Vitis amurensis VaERF022 gene and application thereof in cold resistance of plants

By overexpressing the VaERF022 gene of Vitis amurensis in grape leaves and activating the expression of antioxidant enzymes, the problem of insufficient resistance of grapes to low temperature stress was solved, the efficient cold resistance of grape plants was enhanced, and genetic resources and breeding basis were provided.

CN120665884APending Publication Date: 2025-09-19SHENYANG AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510674224.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-23
Publication Date
2025-09-19

AI Technical Summary

Technical Problem

Existing technologies make it difficult to effectively improve grapes' resistance to low temperature stress. Traditional cold-proof methods are time-consuming, labor-intensive, and have an impact on the ecological environment. Research on ERF transcription factors in grapes is not comprehensive enough, and there is a lack of effective cold-resistant gene resources.

Method used

By overexpressing the Vitis amurensis VaERF022 gene in grape leaves, a recombinant vector was constructed and transformed into grape plants to activate the expression of antioxidant enzymes to enhance antioxidant capacity and reduce the damage to plants caused by low temperature stress.

Benefits of technology

It significantly enhanced the antioxidant capacity of grape plants, reduced the degree of waterlogging and necrosis under low temperature stress, and improved resistance to low temperatures, providing new genetic resources and theoretical basis for grape cold-resistant breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120665884A_ABST
    Figure CN120665884A_ABST
Patent Text Reader

Abstract

The invention discloses a vitis amurensis VaERF022 gene and application of the vitis amurensis VaERF022 gene in plant cold resistance, the vitis amurensis VaERF022 gene is a transcription factor separated and cloned from extremely cold-resistant vitis amurensis in northeast China, and the sequence is shown as SEQ ID NO.1; 1, and the amino acid sequence coded by the VaERF062 gene is as shown in SEQ ID NO. 2. Through gene expression analysis, it is found that the VaERF062 is very remarkable in low-temperature induced expression effect, and it is proved that the VaERF022 can remarkably enhance the cold resistance of grape leaves through a cold resistance phenotype identification method. The VaERF022 gene provided by the invention can provide improved technical support for the existing grape strain with weaker cold resistance so as to reduce the invasion of cold damage to grape plants; meanwhile, the gene also has important guiding significance for cultivating new varieties of high-quality cold-resistant grapes.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the fields of genetic engineering and biotechnology, and particularly relates to a Vitis amurensis VaERF022 gene and application thereof in plant cold resistance. Background Art

[0002] Grapes, grapes for juice, and other four major categories of grapes have brought lucrative profits to grape growers worldwide. However, in temperate regions where they are most widely distributed and have the greatest variety, large numbers of cultivated grapes are often subjected to high-latitude cold air during winter dormancy or early spring budding. Low-temperature stressors such as chilling, freezing, and frost often cause irreversible damage to grape plants. Low temperatures disrupt the integrity of the cell membrane system, leading to structural and functional changes in organelles such as mitochondria and endoplasmic reticulum; inhibit the activity of various enzymes and reduce metabolic activity; increase cell membrane permeability, causing intracellular substances such as tannins, starch crystals, and phenolics to leak out of the cell; disrupt the balance between the production and removal of reactive oxygen species within the cell, leading to excessive accumulation of reactive oxygen species, causing peroxidation of cell membrane lipids, the production of harmful substances such as malondialdehyde, and thus damaging cell membrane structure and function; and freezing key organs such as the root system, root neck, cambium, inflorescence, and leaves. When low temperature stress is severe, it can cause the grape plants in the entire vineyard to become weak, greatly affecting the fruit yield and economic benefits of the vineyard.

[0003] Traditional cold-proofing techniques, such as burying plants in the ground, spraying water, fumigating plants, and blowing air, are not only time-consuming and labor-intensive, consuming resources and energy, but also have a certain impact on the orchard's ecological environment. In recent years, with advances in molecular biology research, the regulatory role of plant-specific transcription factors in cold stress has gradually become a hot topic of research. By introducing cold-resistance transcription factors into grape plants or overexpressing the transcription factor genes in the plants, they can regulate the expression of grape-related genes, activate relevant cold-resistance pathways, and thus improve the grape plant's tolerance to cold stress. This method is not only labor-saving, safe, and environmentally friendly, but also provides a more effective new approach for genetic improvement of grapes and the breeding of new cold-resistant varieties. Therefore, discovering and utilizing effective cold-resistance transcription factors is a more effective and modern means and approach to improving grape cold resistance.

[0004] Vitis amurensis is an important wild grape germplasm resource in my country, widely distributed in the mountainous regions of Northeast China. Its branches and buds can withstand temperatures as low as -40°C to -50°C, and its roots, compared to other cultivated grape varieties, can withstand temperatures as low as -15°C to -16°C, allowing Vitis amurensis to grow normally and overwinter in the cold regions of Northeast China. The ERF transcription factor family is unique to plants and plays a crucial role in regulating plant responses to abiotic and biotic stresses. During abiotic stresses (such as cold stress), ERF transcription factors can enhance reactive oxygen species (ROS) scavenging systems to remove excess ROS produced by plant cells under adverse conditions, thereby alleviating oxidative damage caused by cold stress. They can also enhance plant resistance by regulating osmotic regulation and interacting with other transcription factors. In recent years, the regulatory mechanisms of ERF transcription factors in plant responses to cold stress have attracted increasing attention. However, research on the functions of ERF transcription factor genes in Vitis amurensis plants with excellent cold-resistance traits is still incomplete and incomplete. The mechanism of ERF transcription factor gene family members in coordinating the cold resistance of Vitis amurensis plants needs to be further supplemented and improved so that it can be better applied to actual production and provide more powerful scientific and theoretical support for the breeding of high-quality cold-resistant grape varieties. Summary of the Invention

[0005] The present invention aims to provide a Vitis amurensis VaERF022 gene and its application in plant cold resistance. By overexpressing the transcription factor VaERF022 in grape leaves, the relationship between the VaERF022 gene and grape cold resistance is identified, and the role of the gene in enhancing plant cold resistance can be clarified. This provides a new application for improving plant cold resistance using the cold-resistant gene VaERF022, and also provides a new method for plant cold-resistant breeding.

[0006] The objective of the present invention is achieved through the following technical solution: a Vitis amurensis VaERF022 gene, the nucleotide sequence of the VaERF022 gene is shown in SEQ ID NO.1.

[0007] Furthermore, the amino acid sequence of the protein encoded by VaERF022 is shown in SEQ ID NO.2.

