Application and method of CsRHY1A gene in improvement of citrus liberobacter asiaticum resistance

By cloning the citrus CsRHY1A gene and constructing an overexpression vector, citrus was transformed to improve its resistance to Huanglongbing disease, solving the problem of low efficiency in the prevention and control of citrus Huanglongbing disease in the existing technology and achieving the effect of significantly reducing the titer of the pathogen.

CN120665891AActive Publication Date: 2025-09-19SOUTHWEST UNIV

Patent Information

Application Number
CN202510823806.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-19
Publication Date
2025-09-19
Estimated Expiration
2045-06-19

AI Technical Summary

Technical Problem

Existing technologies make it difficult to effectively improve citrus' resistance to Huanglongbing disease. Traditional chemical control has environmental pollution problems, while biological control is costly and has unstable effects. Traditional breeding cycles are long and it is difficult to respond quickly to disease outbreaks.

Method used

By cloning the citrus CsRHY1A gene, constructing an overexpression vector and transforming citrus, the expression level of the CsRHY1A gene was increased and the resistance of citrus to Huanglongbing was enhanced.

Benefits of technology

It significantly reduces the titer of Huanglongbing bacteria and delays the colonization of pathogens in citrus, providing an efficient bioengineering method to improve citrus' resistance to Huanglongbing.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120665891A_ABST
    Figure CN120665891A_ABST
Patent Text Reader

Abstract

The invention discloses an application and a method of a CsRHY1A gene in improvement of citrus liberobacter asiaticum resistance, belongs to the technical field of agricultural biological genetic engineering, and discloses the application of the CsRHY1A gene in improvement of citrus liberobacter asiaticum resistance, and the nucleotide sequence of the CsRHY1A gene is as shown in SEQ ID NO.1. The invention also discloses a method for improving the citrus yellow shoot resistance by using the CsRHY1A gene. The method comprises the following steps: S1, cloning the citrus CsRHY1A gene; s2, an overexpression vector pLGNe-CsRHY1A of the CsRHY1A is constructed, and the expression vector pLGNe-CsRHY1A And S3, transforming the overexpression vector pLGNE-CsRHY1A obtained in the S2 into citrus, and identifying to obtain a transgenic plant with improved Huanglongbing resistance. The invention provides a new choice for improving the resistance of the citrus to the citrus huanglongbing, effectively improves the resistance of the citrus to the citrus huanglongbing, and has an important application value for breeding of citrus huanglongbing resistance.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical field of agricultural biological gene engineering, and particularly relates to an application and method of a CsRHY1A gene in improving resistance to citrus Huanglongbing disease. Background Art

[0002] Citrus is one of the most important fruit crops. Citrus Huanglongbing (HLB) is the most destructive disease affecting all commercial citrus varieties. HLB is caused by α-proteobacteria that colonize the phloem. These bacteria belong to the genus Candidatus Liberibacter (Candidatus Liberibacter spp.), including the heat-resistant Asian species (Ca.L.asiaticus, CLas), the American species (Ca.L.americanus, CLam) first discovered in Brazil, and the African species (Ca.L.africanus, CLaf) prevalent in South Africa. Among them, CLas, transmitted by the Asian citrus psyllid (ACP, Diaphorina citri), poses a major threat to citrus production due to its widespread distribution and high pathogenicity.

[0003] Currently, integrated control strategies for Huanglongbing (HLB) are typically employed, primarily through chemical control (to eliminate the psyllid vector) supplemented by biological control. However, chemical methods pose challenges such as environmental pollution and high labor and material resource consumption, while biological control is inconsistent and expensive. Traditional hybrid breeding cycles are long (the juvenile period for citrus crops is generally 5-8 years), resulting in low breeding efficiency and difficulty in rapidly responding to disease outbreaks. With the advancement of molecular biotechnology, genetic engineering to improve citrus HLB resistance is currently a popular approach. Related studies have shown that overexpressing the Arabidopsis NPR1 gene in the sweet orange varieties 'Hamlin' and 'Valencia' enhances resistance to HLB. Overexpressing CiNPR3 and CiNPR4 from the HLB-resistant grapefruit variety 'Jackson' in Late Jin Orange enhanced the transgenic Late Jin Orange's resistance to HLB. Overexpressing CsSAMT1 in Late Jin Orange significantly increased SA and MeSA levels, enhancing the transgenic plants' resistance to HLB. Currently, there is no research and application on using CsRHY1A gene to improve the resistance of citrus to citrus Huanglongbing. Summary of the Invention

