Cloning of tilapia mossambica TRIM13 gene, recombinant plasmid pEGFP-TRIM13 and application thereof
By designing specific primers and selecting suitable EGFP vectors, the problems of tilapia TRIM13 gene amplification and expression were solved, efficient gene research and breeding applications were achieved, protein localization detection was simplified, and the function of TRIM13 protein was deeply understood.
Patent Information
- Application Number
- CN202510335952.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-21
- Publication Date
- 2025-09-19
AI Technical Summary
In the existing technology, the differences in the tilapia TRIM13 gene sequence lead to inappropriate primer design, and the compatibility issues between the EGFP vector and tilapia cells affect the expression and localization observation of the TRIM13 gene.
Design highly specific primers for PCR amplification, select the appropriate pEGFP-N2 vector for recombination, optimize transfection conditions, and observe the expression and localization of EGFP fusion protein using a fluorescence microscope.
The accurate amplification and stable expression of the tilapia TRIM13 gene were achieved, providing a basis for disease-resistant breeding, simplifying protein localization detection, and in-depth research on the interaction mechanism of TRIM13 protein.
Smart Images

Figure CN120665877A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the field of biotechnology, and in particular relates to a recombinant plasmid pEGFP-TRIM13 and an application thereof, that is, relates to the cloning of a tilapia TRIM13 cDNA sequence and the construction and application of an EGFP plasmid thereof. Background Art
[0002] As an important aquaculture fish, tilapia faces threats from various pathogens during its breeding process. Cloning the TRIM13 gene, one of the key genes in the tilapia immune system, will help us gain a deeper understanding of the immune signaling pathways and the molecular mechanisms of immune defense in tilapia. By studying the changes in expression of this gene during the immune response and its interactions with other immune-related molecules, we can fill the gaps in tilapia immune research and provide a theoretical basis for the development of more effective immune enhancement strategies and disease prevention and control methods. For example, in the face of bacterial or viral infections, clarifying how the TRIM13 gene initiates or regulates the immune response can help design targeted intervention measures to improve tilapia's disease resistance and reduce breeding losses caused by disease outbreaks.
[0003] EGFP has the property of autofluorescence, emitting bright green fluorescence under blue or ultraviolet light. This allows for the visual observation of gene expression and localization, facilitating the study of gene function and dynamic processes within cells. After constructing the EGFP vector, the expression of the fusion protein allows for the visual observation of the intracellular localization of the TRIM13 gene, helping to identify the specific site of its function and further revealing the gene's role in cellular physiological processes. This not only facilitates the improvement and genetic breeding of tilapia itself, but also provides a reference for gene function research and evolutionary analysis in other aquatic animals, promoting the development and progress of the entire aquaculture industry at the molecular biology level.
[0004] Gene Cloning, Expression, and Protein Purification of Enhanced Green Fluorescent Protein: The full-length cDNA sequence of EGFP was cloned by PCR, and the prokaryotic expression vector pGEX-4T-1-EGFP was constructed. The protein was expressed and purified in Escherichia coli, laying the experimental foundation for the application of EGFP to track dynamic activities such as cellular phagocytosis.
[0005] The shortcomings of the prior art are as follows:
[0006] 1. Gene sequence specificity challenge: The TRIM13 gene may have certain sequence differences between different tilapia individuals or strains. The designed primers may not be fully applicable to all situations, resulting in deviations in the amplified gene sequence or failure to amplify successfully.
[0007] 2. Vector Selection and Compatibility: Existing EGFP vectors may not be fully optimized for the tilapia TRIM13 gene, and there may be compatibility issues between the vector and tilapia cells or tissues. For example, the replication, transcription, and expression efficiency of the vector in tilapia cells may be suboptimal, affecting the expression level and stability of the EGFP fusion protein. Summary of the Invention
[0008] The technical problem to be solved by the present invention is to provide a cloning of tilapia TRIM13 cDNA sequence, the construction of recombinant plasmid pEGFP-TRIM13 and its application.
[0009] To solve the above technical problems, the present invention provides a tilapia TRIM13 gene, the cDNA sequence of which is shown in SEQ ID NO: 1.
[0010] The present invention also provides primers for specifically amplifying the tilapia TRIM13 gene, which are the following primer pairs:
[0011] TRIM13-F ATGGAGCAGCTAGAAGAGGAA
[0012] TRIM13-R CTAGTTAGTGGGTAACTTATA.