[0008] Furthermore, the primers for amplifying the CDS sequence of the VaERF022 gene of Vitis amurensis are as follows:

[0009] Primer F: 5'-GAGCTCGGTACCCGGGGATCCATGGAACTCTATTTCCAGAATCACC-3' (SEQ ID NO. 3);

[0010] Primer R: 5'-CTTGCTCACCATGGTGTCGACACCTGTGCAGAACAGCTGACACA-3' (SEQ ID NO. 4).

[0011] A recombinant vector containing the Vitis amurensis VaERF022 gene, a recombinant expression vector or a gene recombination plasmid containing the gene VaERF022, the recombinant vector is an Agrobacterium overexpression transformation vector or a silencing vector, and the recombinant vector is a gene overexpression vector.

[0012] A method for constructing a VaERF022 gene overexpression transformation vector, specifically comprising:

[0013] Specific primers with restriction enzyme sites were designed to amplify the CDS sequence of the coding region of the VaERF022 gene. The VaERF022 gene was integrated into the overexpression vector pCAMBIA2300-GFP by homologous recombination. The "double-excellent" cDNA was used as a template for amplification. The amplification system and amplification procedure were referred to the ClonExpress one-step cloning instruction manual of Nanjing Novozymes Company. The plasmid was transformed into GV3101 Agrobacterium by the heat shock method. The primer sequences are shown in SEQ ID NO.3 and SEQ ID NO.4.

[0014] A method for constructing a VaERF022 gene silencing vector, specifically comprising:

[0015] An RNAi vector was constructed using the 813-bp VaERF022 CDS sequence. Using the "Double-Excellent" cDNA as a template, primers constructed using the RNAi vector were used to amplify the forward and reverse fragments. The VaERF022 gene was integrated into the silencing vector VaERF022-RNAi using homologous recombination. The recombinant vector was transformed into Agrobacterium tumefaciens GV3101, using the same transformation methods as for overexpression vectors. The culture medium from positive colonies was then added to 50% glycerol and stored at -80°C until use. The primer sequences are shown in SEQ ID NOs. 3 and 4.

[0016] Application of a Vitis amurensis VaERF022 gene in enhancing the cold resistance of grape plants.

[0017] Furthermore, the gene VaERF022 or the protein encoded by VaERF022 exerts its biological function under low temperature conditions, helps to activate the expression of antioxidant enzymes and can effectively remove high concentrations of reactive oxygen species, thereby improving the antioxidant capacity of grape plants under cold damage.

[0018] A method for cultivating grape plants to enhance resistance to low temperature stress and improve cold resistance of grapes, which is achieved by increasing the expression level of the cold resistance gene VaERF022 in the plant;

[0019] The grape plant cultivation method is specifically carried out according to the following steps:

[0020] constructing an Agrobacterium recombinant overexpression vector containing the gene VaERF022;

[0021] The recombinant overexpression vector containing the VaERF022 gene was transformed into competent cells, cultured, and inoculated onto 'seedless white' grape plants to obtain a high-quality grape strain with strong cold resistance; the details are as follows:

[0022] The overexpression vector containing the gene VaERF022 was transformed into Agrobacterium GV3101 competent cells, and a transgenic Agrobacterium strain was obtained after culture. The strain was propagated in a constant temperature shaker at 28°C and then transformed into leaves of the non-cold-resistant European grape variety "Seedless White" by vacuum infiltration to obtain transgenic grape leaves resistant to low temperature stress.

[0023] A quantitative analysis method for the expression level of the cold-resistant gene VaERF022 in plants based on the qRT-PCR principle is used to measure the expression level of the VaERF022 gene in the leaves of plants under low temperature stress. The specific steps are as follows:

[0024] qRT-PCR analysis was performed using SYBR-qPCR-Mix-kit (GenStar) and gene-specific primers. The 20 μL reaction system included: 10 μL 5× qPCR Mix, 0.4 μL each of upstream and downstream primers, 2 μL cDNA template (diluted 6 times), and 7.2 μL ddH O;

[0025] The primer sequences are as follows:

[0026] q-ERF022-F:

[0027] ATTTGATCCCTCCTGGGTATTT;

[0028] q-ERF022-R:

[0029] AGCCCGAATTCCGTCATATC.

[0030] q-Actin1-F:

[0031] CAAGAGCGGAAACTGCAAAGA;

[0032] q-Actin1-R:

[0033] AATGAGAGATGGCTGGAAGAGG.

[0034] qRT-PCR reaction conditions were: 95°C pre-denaturation for 2 min; 40 cycles of 95°C denaturation for 5 s, 60°C for 30 s (annealing); melting curves were collected using the default program. The internal reference gene was SlEF1ɑ (Solyc06g005060.3.1). Each reaction was performed in triplicate.

[0035] The relative expression levels of genes were calculated using the 2-ΔΔCt method, and the t-test was used to analyze the significance of the differences in gene expression levels.

[0036] Compared with the prior art, the present invention has the following beneficial effects:

[0037] This paper proposes, for the first time, a single-nucleotide polymorphism (SNP) molecular marker suitable for identifying cold-resistance traits in grapes. This marker, derived from the grape VvCML gene, addresses shortcomings in existing technologies and provides an accurate, efficient, and low-cost method for identifying cold-resistance traits in grapes, with potential application in large-scale cold-resistance-related grape breeding.

[0038] The present invention discloses a gene, VaERF022, and its application in regulating grape resistance to cold stress. The gene's expression pattern after low-temperature treatment in different plant species was analyzed. The role of the VaERF022 gene in regulating grape resistance to cold stress was verified using transient gene overexpression and gene silencing. The results showed that, compared with wild-type and VaERF022-silenced leaves, grape leaves overexpressing the VaERF022 gene showed significantly increased endogenous antioxidant enzyme activity and enhanced antioxidant capacity. Furthermore, the degree of waterlogging and necrosis in leaves after freezing damage was reduced, enhancing the plant's ability to resist cold stress. This indicates that the gene can regulate grape leaf resistance to cold stress, providing a positive guiding role in the cultivation of high-quality, cold-resistant grape varieties. The gene also helps clarify the role of the Vitis amurensis transcription factor, VaERF022, in regulating grape resistance to cold stress from a molecular perspective, providing a theoretical basis and gene resources for molecular breeding of cold-resistant grapes.