[0004] The present invention aims to provide an application and method of the CsRHY1A gene in improving citrus Huanglongbing resistance, providing a new option for improving citrus resistance to Huanglongbing. The application is to integrate the citrus CsRHY1A gene into citrus through an expression vector, effectively improving citrus resistance to Huanglongbing, which has great application value for citrus Huanglongbing resistance breeding.

[0005] In order to solve the above technical problems, the technical solutions adopted by the present invention are as follows:

[0006] The invention relates to an application of the CsRHY1A gene in improving resistance to citrus Huanglongbing disease. The nucleotide sequence of the CsRHY1A gene is shown in SEQ ID NO.1.

[0007] Preferably, the method of improving the resistance of citrus to Huanglongbing is carried out by regulating the expression level of the citrus CsRHY1A gene to improve the resistance of citrus to Huanglongbing.

[0008] The present invention also provides an overexpression vector for improving the resistance to citrus Huanglongbing disease, wherein the overexpression vector comprises the CsRHY1A gene.

[0009] The present invention also provides a strain for improving the resistance to citrus Huanglongbing disease, wherein the strain comprises the overexpression vector.

[0010] The present invention also provides a method for improving citrus Huanglongbing resistance by utilizing the CsRHY1A gene, comprising the following steps:

[0011] S1, cloning of the citrus CsRHY1A gene;

[0012] S2. Construction of CsRHY1A overexpression vector pLGNe-CsRHY1A;

[0013] The overexpression vector pLGNe-CsRHY1A obtained in S3 and S2 was transformed into citrus, and transgenic plants with improved resistance to Huanglongbing were obtained after identification.

[0014] Preferably, in S1, the cloned citrus CsRHY1A gene is specifically:

[0015] Total RNA was extracted from citrus, reverse transcribed into cDNA as template, and PCR amplified using primers OE-CsRHY1A-F and OE-CsRHY1A-R. The CsRHY1A gene was obtained by digestion with BamHI and EcoRI.

[0016] The nucleotide sequence of the primer OE-CsRHY1A-F is shown in SEQ ID NO.2, and the nucleotide sequence of the primer OE-CsRHY1A-R is shown in SEQ ID NO.3.

[0017] Preferably, in S2, the construction of the CsRHY1A overexpression vector pLGNe-CsRHY1A is specifically as follows: the CsRHY1A gene obtained in S1 is connected to the pLGNe vector recovered by digestion with BamHI and EcoRI to construct the overexpression vector pLGNe-CsRHY1A.

[0018] Preferably, in S3, the overexpression vector pLGNe-CsRHY1A obtained in S2 is transformed into citrus by: transforming the overexpression vector pLGNe-CsRHY1A obtained in S2 into Agrobacterium tumefaciens EHA105 by heat shock method, and then transforming citrus explants by Agrobacterium-mediated transformation. The explant cells after genetic transformation are identified by GUS staining, PCR identification, and qRT-PCR analysis of CsRHY1A expression level to obtain transgenic plants.

[0019] Preferably, in the PCR identification, the PCR amplification primers are ID-CsRHY1A-F and ID-CsRHY1A-R;

[0020] The nucleotide sequence of the primer ID-CsRHY1A-F is shown in SEQ ID NO.4, and the nucleotide sequence of the primer ID-CsRHY1A-R is shown in SEQ ID NO.5.

[0021] Preferably, in the qRT-PCR analysis, the primers for qRT-PCR detection are RT-CsRHY1A-F and RT-CsRHY1A-R;

[0022] The nucleotide sequence of the primer RT-CsRHY1A-F is shown in SEQ ID NO.6, and the nucleotide sequence of the primer RT-CsRHY1A-R is shown in SEQ ID NO.7.

