virus packaging reagent The virus was packaged into 293T cells, and the viral supernatant was collected. Finally, the viral supernatant was used to infect endothelial cells and cardiomyocytes. After 72 hours of infection, the cells were observed for fluorescence using a fluorescence microscope and photographed.

[0175] The results are as follows Figure 6 shown.

[0176] 5. Based on the molecular tool vector obtained in Example 2, the actual effect of the molecular tool vector on expressing SNORD32A in endothelial cells was investigated. The specific steps were as follows:

[0177] First, the SNORD32A product was amplified according to the following PCR procedure, and then the PCR product was subjected to agarose gel electrophoresis and finally UV development.

[0178] Table 9 Detection PCR program

[0179]

[0180]

[0181] The results are as follows Figure 7 As shown, this molecular tool vector can specifically overexpress SNORD32A in endothelial cells, but cannot specifically overexpress SNORD32A in cardiomyocytes.

[0182] In summary, the molecular tool vector expression system provided in the embodiments of the present application uses an endothelial-specific promoter derived from the ICAM2 gene to replace the traditional U6 or CMV promoter, which can specifically promote the expression of snoRNA. In addition, the backbone sequence designed from the intron 2 region of A in the mouse rpl13a gene can promote the presence of multiple splicing sites in the backbone sequence, thereby achieving accurate and efficient stable overexpression of short-chain non-coding RNAs including snoRNA.

[0183] In addition, a molecular tool vector expression system provided in an embodiment of the present application replaces the traditional CMV promoter with the endothelial-specific promoter ICAM2 through molecular biological means. From the effect of the detected promoter ICAM2 specifically promoting GFP protein expression, it can be seen that it essentially solves the problem of low expression efficiency of short-chain non-coding RNA including snoRNA in endothelial cells; secondly, in the animal cell experimental results, adeno-associated virus containing the molecular tool vector expression system is used to simultaneously infect human umbilical vein endothelial cells and cardiomyocytes, and the PCR test results show that the molecular tool vector can specifically and efficiently express SNORD32A in endothelial cells, which shows that the molecular tool vector expression system can efficiently and accurately overexpress SNORD32A, and has the infection efficiency of the molecular tool vector of the molecular tool vector expression system.

[0184] In addition, the embodiments of the present application provide a molecular tool vector expression system, which can be integrated into various types of expression vectors, for example, it can be applied to various expression systems such as ordinary eukaryotic expression, lentiviral expression, adenoviral expression, retroviral expression, and prokaryotic expression.

[0185] In addition, a molecular tool vector provided in an embodiment of the present application, by adding natural splicing site sequences on both sides of the snoRNA fragment, can achieve the advantage of strong selectivity of the molecular tool vector without introducing additional nucleic acid base sequences, and can ensure the accurate expression of short-chain non-coding RNA including snoRNA.

[0186] In addition, the present invention provides a molecular tool vector, which is particularly suitable for the expression of various endothelial-specific regulated snoRNAs, and can also be used for the expression of short-chain non-coding RNAs including snoRNAs and DNA sequences, and has the advantages of high expression efficiency and stability.

[0187] In addition, the preparation method of a molecular tool vector provided in the embodiment of the present application can simply and easily enable the molecular tool vector to express short-chain non-coding RNA including snoRNA. The overall operation is simple and easy to promote.

[0188] The foregoing is merely a list of specific embodiments of the present application, intended to enable those skilled in the art to understand or implement the present application. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present application. Therefore, the present application is not limited to the embodiments shown herein, but rather is intended to conform to the broadest scope consistent with the principles and novel features claimed herein.

Claims

1. A short chain non-coding RNA molecular tool vector expression system, characterized in that: The molecular tool vector expression system includes an endothelial-specific gene promoter sequence and a backbone sequence for expressing snoRNA, wherein the endothelial-specific gene promoter sequence is derived from the ICAM2 gene, and the backbone sequence is derived from the intron 2 region of SNORD32A in the rpl13a gene.

2. The molecular tool vector expression system according to claim 1, characterized in that The nucleotide sequence of the endothelial-specific gene promoter sequence is shown in SEQ ID NO.

1.

3. The molecular tool vector expression system according to claim 1, characterized in that The backbone sequence includes, in sequence, the upstream sequence of intron region No. 2, intron region No. 2, and the downstream sequence of intron region No. 2, wherein the upstream sequence is a sequence of a preset length upstream of the 5' end of intron region No. 2, and the downstream sequence is a sequence of the preset length from SNORD32A to the 3' end downstream of intron region No. 2; the preset length is 30 bp.

4. The molecular tool vector expression system according to claim 3, characterized in that The preset length is 30 bp.

5. The molecular tool vector expression system according to claim 4, characterized in that The nucleotide sequence of the upstream sequence is shown in SEQ ID NO.2, the nucleotide sequence of the intron 2 region is shown in SEQ ID NO.3, and the nucleotide sequence of the downstream sequence is shown in SEQ ID NO.

4.

6. The molecular tool vector expression system according to claim 1, characterized in that The nucleotide sequence of the backbone sequence is shown in SEQ ID NO.

5.

7. A molecular tool carrier, characterized in that The molecular tool vector comprises the molecular tool vector expression system according to any one of claims 1 to 6.

8. The molecular tool carrier according to claim 7, characterized in that The tool carrier includes at least one of the following: Eukaryotic expression vectors, lentiviral vectors, adenoviral vectors and retroviral vectors.

9. A method for preparing the molecular tool carrier according to claim 7 or 8, characterized in that: The method comprises: Using the HUVEC cell genome as a template and the first amplification primer set for PCR amplification, followed by purification, to obtain the ICAM2 fragment; The ICAM2 fragment and the adeno-associated virus vector with a CMV promoter are subjected to a first double enzyme digestion, followed by purification and T4 ligase ligation to obtain a first recombinant plasmid; Using the B16 cell genome as a template and using the second amplification primer set for PCR amplification, followed by purification, to obtain DNA sequences of short non-coding RNAs including overexpressed snoRNAs; Performing a second double enzyme digestion on the DNA sequence of the short non-coding RNA including the overexpressed snoRNA and the first recombinant plasmid, followed by purification and T4 ligase ligation to obtain a second recombinant plasmid; Using homologous recombination technology, the SNORD15A, SNORD118 and Dsred sequences were respectively inserted into the second recombinant plasmid, and then sequenced and screened to obtain a molecular tool vector; Wherein, the first amplification primer set has a first enzyme cleavage site set, and the first enzyme cleavage site set is the same as the enzyme cleavage site of the first double enzyme digestion; The second amplification primer set has a second enzyme cleavage site set, and the second enzyme cleavage site set is the same as the enzyme cleavage site of the second double enzyme digestion; The first restriction enzyme cleavage site group and the second restriction enzyme cleavage site group are different.

10. The method according to claim 9, characterized in that The first restriction enzyme cleavage site group includes an Avr II site and a BspE I site; the second restriction enzyme cleavage site group includes an ECOR I site and an Eag I site.