[0039] The cloning and isolation of the gene CtrRAV2 of the present invention provides a new genetic resource for plant stress resistance molecular design and breeding, and provides a new genetic resource for the implementation of green agriculture and water-saving agriculture. The development and utilization of this genetic resource is conducive to reducing agricultural production costs and achieving environmental friendliness. For some cultivated grape varieties that are extremely susceptible to low temperature invasion during cultivation and production, high-quality cold-resistant grape varieties can be cultivated by overexpressing the transcription factor VaERF022 gene or homologous recombination genes.

[0040] The present invention screened a novel grape cold-resistance regulatory gene, VaERF022, and disclosed its application in regulating grape resistance to low-temperature stress. Experimental results showed that the gene could significantly respond to low-temperature induction when the plant was subjected to low-temperature stress. Compared with the wild-type and VaERF022-silenced leaves, grape leaves overexpressing the VaERF022 gene had significantly enhanced antioxidant capacity. At the same time, the degree of waterlogging and necrosis of the plant leaves after freezing was reduced, thereby enhancing the plant's ability to resist low-temperature stress. This indicates that the gene can regulate the resistance of grape leaves to low-temperature stress. Therefore, the acquisition of this gene can provide a certain theoretical basis for understanding the cold-resistance mechanism of grapes.

[0041] The grape cold-resistance regulatory gene VaERF022 provided by the present invention can improve the low-temperature tolerance of plants, enabling them to maintain healthy growth in low-temperature environments. The acquisition of this gene can, on the one hand, provide a reference gene for the use of molecular markers to assist in grape cold-resistance breeding, and on the other hand, enrich the gene selection of plants such as grapes in the field of cold-resistance transgenic breeding, laying the foundation for molecular breeding of grape cold resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] Figure 1 This is a diagram showing the low temperature response analysis of the ERF022 gene in 'Shuangyou' and 'Wuhebai';

[0043] Figure 2 This is the electrophoresis diagram of the cloned VaERF022 gene of Vitis amurensis of the present invention;

[0044] Figure 3 This is a diagram of the transcriptional activation activity analysis of the VaERF022 gene;

[0045] Figure 4 Schematic diagram of the subcellular localization of the VaERF022 gene;

[0046] Figure 5 is the relative expression level of VaERF022 gene after low temperature treatment;

[0047] Figure 6 In order to utilize the LTE low-temperature thermal effect of plants, the cold resistance peak of leaves was detected and recorded by differential thermal analysis using a portable plant cold resistance tester;

[0048] Figure 7 The Fv / Fm fluorescence images and values ​​of leaves of wild type, VaERF022 gene overexpression group and VaERF022 gene silencing group after low temperature treatment;

[0049] Figure 8 This is the REL analysis of the electrical conductivity of the leaves after low temperature treatment;

[0050] Figure 9The activities of POD, SOD and CAT in leaves of wild type, VaERF022 gene overexpression group and VaERF022 gene silencing group after low temperature treatment were detected.

[0051] Figure 10 DAB and NBT staining of leaves of the wild type, VaERF022 gene overexpression group and VaERF022 gene silencing group after low temperature treatment. DETAILED DESCRIPTION

[0052] The present invention is further described below by combining specific experimental methods, and the advantages and features of the present invention are better revealed through detailed descriptions. It is particularly noted that the specific experimental methods involved in the following examples, unless otherwise specified, are conventional experimental methods or are carried out according to the conditions recommended in the manufacturer's instructions.

[0053] Unless otherwise specified, the techniques used in the experiments are conventional methods well known to those skilled in the art. The experimental methods described are all conventional methods unless otherwise specified. Unless otherwise specified, the reagents and materials used in the experiments can be purchased commercially. [Materials and Methods]

[0054] Unless otherwise defined, all professional and scientific terms used below have the same meaning as those familiar to those skilled in the art. In addition, any methods and materials similar or similar to those described below can be applied to the present invention.

[0055] The test materials are for demonstration purposes only.

[0056] Unless otherwise indicated, the present invention will be practiced using techniques familiar to those skilled in the art in botany, microbiology, plant tissue culture, molecular biology, biochemistry, DNA recombination, transformation, and bioinformatics. The relevant techniques are fully explained in the references cited.

[0057] like Figure 1-10 As shown, a Vitis amurensis VaERF022 gene, the nucleotide sequence of the VaERF022 gene is shown as SEQ ID NO.1.

[0058] Furthermore, the amino acid sequence of the protein encoded by VaERF022 is shown in SEQ ID NO.2.

[0059] Furthermore, the primers for amplifying the CDS sequence of the VaERF022 gene of Vitis amurensis are as follows:

[0060] Primer F: 5'-GAGCTCGGTACCCGGGGATCCATGGAACTCTATTTCCAGAATCACC-3' (SE QIDNO.3);

[0061] Primer R: 5'-CTTGCTCACCATGGTGTCGACACCTGTGCAGAACAGCTGACACA-3' (SEQ ID NO. 4).

[0062] A recombinant vector containing the Vitis amurensis VaERF022 gene, a recombinant expression vector or a gene recombination plasmid containing the gene VaERF022, the recombinant vector is an Agrobacterium overexpression transformation vector or a silencing vector, and the recombinant vector is a gene overexpression vector.

[0063] A method for constructing a VaERF022 gene overexpression transformation vector, specifically comprising:

[0064] Specific primers with restriction enzyme sites were designed to amplify the CDS sequence of the coding region of the VaERF022 gene. The VaERF022 gene was integrated into the overexpression vector pCAMBIA2300-GFP by homologous recombination. The "double-excellent" cDNA was used as a template for amplification. The amplification system and amplification procedure were referred to the ClonExpress one-step cloning instruction manual of Nanjing Novozymes Company. The plasmid was transformed into GV3101 Agrobacterium by the heat shock method. The primer sequences are shown in SEQ ID NO.3 and SEQ ID NO.4.

[0065] A method for constructing a VaERF022 gene silencing vector, specifically comprising:

[0066] An RNAi vector was constructed using the 813-bp VaERF022 CDS sequence. Using the "Double-Excellent" cDNA as a template, primers constructed using the RNAi vector were used to amplify the forward and reverse fragments. The VaERF022 gene was integrated into the silencing vector VaERF022-RNAi using homologous recombination. The recombinant vector was transformed into Agrobacterium tumefaciens GV3101, using the same transformation methods as for overexpression vectors. The culture medium from positive colonies was then added to 50% glycerol and stored at -80°C until use. The primer sequences are shown in SEQ ID NOs. 3 and 4.