[0023] Compared with the prior art, the present invention has the following advantages and technical effects:

[0024] The present invention provides a method for improving citrus Huanglongbing resistance by overexpressing the CsRHY1A gene. By cloning the citrus CsRHY1A coding sequence, constructing an overexpression vector, and then transforming citrus, the method can delay the colonization of Huanglongbing in citrus and significantly reduce the titer of Huanglongbing bacteria. In summary, the present invention is a promising bioengineering technology for improving citrus Huanglongbing resistance and has great value for molecular breeding of citrus varieties for resistance (or tolerance) to Huanglongbing.

[0025] The technical solution of the present invention is further described in detail below through the accompanying drawings and embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 The bioinformatics characteristics of CsRHY1A of the present invention are as follows: A is the chromosome location of the citrus CsRHY1A gene, bp represents base; B is the gene structure of citrus CsRHY1A; C is the functional domain of citrus CsRHY1A, aa represents amino acid;

[0027] Figure 2The electrophoresis diagram of the PCR amplification of the CsRHY1A gene clone of the present invention: CDS represents the CsRHY1A coding sequence; M represents the DNA molecular weight standard;

[0028] Figure 3 This is the structure diagram of the CsRHY1A plant overexpression vector of the present invention: 35S represents a strong constitutive promoter; GUS: NPTII: a marker gene for transgenic citrus screening; NOS: a transcription termination sequence; LB: the left arm of T-DNA; RB: the right arm of T-DNA;

[0029] Figure 4 The GUS staining images of the transgenic plants of the present invention are shown as follows: OE-1, OE-2, and OE-6 represent transgenic plants, respectively; WT represents the wild-type Wanjin Orange plant; and + represents the plasmid pLGNe-CsRHY1A.

[0030] Figure 5 PCR identification diagram of the transgenic plants of the present invention: M, Marker; +, plasmid pLGNe-CsRHY1A; WT, wild-type control; OE-#, transgenic plants;

[0031] Figure 6 The expression level analysis diagram of the transgenic plants in the present invention: *Asterisk indicates significant difference compared with the WT control (**p<0.01, ***p<0.001, ****p<0.0001, one-way ANOVA);

[0032] Figure 7 This is a phenotype diagram of the CsRHY1A overexpressing plant of the present invention;

[0033] Figure 8 The results of pathogen content detection in transgenic plants are shown in the figure: MAI stands for month after infection. DETAILED DESCRIPTION

[0034] The technical solution of the present invention is further described below with reference to the accompanying drawings and embodiments.

[0035] Unless otherwise defined, technical or scientific terms used in the present invention shall have the same meaning as commonly understood by one of ordinary skill in the art to which the present invention belongs.

[0036] Source of test materials:

[0037] In this example, Wanjin Orange was used as the experimental object.

[0038] In the present invention, unless otherwise specified, other test materials and instruments and equipment are conventional test materials in this field and can be purchased through commercial channels.

[0039] Example 1

[0040] 1. Bioinformatics analysis of the citrus CsRHY1A gene

[0041] The citrus CsRHY1A gene is located between 153439bp and 155402bp on chromosome 4 of citrus. The full length of the chromosome is 19953105bp, the CDS sequence is 624bp long, and it can encode 207 amino acids. The protein sequence analysis results are as follows Figure 1 .

[0042] Figure 1 The results showed the existence of a distinct RING structural functional domain.

[0043] The CsRHY1A gene has a nucleotide sequence shown in SEQ ID NO.1.