[0013] The present invention also provides PCR amplification using the above primers:
[0014] PCR amplification system (50 μL): 21 μL dd H2O, 1.0 μL each of upstream and downstream primers TRIM13-F / TRIM13-R (10 μmol / L), 25 μL 2× dNTP Mixture, 2 μL DNA template;
[0015] PCR amplification conditions: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 60 s, 35 cycles; extension at 72°C for 10 min, termination at 16°C.
[0016] The present invention also provides a recombinant plasmid pEGFP-TRIM13 (ie, a fluorescence fusion expression plasmid pEGFP-TRIM13): obtained by inserting the TRIM13 gene into a pEGFP-N2 vector.
[0017] As an improvement of the recombinant plasmid pEGFP-TRIM13 of the present invention: the primer pairs used are as follows:
[0018] TRIM13-Xho-IFTTTCTCGAGGCCACCATGGAGCAGCTAGAAGAG
[0019] TRIM13-EcoR-IRAAAGAATTCGTTAGTGGGTAACTTATA.
[0020] The present invention also provides an application of the above-mentioned recombinant plasmid pEGFP-TRIM13: the expression plasmid pEGFP-TRIM13 is transfected into human embryonic kidney HEK293T cells for subcellular localization;
[0021] Tilapia TRIM13 gene is expressed in the cytoplasm of human embryonic kidney HEK293T cells.
[0022] During the invention process, the present invention fully considered the following contents:
[0023] 1. Gene cloning: Design primers with strong specificity and appropriate annealing temperature to ensure accurate amplification of the tilapia TRIM13 gene; extract high-quality total RNA from tilapia tissue and reverse transcribe it into high-quality cDNA; use RT-PCR technology to optimize reaction conditions, such as adjusting the annealing temperature and extension time, to improve amplification efficiency and specificity.
[0024] 2. Vector construction: pEGFP-N2 was selected as the vector, and it was ensured to have XHO-I and ECOR-I multiple cloning sites, promoters, terminators and other elements to facilitate the insertion and expression of the tilapia TRIM13 gene; when performing enzyme digestion at 37°C and ligation at 4°C overnight, it was ensured that the enzyme digestion was complete to improve the ligation efficiency; the constructed recombinant vector needed to be strictly identified, such as by enzyme digestion identification ( Figure 2 ), PCR identification and sequencing analysis to ensure that the TRIM13 gene was correctly inserted into the pEGFP-N2 vector and the sequence was correct.
[0025] 3. Cell transfection and expression detection: Select appropriate cell lines or primary cells for transfection, optimize transfection conditions, and improve transfection efficiency; use appropriate detection methods (such as fluorescence microscopy) to detect the expression of EGFP fusion protein and determine the expression level and location of the target gene in the cell.
[0026] The present invention has the following beneficial effects:
[0027] 1) Great potential for disease-resistant breeding: Through in-depth research on the function of the TRIM13 gene and the application of the EGFP vector, tilapia individuals with excellent immune traits can be screened, providing genetic resources and theoretical basis for disease-resistant breeding of tilapia, and cultivating new tilapia varieties with strong disease resistance.
[0028] 2) Convenient protein localization: After the EGFP gene is fused with the TRIM13 gene, the expressed fusion protein has green fluorescence. Its distribution in the cell can be directly observed under a fluorescence microscope. The subcellular localization of the TRIM13 protein, such as its specific location in the nucleus, cytoplasm or organelles, can be quickly determined without the need for complex protein localization detection methods.
[0029] 3) Study the interaction mechanism: By observing the dynamic process of the interaction between EGFP fusion protein and other proteins, such as the time, location and method of interaction, we can further study the interaction mechanism between TRIM13 protein and other proteins, as well as the role of this interaction in cellular physiological activities.
[0030] The conclusions obtained by the present invention are as follows:
[0031] 1. Amplification results of the CDS region of the tilapia TRIM13 gene
[0032] The present invention adopts RT-PCR technology to amplify the CDS region of tilapia TRIM13 gene, and the size of the amplified product is consistent with the expected result.