[0067] Application of a Vitis amurensis VaERF022 gene in enhancing the cold resistance of grape plants.

[0068] Furthermore, the gene VaERF022 or the protein encoded by VaERF022 exerts its biological function under low temperature conditions, helps to activate the expression of antioxidant enzymes and can effectively remove high concentrations of reactive oxygen species, thereby improving the antioxidant capacity of grape plants under cold damage.

[0069] A method for cultivating grape plants to enhance resistance to low temperature stress and improve cold resistance of grapes, which is achieved by increasing the expression level of the cold resistance gene VaERF022 in the plant;

[0070] The grape plant cultivation method is specifically carried out according to the following steps:

[0071] constructing an Agrobacterium recombinant overexpression vector containing the gene VaERF022;

[0072] The recombinant overexpression vector containing the VaERF022 gene was transformed into competent cells, cultured, and inoculated onto 'seedless white' grape plants to obtain a high-quality grape strain with strong cold resistance; the details are as follows:

[0073] The overexpression vector containing the gene VaERF022 was transformed into Agrobacterium GV3101 competent cells, and a transgenic Agrobacterium strain was obtained after culture. The strain was propagated in a constant temperature shaker at 28°C and then transformed into leaves of the non-cold-resistant European grape variety "Seedless White" by vacuum infiltration to obtain transgenic grape leaves resistant to low temperature stress.

[0074] A quantitative analysis method for the expression level of the cold-resistant gene VaERF022 in plants based on the qRT-PCR principle is used to measure the expression level of the VaERF022 gene in the leaves of plants under low temperature stress. The specific steps are as follows:

[0075] qRT-PCR analysis was performed using SYBR-qPCR-Mix-kit (GenStar) and gene-specific primers. The 20 μL reaction system included: 10 μL 5× qPCR Mix, 0.4 μL each of upstream and downstream primers, 2 μL cDNA template (diluted 6 times), and 7.2 μL ddH O;

[0076] The primer sequences are as follows:

[0077] q-ERF022-F:

[0078] ATTTGATCCCTCCTGGGTATTT;

[0079] q-ERF022-R:

[0080] AGCCCGAATTCCGTCATATC.

[0081] q-Actin1-F:

[0082] CAAGAGCGGAAACTGCAAAGA;

[0083] q-Actin1-R:

[0084] AATGAGAGATGGCTGGAAGAGG.

[0085] qRT-PCR reaction conditions were: 95°C pre-denaturation for 2 min; 40 cycles of 95°C denaturation for 5 s, 60°C for 30 s (annealing); melting curves were collected using the default program. The internal reference gene was SlEF1ɑ (Solyc06g005060.3.1). Each reaction was performed in triplicate.

[0086] The relative expression levels of genes were calculated using the 2-ΔΔCt method, and the t-test was used to analyze the significance of the differences in gene expression levels.

[0087] As used herein, the terms "nucleic acid," "nucleic acid sequence," "nucleotide," "nucleic acid molecule," or "polynucleotide" are intended to include isolated DNA molecules (e.g., cDNA or genomic DNA), RNA molecules (e.g., messenger RNA), including natural and mutant forms, synthetic DNA or RNA molecules, DNA or RNA molecules composed of nucleotide analogs, and single-stranded or double-stranded structures, including the VaERF022 gene. "Gene" or "gene sequence" refers to a DNA nucleic acid sequence that can be translated into a protein and perform a related biological function.

[0088] A "gene expression vector" is a cloning vector with expanded and optimized functionality. The primary function of a cloning vector is to carry exogenous genes, allowing them to stably exist and replicate in host cells after being transformed. Gene expression vectors, on this basis, add key expression elements such as promoters, RBS (ribosome binding sites), and terminators, enabling the inserted target gene to be effectively transcribed and translated in the host cell, thereby producing the corresponding protein product and achieving gene expression.

[0089] "Agrobacterium transformation" refers to the insertion of the target gene into the T-DNA region of the Ti plasmid unique to the modified Agrobacterium, using the infection of Agrobacterium to achieve the transfer and integration of exogenous genes into plant cells, and then regenerating transgenic plants through botanical techniques such as cell and tissue culture.

[0090] "qRT-PCR", the full name of which is Quantitative Reverse Transcription Polymerase Chain Reaction, is a process that reverse transcribes the nucleic acid RNA transcribed from plant cells back into cDNA using reverse transcriptase, and then uses real-time quantitative PCR technology to amplify and detect the cDNA to achieve quantitative detection of the initial RNA template and accurately determine the expression level of the target gene.

[0091] In the early stages of this study, dormant buds of the Chinese wild cold-resistant Vitis vinifera cultivar 'Shuangyou' and the non-cold-resistant Eurasian grape cultivar 'Seedless White' were subjected to low-temperature stress treatment. The gene VaERF022, which showed a highly significant differential response to low-temperature stress, was analyzed and screened. Subsequently, VaERF022 was cloned and overexpression and gene silencing vectors were constructed. Gene function was verified in the leaves of 'Seedless White'. The results showed that overexpression of VaERF022 reduced waterlogging and wrinkling in the leaves, and the mesophyll cells became more firm. The activities of the endogenous antioxidant enzymes superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT) were significantly increased. The levels of intracellular reactive oxygen species (ROS) and hydrogen peroxide (H2O2) were significantly reduced, effectively enhancing the grape plants' resistance and tolerance to low-temperature stress. The specific experiments are as follows:

[0092] Example 1: Functional verification of the VaERF022 gene's ability to respond to low temperature stress

[0093] First, to further verify that ERF022 can respond to low temperature stress, dormant buds of the low-temperature sensitive variety 'Seedless White' and the cold-resistant wild grape 'Shuangyou' were treated with -20℃ low temperature. RNA was extracted 2h, 4h, 8h, 12h, 24h, and 48h after treatment, and the expression level of the ERF022 gene was quantitatively analyzed. The expression pattern differences of the ERF022 gene in the two different low-temperature resistant materials were analyzed. Figure 1 As shown, ERF022 was induced in both grape accessions, but with different expression patterns. In the 'Seedless White' grape variety, ERF022 expression showed a decreasing trend from 2 to 12 hours after low temperature treatment, then gradually increased after 12 hours and finally stabilized. In contrast, in the 'Shuangyou' variety, ERF022 expression showed a regular pattern, initially increasing significantly and then gradually decreasing, reaching peaks at 2 and 12 hours, respectively. Furthermore, the low temperature-induced upregulation of ERF022 in the 'Shuangyou' variety was significantly higher than that in the 'Seedless White' grape variety. Therefore, VaERF022 was selected for this study.