[0044] SEQ ID NO.1: (CDS sequence of CsRHY1A, ATG to stop codon)

[0045] ATGGCTGGTATGCTACCTGGAGTTGAATGTGCAAGAAGAAGAAGGATTCATCAAAGTGGAGGAGGGTGCAGCTCAGCCTCAGATGGCTTGGCGCCAACGTGGTCTTCTATGTCTATGTCTATGAGCAGAAGGTCCTCTTTTTGTTTATACACAAGC AGCCACGAGTCTCATCACACTTCTTCTATCTCTTCTCTGAGAAGCATAATCAACCAAGCGTGTGAAGATGAGCAGCTTGCAGGAGTAGCTAGAGAAGCTAAAGAAAGGTTAGATGAGAGACTCGGAACTCAAAGGAAATCCTCAGATAGCAATAGC AGGCAAAATGGCAAAGAGAGCTCAGTATTGATGAATATTAATAAGTCTACGGTGTTACATACACAAGTGTTTGGATCAAAGAAGAGTGGTTCAAAAAGGTTTAGTTGGTCCAAGTTGAGCTGGAAAGCTTGTGAGCAAGAAGAGTGTGCAATTTGC CTCGAGAGATTCAAGGTTGGTGACACCTTGGTGCACTTGCCTTGTGCTCATAGGTTTCATGCAAGGTGCTTGTTGCCATGGCTTGCCACCAATGCTCATAATTGCCCCTGTTGCAGAATGCAAATCCTGGACCCTGCAGCTTCATCAGCAGATTAA

[0046] 2. Cloning of the Citrus CsRHY1A Coding Sequence

[0047] 1. RNA Extraction and cDNA Synthesis

[0048] Total RNA was extracted from citrus (Wanjincheng) leaves using a plant total RNA extraction kit (Adlai, CAT: RN09). RNA quality was verified by agarose gel electrophoresis and concentration was determined using a concentration meter. cDNA was synthesized using a reverse transcription kit, PrimeScript RTMaster Mix (TaKaRa, CAT: RR036A).

[0049] 2. PCR Amplification of the CsRHY1A Coding Sequence

[0050] The CsRHY1A coding sequence was amplified from citrus cDNA using primers OE-CsRHY1A-F (SEQ ID No. 2) and OE-CsRHY1A-R (SEQ ID No. 3) and high-fidelity enzyme PrimeSTAR Max DNA Polymerase (TaKaRa, CAT: R045A). The DNA fragment was 624 bp long (e.g. Figure 2 The amplified DNA fragment was sequenced and confirmed to be the coding sequence of the citrus CsRHY1A gene (SEQ ID No. 1). Under ultraviolet light, a clean blade was used to cut out the agarose gel containing the target fragment, and the DNA fragment was recovered using a kit (Tian Gen, CAT: DP214).

[0051] PCR amplification program: 98°C, 5 min; 98°C, 30 s, 56°C, 30 s, 72°C, 1 min, 35 cycles; extension at 72°C for 10 min.

[0052] SEQ ID No. 2: (CDS cloning primer OE-CsRHY1A-F, containing restriction enzyme cutting site)

[0053] GGACAGGGTACCCGGGGATCCATGGCTGGTATGCTACCTGG

[0054] SEQ ID No.3: (CDS cloning primer OE-CsRHY1A-R, containing enzyme cleavage site)

[0055] TCTCATTAAAGCAGGGAATTCTTAATCTGCTGATGAAGCTGC

[0056] 3. Construction of CsRHY1A expression vector and transformation of Agrobacterium

[0057] 1. Construction of overexpression vector

[0058] The CsRHY1A coding sequence DNA fragment and the overexpression vector pLGNe were double-digested with restriction endonucleases BamHI and EcoRI (ThermoFisher), recovered from gels, and ligated at 37°C using a homologous recombination kit (Novagen, CAT: C112). The ligation product was transformed into Escherichia coli DH5α, and the plasmid of the positive clone was extracted using a plasmid extraction kit (Tiangen, CAT: DP103) to obtain the CsRHY1A overexpression vector pLGNe-CsRHY1A (such as Figure 3 shown).