[0033] 2. Double enzyme digestion identification of recombinant plasmid pEGFP-TRIM13
[0034] After double digestion of the recombinant plasmid pEGFP-TRIM13 with Xho-I and EcoR-Ⅰ, the TRIM13 gene was ligated into the pEGFP-N2 plasmid. Sequencing of positive clones showed that the TRIM13 gene ligated into the pEGFP-N2 vector was consistent with the sequence obtained, indicating that the recombinant plasmid pEGFP-TRIM13 was successfully constructed.
[0035] 3. Subcellular localization of TRIM13
[0036] The expression and localization results of TRIM13 protein in cells in vitro showed that the green fluorescence of the control pEGFP-N2 transfected cells was evenly distributed throughout the cells, while the green fluorescence of pEGFP-TRIM13 was mainly distributed in the cytoplasm of HEK293T cells, occasionally aggregated into round dots.
[0037] It needs further explanation:
[0038] TRIM family proteins play an important role in immune responses. Cloning the tilapia TRIM13 gene and constructing an EGFP vector can provide in-depth research on its immune regulatory mechanisms in tilapia's resistance to pathogen infection, such as recognition of pathogens such as viruses and bacteria, signal transduction, and activation of immune cells.
[0039] Sequence analysis of the cloned tilapia TRIM13 gene and comparison with homologous genes in other species can help us understand the conservation and variability of this gene during evolution, and reveal the status and evolutionary process of tilapia in biological evolution.
[0040] The constructed EGFP vector can be used to study the transcriptional regulatory elements of the TRIM13 gene. By analyzing the mutation or deletion of different regulatory elements on the vector, the key cis-acting elements and trans-acting factors affecting TRIM13 gene expression can be identified, and the molecular mechanism of gene expression regulation can be elucidated. BRIEF DESCRIPTION OF THE DRAWINGS
[0041] The specific embodiments of the present invention are further described in detail below with reference to the accompanying drawings.
[0042] Figure 1 The expression of TRIM13 gene and β-actin gene in various tissues; lanes 1-8 represent skin, muscle, heart, liver, intestine, swim bladder, gill, and kidney, respectively.
[0043] Figure 2 It is a double enzyme digestion product (M is 2kbDNAMarker, 1 is the recombinant plasmid pEGFP-TRIM13).
[0044] Figure 3 Subcellular localization of TRIM13 in HEK293T cells (200×);
[0045] Figure 3 Middle: EGFP corresponds to enhanced green fluorescent protein; DAPI corresponds to a blue fluorescent dye that can penetrate the cell membrane; Merge shows the superposition effect of the above two images. DETAILED DESCRIPTION
[0046] The present invention is further described below with reference to specific embodiments, but the protection scope of the present invention is not limited thereto:
[0047] 1. Experimental Materials
[0048] Tilapia were purchased from a farmers' market in Hangzhou, China. The holding tank temperature was maintained at 28 ± 1°C. After one week of rearing, the liver, intestine, muscle, skin, swim bladder, gills, and kidneys were dissected and immediately treated with liquid nitrogen before storage at −80°C. 2× Taq PCR Mix, PrimeScript™ IV 1st strand cDNA Synthesis Mix, reverse transcription kit, restriction enzymes, DNA marker, RNAiso Plus, pMD 20, and T4 ligase were purchased from Takara. DNA purification and recovery kits and plasmid miniprep kits were purchased from OMEGA. STBL3 competent cells, pEGFP-N2 vector, and HEK293T cell lines were maintained in our laboratory. DMEM high-glucose medium, phosphate-buffered saline (PBS), and fetal bovine serum were purchased from Gibco. Trypsin was purchased from Shanghai Jitai Biotechnology Co., Ltd. Lipofectamine 2000 was purchased from Invitrogen.
[0049] 2. RNA Extraction and cDNA Synthesis
[0050] Total RNA was extracted from various tilapia tissues (including liver) using RNAiso Plus reagent according to the manufacturer's instructions. Reverse transcription was performed using 1 μg of total RNA. cDNA was obtained using the PrimeScript™ kit and stored at -20°C until use.
[0051] 3. Cloning the full-length CDS of tilapia TRIM13
[0052] Based on the NCBI sequence of tilapia TRIM13 (SEQ ID NO: XM_003451555.5), Prime 5.0 software was used to design primers, taking into account primer specificity and GC content. A primer pair, TRIM13-F / TRIM13-R, was obtained (Table 1). The full-length TRIM13 CDS region was amplified using cDNA obtained by reverse transcription from tilapia liver. The PCR amplification system (50 μL) consisted of 21 μL ddH₂O, 1.0 μL each of the upstream and downstream primers TRIM13-F / TRIM13-R (10 μmol / L), 25 μL 2× dNTP Mixture, and 2 μL DNA template. PCR amplification conditions included pre-denaturation at 95°C for 5 min, followed by 35 cycles of denaturation at 95°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 60 s, followed by extension at 72°C for 10 min and termination at 16°C.