[0094] Example 2: Cloning of the VaERF022 gene from Vitis amurensis

[0095] 1 Materials and Methods

[0096] The plant material used in this experiment was the cold-resistant mountain grape cultivar 'Shuangyou,' obtained from the grape resource nursery of Shenyang Agricultural University. Mature, uniform-sized leaves of 'Shuangyou,' approximately 60 days old, were used as material. The third to fifth mature true leaves above the base of the new shoot were selected for RNA extraction.

[0097] 2 Plant RNA extraction methods

[0098] RNA was extracted from the treated 'Shuangyou' leaves according to the instructions of the plant RNA extraction kit. RNA integrity was verified by agarose gel electrophoresis, and the purity and concentration were determined spectrophotometrically. RNA was reverse transcribed using Baosheng Bio's reverse transcriptase reagent to generate cDNA for subsequent gene cloning.

[0099] 3. Cloning of VaERF022 gene

[0100] Primers were designed to amplify the full-length VaERF022 gene and ligated into the pCAMBIA2300-GFP vector. The cDNA from 'Double Excellence' was used as a template for amplification. The amplification system and procedure were based on the ClonExpress one-step cloning instructions from Nanjing Novozymes. The clone electrophoresis is shown in Figure 2. Figure 2 The primer sequences are shown below:

[0101] 2300ERF022-F:

[0102] GAGCTCGGTACCCGGGGATCCATGGAACTCTATTTCCAGAATCACC(SEQ ID NO.3);

[0103] 2300ERF022-R:

[0104] CTTGCTCACCATGGTGTCGACACCTGTGCAGAACAGCTGACACA (SEQ ID NO. 4).

[0105] 4Construction of VaERF022 gene overexpression vector and silencing vector

[0106] The pCAMBIA2300-GFP plasmid was double-digested. The enzyme digestion system was carried out according to the NEB restriction enzyme instructions. The amplification product and the enzyme digestion product were then purified and recovered using the DNA gel recovery kit from Beijing Tiangen Biochemical Technology Co., Ltd.

[0107] The purified product was ligated with the linearized pCAMBIA2300-GFP vector according to the instructions of the homologous recombination enzyme kit of Zan Company and transformed into competent E. coli DH5α. The specific steps are as follows:

[0108] Take 10 μL of the ligation product and add DH5α, flick gently to mix, and incubate on ice for 30 min (do not shake); heat shock at 42°C for 60 s, incubate on ice for 5 min (do not shake); add 600 μL of antibiotic-free LB liquid medium in a clean bench, culture at 37°C, 200 rpm for 60 min, use a handheld pipette to aspirate 200 μL of medium, and use a spreading rod to evenly spread it on the LB solid medium containing the corresponding antibiotics, and culture upside down (37°C) for 14 h.

[0109] Single colonies on the plates were tested by PCR to screen for positive clones. The reaction system consisted of 5 μL of Green Taq Mix, 0.5 μL each of forward and reverse primers, 1 μL of template, and ddH₂O to 10 μL. The bacterial suspension of positive single clones was sent to Shanghai Sangon Biotechnology Co., Ltd. for sequencing. Sequencing results revealed an 813-bp open reading frame sequence for the VaERF022 gene (see SEQ ID NO. 1 for the detailed sequence). The amino acid sequence of VaERF022 was deduced from the CDS open reading frame sequence, resulting in 270 amino acid residues, a molecular weight of 30057.70 Da, and a theoretical isoelectric point of 8.19 (see SEQ ID NO. 2 for the detailed sequence). Plasmids were extracted from the correctly sequenced bacterial suspension using a plasmid extraction kit; refer to the kit instructions for specific procedures. The resulting recombinant plasmid for overexpression of VaERF022 was named pCAMBIA2300-VaERF022-GFP.

[0110] An RNAi vector was constructed using the 813-bp VaERF022 CDS sequence. Using the "Double-Excellent" cDNA as a template and primers constructed for the RNAi vector, forward and reverse fragments were amplified. The amplification system and procedure were identical to those used for overexpression vector preparation. The RNAi vector plasmid was double-digested with the endonucleases XbaI and SmaI, gel-recovered, and ligated with the forward fragment. Subsequently, DH5α was transformed using the same method as for overexpression vector preparation. After screening and identification of positive single clones, plasmid extraction was performed from the bacterial culture. The recombinant plasmid was double-digested again with KpnI and SacI, gel-recovered, ligated with the reverse fragment, and transformed into DH5α. After screening and identification of positive single clones, plasmid extraction was performed from the bacterial culture to obtain the VaERF022-RNAi recombinant plasmid. The recombinant vector can be transformed into Agrobacterium GV3101 with reference to the transformation method of the overexpression vector, and the bacterial solution of the positive colony is added with 50% glycerol and stored in a -80°C ultra-low temperature refrigerator for use.

[0111] Example 3: Analysis of the transcriptional activation activity of VaERF022 transcription factor

[0112] In order to study and analyze the transcriptional activation activity of the VaERF022 gene, the gene was divided into full-length (1-270aa) and the amplification primers were:

[0113] 2300ERF022-F:

[0114] GAGCTCGGTACCCGGGGATCCATGGAACTCTATTTCCAGAATCACC(SEQ ID NO.3);

[0115] 2300ERF022-R:

[0116] CTTGCTCACCATGGTGTCGACACCTGTGCAGAACAGCTGACACA (SEQ ID NO. 4).

[0117] VaERF022-N-terminus (1-180aa), amplification primers:

[0118] ACTIN-F:GTGCCTGCCATGTATGTTGCC;

[0119] VaERF022-C terminus (181-270aa), amplification primers:

[0120] ACTIN-R:GGTCACGTCCAGCAAGGTCAAG.