[0059] 2. Transformation of Agrobacterium with Overexpression Vector

[0060] The constructed overexpression vector pLGNe-CsRHY1A was introduced into Agrobacterium tumefaciens EHA105 using the heat shock method. The method is as follows: 50 μL of frozen Agrobacterium competent cells EHA105 were thawed on ice in advance; 2 μL of the overexpression vector plasmid was added to the competent cells, mixed by pipetting, and placed on ice for 5 minutes; liquid nitrogen was quick-frozen for 5 minutes; the cells were immediately transferred to a 37°C water bath for heat shock for 5 minutes; 1 mL of LB liquid medium was added, mixed by pipetting, and cultured on a shaker at 220 rpm and 28°C for 60 minutes; the bacterial solution was centrifuged at 10,000 rpm for 1 minute, the supernatant was discarded (about 100 μL of resuspended bacteria remained), the cells were resuspended and spread, and the cells were incubated in the dark at 28°C for 2 days; after plaques grew, single colonies were verified by PCR using primers OE-CsRHY1A-F (SEQ ID No. 2) and OE-CsRHY1A-R (SEQ ID No. 3).

[0061] PCR reaction conditions: 95°C for 3 min; 95°C for 30 s, 58°C for 30 s, 72°C for 1 min, 30 cycles; 72°C for 10 min.

[0062] 4. Agrobacterium tumefaciens-mediated genetic transformation of citrus

[0063] 1. Obtaining epicotyls of citrus seedlings

[0064] Fresh citrus fruits were washed and surface disinfected with 70% alcohol. The seeds were removed under sterile conditions, the seed coats were peeled off, and the seeds were germinated on seed germination medium. The seeds were cultured in the dark at 28°C for 2 weeks and then cultured under 16 h light / 8 h dark conditions for 1 week. The epicotyls of the germinated seedlings were cut into 1 cm stem segments under sterile conditions for Agrobacterium tumefaciens-mediated genetic transformation.

[0065] 2. Preparation of Agrobacterium tumefaciens Culture Solution

[0066] Before transfection, streak the Agrobacterium (containing the pLGNe-CsRHY1A vector) for transfection on LB solid medium containing 50 mg / L kanamycin. Pick a single colony and inoculate it into 25 mL of LB liquid medium containing the same antibiotics. Cultivate the culture with shaking at 28°C overnight. Dilute the culture to an OD600 of 0.1 and continue culturing to an OD600 of 0.5. Centrifuge at 5000 rpm for 10 min, discard the supernatant, and resuspend the culture in MS liquid medium (pH 5.4) for transfection.

[0067] 3. Transformation of Citrus Epicotyls

[0068] Soak the citrus epicotyl stem segments in Agrobacterium solution for 13 minutes and then wipe them dry. Transfer the stem segments to co-cultivation medium and culture them in the dark at 28°C for 2 days. After the co-cultivation is completed, transfer the epicotyls to screening medium and culture them in the dark at 28°C for 7 days. Culture the epicotyls at 28°C, 16h light / 8h dark conditions, subculture every two weeks, and identify the grown buds by GUS staining.

[0069] 4. Seedling Culture of Transformants

[0070] When the seedlings grow to more than 1 cm, they are cut and grafted onto late orange seedlings in sterile test tubes and cultured in seedling culture medium; when the seedlings grow to about 5 cm, they are grafted onto citrus aurantium seedlings and cultured in a 28°C greenhouse.

[0071] The culture medium used in this example is as follows:

[0072] Seed germination medium: MS + 30 g / L sucrose + 2.5 g / L Elrite, pH 5.8.

[0073] Co-culture medium: MS + 2 mg / L BA + 0.5 mg / L IAA + 1 mg / L 2,4-D + 100 μmol AS + 30 g / L sucrose + 2.5 g / L Gelrite, pH 5.8.

[0074] Screening medium: MS + 2 mg / L BA + 0.5 mg / L IAAA + 500 mg / L Cef + 50 mg / L Kan + 30 g / L sucrose + 2.5 g / L Gelrite, pH 5.8.

[0075] Seedling medium: MS + 30g / L sucrose, pH 5.8.

[0076] 5. CsRHY1A overexpression transgenic plants inhibit pathogen proliferation

[0077] 1. GUS staining identification of transgenic plants

[0078] The leaves of the transgenic plants obtained in the initial screening were cut into leaf discs (7 mm in diameter) and subjected to GUS histochemical staining (24 h). The edges of the leaf discs of the positive plants showed blue color, while the leaf discs of the WT plants did not show color (by Figure 4 shown).