[0053] The PCR product was detected and recovered by 1.2% agarose gel electrophoresis, then ligated into the pMD20-T vector and transformed into STBL3 competent cells (New England Biolabs). Positive clones were screened, and plasmids were extracted and sequenced by Shanghai Sangon Biotechnology Co., Ltd. Finally, the sequences were assembled using DNA Star software to obtain the cDNA sequence of the CDS region of the TRIM13 gene, as shown in SEQ ID NO: 1 in the sequence listing.
[0054] Table 1 Primers and primer sequences
[0055]
[0056] 4. Tilapia tissue expression profile analysis
[0057] The expression of TRIM13 gene in seven tissues of tilapia (skin, muscle, heart, liver, intestine, swim bladder, gill and kidney) was investigated by RT-PCR. β-actin was used as the internal reference gene and primers were designed based on the CDS sequence of tilapia β-actin in NCBI (Table 1).
[0058] The primers and reaction system used for PCR refer to step "3" above, with an annealing temperature of 59°C and annealing for 30 seconds.
[0059] Right now,
[0060] The PCR reaction system is as follows: 21 μL dd H2O, 1.0 μL each of upstream and downstream primers (β-actin-F / β-actin-R or TRIM13-F / TRIM13-R) (10 μmol / L), 25 μL 2× dNTP Mixture, and 2 μL DNA template;
[0061] The specific PCR amplification conditions were as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 59°C for 30 s, extension at 72°C for 60 s, 35 cycles; extension at 72°C for 10 min, and termination at 16°C.
[0062] The PCR products were then electrophoresed on a 1.2% agarose gel for analysis of the PCR results. Figure 1 As shown, the TRIM13 gene is widely expressed in adult tilapia tissues such as skin, muscle, heart, liver, intestine, swim bladder, gills, and kidney.
[0063] 5. Construction and identification of recombinant plasmid pEGFP-TRIM13
[0064] Based on the predicted sequence of the tilapia TRIM13 gene, a pair of primers, TRIM13-Xho-IF / TRIM13-EcoR-I-R (Table 1), were designed and synthesized by Sangon Biotech (Shanghai) Co., Ltd. Using the plasmid obtained in step 3 above as a template, the PCR amplification system was similar to that in step 3 above. The PCR product was then subjected to electrophoresis on a 1.2% agarose gel to recover the PCR product.
[0065] In order to determine the function of the TRIM13 gene in vitro, the gel-recovered product of the above PCR was double-digested with Xho-I and EcoR-Ⅰ with the pEGFP-N2 vector, and then the two target fragments were ligated with T4 ligase at 16°C for 2-4 hours. The ligation product was transformed into STBL 3 competent cells to construct the fluorescent fusion expression plasmid pEGFP-TRIM13. The above transformation products were plated on LB solid medium containing kanamycin (Kana, concentration of 100 mg / mL), and the transformed colonies were screened. The single colony was picked and shaken every other day, the plasmid was extracted, identified by double enzyme digestion, and sent to Shanghai Shenggong Biotechnology Co., Ltd. for sequencing identification. The results are as follows Figure 2 As shown, there is a cut band between 1000 bp and 2000 bp, indicating that the TRIM13 gene has been linked into the pEGFP-N2 plasmid.