[0121] Then, the VaERF022 gene coding region sequence fragments were connected to the yeast GAL4 fusion expression vector pGBKT7 to construct a recombinant vector, and then the yeast AH109 competent cells were transformed respectively, and the transcriptional activation activity of VaERF022 was tested on the corresponding defective culture medium. Positive and negative controls were set up in the experiment. The results showed that all transformants were able to grow on SD / -Trp deficiency culture medium, while only the full-length VaERF022 and the C-terminus could grow normally on the deficiency culture medium SD-Trp / -Ade / -His and SD-Trp / -Ade / -His+X-α-Gal, and showed blue, while the transformants containing the N-terminal sequence could not grow and did not show blue. This shows that VaERF022 has transcriptional activation activity, such as Figure 3 Example 4: Subcellular localization of VaERF022 protein

[0122] The CDS region of VaERF022 (excluding the stop codon) was amplified and fused to the vector pCAMBIA2300-35S-GFP, driven by the CaMV35S promoter. Using the correctly sequenced plasmid obtained in Example 1 as a template, specific primers were designed for amplification. 15-20 bp of the linearized vector terminal sequence was added to each 5' end as a homologous sequence to obtain an insert fragment with a homologous sequence. Using the One Step Cloning Kit (Novozyme, China), the insert was inserted between the Eco RI and Bam HI restriction sites on the pCAMBIA2300-35S-GFP vector. After the constructed vector was correctly sequenced, it was transferred into the competent Agrobacterium GV3101. The primers used are as follows:

[0123] 2300ERF022-F:

[0124] GAGCTCGGTACCCGGGGATCCATGGAACTCTATTTCCAGAATCACC(SEQ ID NO.3);

[0125] 2300ERF022-R:

[0126] CTTGCTCACCATGGTGTCGACACCTGTGCAGAACAGCTGACACA (SEQ ID NO. 4).

[0127] The OD value of the Agrobacterium culture containing the recombinant plasmid was adjusted to 0.6. Then, the control 35S:GFP+mCherry and 35S:VaERF022-GFP+mCherry were transiently transformed into 5-week-old Nicotiana benthamiana leaves in good growth condition and injected from the back of the leaves. After culturing for 48 hours at 22°C, 16h light / 8h dark, and 60% relative humidity, the leaves were observed and photographed using a laser confocal microscope. It was found that the fluorescence of the control filled the entire epidermal cells, including the cytoplasm and nucleus, while the fluorescence of the transformed 35S:VaERF022-GFP+mCherry was only detected in the nuclear matrix, indicating that VaERF022 is a nuclear-localized protein. Figure 4 shown.

[0128] Example 5: The recombinant overexpression vector and silencing vector of VaERF022 were respectively transformed into Agrobacterium

[0129] The successfully constructed recombinant overexpression vector: pCAMBIA2300-VaERF022-GFP plasmid and the empty vector control: pCAMBIA2300-35S-GFP, as well as the recombinant silencing vector pTRV-VaERF022, were transformed into Agrobacterium competent cells GV3101 by freeze-thaw method for subsequent experiments. The specific Agrobacterium transformation method is as follows:

[0130] Take 1 μg of recombinant plasmid and add it to GV3101, and gently flick to mix. Incubate on ice for 5 minutes (do not shake), quick freeze in liquid nitrogen for 5 minutes, heat shock at 37°C for 5 minutes, and then immediately incubate on ice for 5 minutes. Add 600 μL of antibiotic-free LB medium to the centrifuge tube in a clean bench, culture at 28°C, 200 rpm for 2.5 hours, and then centrifuge to collect the bacteria (10,000 rpm, 5 seconds); aspirate 200 μL of supernatant to resuspend the bacteria, and use a spreading rod to evenly spread the bacterial solution on LB solid medium containing 50 mg / L kanamycin. After incubating inverted and protected from light in a 28°C biochemical incubator for 2 days, pick several single clones for positive colony identification. Activate the bacterial solution with the correct PCR fragment size, store it in 50% glycerol, quick freeze it in liquid nitrogen, and store it at -80°C for later use.

[0131] Referring to the transformation method of the overexpression vector, the recombinant silencing vector pTRV-VaERF022 was transformed into Agrobacterium GV3101, and the bacterial suspension of the positive colonies was added with 50% glycerol and stored in a -80℃ ultra-low temperature freezer until use. Example 6: Transient transformation of 'Seedless White' grape leaves

[0132] 1. Acquisition of plant materials

[0133] The plant material used in this experiment was the cold-resistant European grape variety 'Seedless White,' obtained from the grape resource nursery of Shenyang Agricultural University. Leaves from mature, uniform-sized 'Seedless White' plants, approximately 60 days old, were used as material. The third to fifth mature true leaves above the base of the new shoot were selected.

[0134] 2. Instantaneous transformation of grape leaves

[0135] 100 μL of the stored Agrobacterium culture solution was inoculated into 5 mL of LB liquid culture medium containing 50 mg / L Kan and 50 mg / L Rif, and cultured in a constant temperature shaker at 28° C. and 200 rpm for 48 h.

[0136] 1 mL of activated bacterial solution was inoculated into 100 mL of LB medium (containing 50 mg / L Kan and 50 mg / L Rif), and cultured in a 28°C constant temperature shaker at 200 rpm for 12 h until the OD600 reached 0.6.

[0137] Aliquot the bacterial suspension into 50 mL conical centrifuge tubes and centrifuge at 5000 rpm for 8 minutes to collect the cells. Discard the supernatant and wash once with MES solution (1 M MgCl2, 500 mM MES, 50 mM acetosyringone, pH 5.8, prepared fresh). Resuspend the cells to an OD600 of 0.6, add 150 μM acetosyringone, and incubate at room temperature for 3 hours. Next, using the vacuum infiltration method, the Agrobacterium suspension was transformed into the epidermal cells of 'Seedless White' leaves by creating a negative pressure inside the container using a vacuum pump. The cells were then incubated in a plant incubator at 22°C, 16 h light / 8 h dark, and 60% relative humidity for 48 hours.

[0138] Example 7: Real-time fluorescence quantitative PCR technology

[0139] Total RNA was extracted from low-temperature treated grape leaves using a plant total RNA extraction kit. HiScript IIQ Select RT SuperMix (Novagen, Nanjing) was used for reverse transcription and cDNA synthesis. Detailed procedures were performed according to the kit instructions.

[0140] qRT-PCR analysis was performed using the SYBR-qPCR-Mix-kit (Novizan, Nanjing) and gene-specific primers. A 20 μL reaction system included: 10 μL 5× qPCR-Mix, 0.4 μL each of upstream and downstream primers, 2 μL cDNA template (diluted 6-fold), and 7.2 μL ddH2O.

[0141] The primer sequences are as follows:

[0142] q-ERF022-F:

[0143] ATTTGATCCCTCCTGGGTATTT;

[0144] q-ERF022-R:

[0145] AGCCCGAATTCCGTCATATC.

[0146] qRT-PCR reaction conditions were: 95°C pre-denaturation for 2 min; 40 cycles of 95°C denaturation for 5 s, 60°C for 30 s (annealing); melting curves were collected using the default program. Actin was used as the internal reference gene, and each reaction was performed in triplicate.

[0147] The relative expression of genes was calculated using the 2-ΔΔCt method, and the t-test was used to analyze the significance of the differences in gene expression. Figure 5 shown.

[0148] Example 8: An improved high-precision method for identifying plant cold resistance

[0149] Using a high-precision plant cold resistance tester independently developed by our R&D team, based on the principle of differential thermal analysis, we monitor and record the heat release process of plant tissues in low-temperature environments in real time. This heat release is converted into an electrical signal, thereby obtaining a "temperature-voltage" curve for grapes. The freezing point temperature of 'Seedless White' leaves under low-temperature conditions is recorded to assess the cold resistance of grape leaves. The specific operating process is as follows:

[0150] 1. Sample pretreatment: Rinse the sample repeatedly with tap water to remove sediment and impurities, then wash with distilled water and air dry. Cut the leaves into standard sizes, approximately 40 mm in length and width, and remove unnecessary tissue to ensure consistency and comparability of sample processing. Place the sample in a petri dish with damp absorbent paper to maintain appropriate humidity; then place it in a -4°C incubator for a period of time to allow it to reach equilibrium.

[0151] 2. Sample placement: Place the sample from step 1 into the sample placement device of the cold resistance tester system. A high-sensitivity temperature sensor is installed on the side of the sample placement device to record the temperature changes in the thermal conductivity module of each sample placement device during the heat release process of the blade and convert it into voltage (mV) output;

[0152] 3 Binding and fixing: Spread the hard cotton cloth flat on the layout device and gently press it to make the blade fit tightly with the layout device module. Use rubber bands to fix the device to ensure that it is tightly bound to avoid loose coverage or gaps between the blade and the layout device, so as to ensure the accuracy of the test data.

[0153] 4. Set up the gradient cooling program: put the sample device into the variable temperature test box, and use the test box to set the temperature to continuously cool down to simulate the natural

[0154] Set the temperature in the programmable constant temperature and humidity test chamber to drop at a rate of 4°C / h to adjust the temperature. After setting the program, click Run.

[0155] The cooling program of the programmable constant temperature and humidity test chamber is as follows: the room temperature is lowered to 0℃ for 1 hour; 0℃ is maintained for 0.5 hours; the cooling rate from 0℃ to -40℃ is

[0156] Temperature 4℃ / h for 10h; keep at -40℃ for 1h; heat to 4℃ in 1h;

[0157] 5. Data processing: Perform a significant variance analysis on the exported data to determine whether the differences between groups are significant. By calculating the overall variance, the variance within the group, and the variance between the groups, use statistical methods such as the F test or t test to determine whether the differences between different groups are statistically significant;

[0158] The experiment was carried out by the technical steps in Example 8. The freezing point temperature values ​​of the grape leaves in the wild type, VaERF022 gene overexpression group and VaERF022 gene silenced group, that is, the limit value that the leaves can withstand low temperatures, were as follows: Figure 6 shown.

[0159] The structure and detailed usage of the cold resistance instrument can be found in: "Bai Xuewei, Guo Yinshan, Xu Weirong, Zhang Fengyu, Wu Tianhao, Dong Yuchi, Meng Qingchen, Ma Xiaolele, Yan Zhuoyu, Wang Zhixu, Xu Mingze, Tong Haoyang, Liu Lingfei, Liu Jiahong, Xu Jiarui. A test device for the cold resistance of plant branches [P]. CN116297663A, 2023-06-23".

[0160] Example 9: Other methods for improving plant cold resistance used in this patent

[0161] 1Material collection and cryogenic treatment

[0162] Healthy, uniformly growing leaves from transgenic and empty vector control 'Seedless White' grapes were subjected to cold stress. Stress treatment began at 0°C in a low-temperature incubator for 0.5 hours, and continued for 1 hour after the temperature reached -16°C. Grape leaves were then collected for freezing phenotypes. Grape leaves for determination of electrolyte permeability, antioxidant enzyme activity, and chlorophyll fluorescence were collected immediately after the 0°C treatment ended. Four leaves from each grape line were used as an independent experiment, and each experiment was replicated three times.

[0163] 2. Observe the phenotype of grape leaves to assess the cold resistance of plants

[0164] After low temperature stress, compared with the leaves of the empty vector negative control group and the VaERF022 transgenic silenced line, the grape leaves in the VaERF022 transgenic overexpression group showed chlorosis, and the degree of water-soaking of the leaves was significantly less than the former two. The grape leaves in the negative control group and the silenced group showed large areas of wilting and chlorosis, and more water-soaked spots appeared. In summary, the grape leaves overexpressing VaERF022 appeared healthier than the leaves in the negative control group and the silenced group. Figure 7 shown.

[0165] 3. Evaluating plant cold resistance through chlorophyll fluorescence measurement

[0166] Chlorophyll fluorescence and Fv / Fm were determined as follows: Prior to measurement, the material to be tested was kept in darkness for approximately 30 min. The plant leaves were then photographed using a plant chlorophyll fluorescence imaging system (FC800-C / 1010, PSI, Germany) and the Fv / Fm values ​​were measured. The results are described below:

[0167] Compared with the wild-type WT and VaERF022 silenced groups, the cyan fluorescence intensity and Fv / Fm of the overexpression lines were significantly higher than those of the WT plants after low temperature stress. The REL content of the overexpression lines was significantly lower than that of the wild-type WT and VaERF022 silenced groups. Figure 8 As shown, overexpression of VaERF022 enhanced the low temperature tolerance of grape plants.

[0168] 4. Identification of plant cold resistance by measuring antioxidant enzyme activity

[0169] The experimental results showed that the SOD, POD and CAT enzyme activities in the leaves of the VaERF022 overexpressing grapes were significantly higher than those in the empty vector control group (EV) and the VaERF022 silenced group (pTRV-Va ERF022). Figure 9 shown.

[0170] 5. Evaluation of plant cold resistance by histochemical staining techniques

[0171] DAB and NBT staining techniques were used to qualitatively analyze the accumulation level of reactive oxygen species in grape leaves in order to evaluate the antioxidant capacity of grapes in resisting cold damage. The results showed that compared with the empty vector control group EV and the VaERF022 gene silencing group grape leaves, the staining area of ​​the VaERF022-overexpressing transgenic 'seedless white' grape leaves after low temperature stress was smaller, among which DAB staining H2O2 showed yellow-brown, while NBT staining O2 showed blue, and the color of the transgenic grape leaves in the overexpression group was lighter, indicating that the transgenic grape leaves overexpressing VaERF022 accumulated less H2O2 and O2- under low temperature stress, such as Figure 10 shown.