[0066] 6. Subcellular localization of the tilapia TRIM13 gene
[0067] The successfully constructed expression plasmid pEGFP-TRIM13 was transfected into human embryonic kidney HEK293T cells for subcellular localization as follows:
[0068] HEK293T cells were cultured in DMEM (containing 10% fetal bovine serum) at 37°C and 5% CO2, with fresh culture medium replaced every 2-3 days. When the cell confluence reached approximately 90%, they were digested with 0.25% trypsin for 2-3 minutes, then digested with fresh culture medium. The cells were then diluted 1:4 (volume ratio) with DMEM (containing 10% fetal bovine serum) and mixed by repeated pipetting to create a single-cell suspension. 20 μL of the single-cell suspension was added to the center of a coverslip placed in a 6-well plate and cultured for cell growth (37°C and 5% CO2). After 24 hours of culture, HEK293T cells were transfected with the fluorescent fusion expression plasmid pEGFP-TRIM13 using Lipofectamine 2000 transfection reagent. An empty pEGFP-N2 plasmid was also transfected as a negative control. 4-6 hours after transfection, the medium was changed. 48 hours after transfection, the culture medium was discarded, the sections were fixed with formalin for 10 minutes, washed twice with PBS, and finally stained with 0.1 μg / mL fluorescent dye DAPI for 2 minutes. After discarding the sections, the sections were washed with PBS and mounted with 30% glycerol. Fluorescence images were taken with an Olymapus upright microscope.
[0069] The results are as follows Figure 3 The green fluorescence of cells transfected with pEGFP-N2 was evenly distributed throughout the cells, while the green fluorescence of pEGFP-TRIM13 was primarily distributed in the cytoplasm of HEK293T cells, occasionally clustering into circular puncta. Based on 3, the following conclusions can be drawn: the tilapia TRIM13 gene is expressed in the cytoplasm of human embryonic kidney HEK293T cells.
[0070] Description: Because the vector EGFP-N2 of the present invention contains enhanced green fluorescent protein, it can achieve efficient transfection of the TRIM13 gene in human embryonic kidney HEK293T cells via microinjection. Its fluorescent labeling properties can track the expression and localization of the TRIM13 protein in real time. Therefore, when tilapia resists pathogen infection, TRIM13, as an E3 ubiquitin ligase, can specifically recognize pathogen-associated molecular patterns (PAMPs). Through K63 ubiquitination modification, it activates the MAVS / STING signaling pathway, inducing the expression of type I interferons and pro-inflammatory cytokines, thereby achieving recognition of pathogens such as viruses and bacteria, signal transduction, and activation of immune cells.
[0071] The present invention has used the following primers in the invention process:
[0072] Primer pair 1:
[0073] TRIM13-F:ATGGAGCAGCTAGAAGAGGAACT
[0074] TRIM13-R:CTAGTTAGTGGGTAACTTATAAC
[0075] The final result is: specific amplification cannot be achieved.
[0076] Primer pair 2:
[0077] β-actin-F:ATGGAAGATGAAATCGCCGCACTG
[0078] β-actin-R:TTAGAAGCATTTGCGGTGGACGA
[0079] The final result is: specific amplification cannot be achieved.
[0080] Finally, it should be noted that the above examples are merely specific embodiments of the present invention. Obviously, the present invention is not limited to the above examples and is subject to numerous variations. All variations that can be directly derived or conceived by a person of ordinary skill in the art from the disclosure of the present invention are considered to be within the scope of protection of the present invention.
Claims
1. Tilapia TRIM13 gene, characterized by: The cDNA sequence of the TRIM13 gene is shown in SEQ ID NO:
1.
2. Primers for specific amplification of the tilapia TRIM13 gene, characterized in that The primer pairs are as follows: TRIM13-F ATGGAGCAGCTAGAAGAGGAA TRIM13-R CTAGTTAGTGGGTAACTTATA.
3. PCR amplification performed using the primers according to claim 2, characterized in that: PCR amplification system: 21 μL dd H2O, 1.0 μL each of 10 μmol / L upstream and downstream primers TRIM13-F / TRIM13-R, 25 μL 2× dNTP Mixture, and 2 μL DNA template; PCR amplification conditions: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 60 s, 35 cycles; extension at 72°C for 10 min, termination at 16°C.
4. A recombinant plasmid pEGFP-TRIM13, characterized by: The TRIM13 gene was inserted into the pEGFP-N2 vector.
5. The recombinant plasmid pEGFP-TRIM13 according to claim 4, characterized in that: The primer pairs used are as follows: TRIM13-Xho-IFTTTCTCGAGGCCACCATGGAGCAGCTAGAAGAG TRIM13-EcoR-IRAAAGAATTCGTTAGTGGGTAACTTATA.
6. Application of the recombinant plasmid pEGFP-TRIM13, characterized by: The expression plasmid pEGFP-TRIM13 was transfected into human embryonic kidney HEK293T cells for subcellular localization; Tilapia TRIM13 gene is expressed in the cytoplasm of human embryonic kidney HEK293T cells.