[0172] It will be apparent to those skilled in the art that the present invention is not limited to the details of the exemplary embodiments described above and that the invention can be embodied in other specific forms without departing from the spirit or essential characteristics of the invention. Therefore, the embodiments should be considered in all respects as illustrative and non-restrictive, and the scope of the invention is defined by the appended claims, not the foregoing description, and all variations within the meaning and range of equivalents of the claims are intended to be encompassed therein. Any reference sign in a claim should not be construed as limiting the claim to which it relates.

[0173] In addition, it should be understood that although this specification is described in terms of implementation methods, not every implementation method contains only one independent technical solution. This narrative method of the specification is only for the sake of clarity. Those skilled in the art should regard the specification as a whole. The technical solutions in each embodiment can also be appropriately combined to form other implementation methods that can be understood by those skilled in the art.

Claims

1. A Vitis amurensis VaERF022 gene, characterized in that: The nucleotide sequence of the VaERF022 gene is shown in SEQ ID NO.

1.

2. The Vitis amurensis VaERF022 gene according to claim 1, characterized in that The amino acid sequence of the protein encoded by VaERF022 is shown in SEQ ID NO.

2.

3. The primers for amplifying the CDS sequence of the VaERF022 gene of Vitis amurensis according to claim 1, characterized in that: The primer sequences are: Primer F: 5'-GAGCTCGGTACCCGGGGATCCATGGAACTCTATTTCCAGAATC ACC-3' (SEQ ID NO. 3); Primer R: 5'-CTTGCTCACCATGGTGTCGACACCTGTGCAGAACAGCTGACAC A-3' (SEQ ID NO. 4).

4. A recombinant vector comprising the Vitis amurensis VaERF022 gene according to claim 1, characterized in that: The invention relates to a recombinant expression vector or gene recombinant plasmid containing the gene VaERF022, wherein the recombinant vector is an Agrobacterium overexpression transformation vector or a silencing vector, and the recombinant vector is a gene overexpression vector.

5. A method for constructing a VaERF022 gene overexpression transformation vector according to claim 4, characterized in that: Specifically: Specific primers with restriction enzyme sites were designed to amplify the CDS sequence of the coding region of the VaERF022 gene. The VaERF022 gene was integrated into the overexpression vector pCAMBIA2300-GFP by homologous recombination. The "double-excellent" cDNA was used as a template for amplification. The amplification system and procedure were based on the ClonExpress one-step cloning instructions of Nanjing Novozymes. The plasmid was transformed into GV3101 Agrobacterium by heat shock. The primer sequences are shown in SEQ ID NO.3 and SEQ ID NO.

4.

6. A method for constructing the VaERF022 gene silencing vector according to claim 5, characterized in that: Specifically: An RNAi vector was constructed using the 813-bp VaERF022 CDS sequence. Using the "Double-Excellent" cDNA as a template, primers constructed using the RNAi vector were used to amplify the forward and reverse fragments. The VaERF022 gene was integrated into the silencing vector VaERF022-RNAi using homologous recombination. The recombinant vector can be transformed into Agrobacterium GV3101 with reference to the transformation method of the overexpression vector, and the bacterial solution of the positive colony is added with 50% glycerol and stored in a -80°C ultra-low temperature freezer until use. The primer sequences are shown in SEQ ID NO. 3 and SEQ ID NO.

4.

7. Use of the Vitis amurensis VaERF022 gene according to claim 1 or 2 in enhancing the cold resistance of grape plants.

8. The use of the Vitis amurensis VaERF022 gene in enhancing the cold resistance of grape plants according to claim 7, characterized in that: The gene VaERF022 or the protein encoded by VaERF022 exerts its biological function under low temperature conditions, helps to activate the expression of antioxidant enzymes and can effectively remove high-concentration active oxygen, thereby improving the antioxidant capacity of grape plants under cold damage.

9. A method for cultivating grape plants to enhance resistance to low temperature stress and improve cold resistance of grapes, characterized in that: This is achieved by increasing the expression level of the cold-resistant gene VaERF022 in the plant; The grape plant cultivation method is specifically carried out according to the following steps: constructing an Agrobacterium recombinant overexpression vector containing the gene VaERF022; The recombinant overexpression vector containing the VaERF022 gene was transformed into competent cells, cultured, and inoculated onto 'seedless white' grape plants to obtain a high-quality grape strain with strong cold resistance; the details are as follows: The overexpression vector containing the VaERF022 gene was transformed into Agrobacterium GV3101 competent cells, and a transgenic Agrobacterium strain was obtained after culture. The strain was propagated in a constant temperature shaker at 28°C and then transformed into leaves of the non-cold-resistant European grape variety "Seedless White" by vacuum infiltration to obtain transgenic grape leaves that were resistant to low temperature stress.

10. A method for quantitatively analyzing the expression level of the cold-resistant gene VaERF022 in plants based on the qRT-PCR principle, characterized in that: To determine the expression level of the VaERF022 gene in the leaves of plants under low temperature stress, the specific steps are as follows: qRT-PCR analysis was performed using SYBR-qPCR-Mix-kit (GenStar) and gene-specific primers. The 20 μL reaction system included: 10 μL 5× qPCR Mix, 0.4 μL each of upstream and downstream primers, 2 μL cDNA template (diluted 6 times), and 7.2 μL ddH2O; The primer sequences are as follows: q-ERF022-F: ATTTGATCCCTCCTGGGTATTT; q-ERF022-R: AGCCCGAATTCCGTCATATC. q-Actin1-F: CAAGAGCGGAAACTGCAAAGA; q-Actin1-R: AATGAGAGATGGCTGGAAGAGG. qRT-PCR reaction conditions were: 95°C pre-denaturation for 2 min; 40 cycles of 95°C denaturation for 5 s, 60°C for 30 s (annealing); melting curves were collected using the default program. The internal reference gene was SlEF1ɑ (Solyc06g005060.3.1). Each reaction was performed in triplicate. The relative expression levels of genes were calculated using the 2-ΔΔCt method, and the t-test was used to analyze the significance of the differences in gene expression levels.