[0079] 2. PCR Identification of Transgenic Plants

[0080] 100 mg of transgenic plant leaves were used to extract genomic DNA using a DNA extraction kit (Bioflux, CAT: BSC13S1B). PCR was performed to detect the integration of the CsRHY1A coding sequence into the citrus genome. The detection primers were ID-CsRHY1A-F (SEQ ID No. 4) and ID-CsRHY1A-R (SEQ ID No. 5). A 1040 bp amplified fragment was obtained in positive plants, while no amplification was observed in WT plants (by Figure 5 shown).

[0081] SEQ ID No.4 (transgenic plant identification primer ID-CsRHY1A-F1, designed within CaMV 35S): CGACACGCTTGTCTACTCCA

[0082] SEQ ID No.5 (primer ID-CsRHY1A-R after transgenic plant identification, designed within CDS): TTAATCTGCTGATGAAGCTGC

[0083] PCR reaction conditions: 94°C for 3 min; 94°C for 30 s, 58°C for 30 s, 72°C for 30 s, 30 cycles; 72°C for 10 min.

[0084] 3. qRT-PCR Analysis of Transgenic Plants

[0085] Total RNA (Adlai, CAT No: RN09) was extracted from the leaves of the transgenic plants and cDNA was synthesized using the reverse transcription kit PrimeScript RT Master Mix (TaKaRa, CAT No: RR036A). The expression level of the target gene was detected by qRT-PCR. The detection primers were RT-CsRHY1A-F (SEQ ID No. 6) and RT-CsRHY1A-R (SEQ ID No. 7). -△△Ct The relative expression of CsRHY1A gene in transgenic plants was calculated by defining the water-treated sample as the reference factor, i.e., its CsRHY1A expression level was 1, and then the fold expression of the gene in transgenic citrus relative to the reference factor was calculated. -△△Ct , which is the relative expression level. The results showed that the CsRHY1A gene was expressed at a higher level in transgenic plants than in wild-type plants (e.g. Figure 6 shown).

[0086] SEQ ID No.6 (transgenic plant RT-PCR identification front primer RT-CsRHY1A-F, designed within the CDS): GTATGCTACCTGGAGTTGAATG

[0087] SEQ ID No.7 (Primer RT-CsRHY1A-R designed within the CDS after RT-PCR identification of transgenic plants): ACTCGTGGCTGCTTGTGTAT

[0088] qRT-PCR reaction conditions: 95°C for 3 min, 94°C for 10 s; 56°C for 10 s, 72°C for 10 s, 40 cycles; 72°C for 10 min.

[0089] 4. Phenotypic observation of transgenic plants

[0090] Observation and analysis of the phenotypes of 3 transgenic plants found no obvious abnormalities in appearance and growth (as Figure 7 shown). It indicates that overexpression of the CsRHY1A gene has no obvious effect on the phenotype and development of plants.

[0091] 5. Evaluation of the resistance of transgenic plants to Huanglongbing

[0092] According to the method of Zou et al. (2016), qPCR was used to detect the pathogen content in transgenic plants. Starting from inoculating the transgenic plants with the virus, the pathogen content in CsRHY1A transgenic plants was detected at 2, 4, and 6 months. For each line, 3 leaves were taken to extract DNA, diluted to 10 ng / μL, and detected using primers Las16S (SEQ ID No.8, 9) and citrus 18S (SEQ ID No.10, 11). Using the following formula: Las copies μg-1 citrus DNA = [10 ^(-0.2718×CtLas16S+10.624) / 10^(-0.2749×CtCs18S+4.0531) ×10 ^3 (12.7 < CtLas16S < 31.3 and 8.4 < CtCs18S < 26.5), calculate the relative content (Log10) of CLas bacteria. The wild-type plants were used as controls to detect the resistance level of CsRHY1A transgenic plants. Each treatment was set with 3 biological replicates and 3 technical replicates. The results showed that overexpression of CsRHY1A inhibited the proliferation of CLas in transgenic plants (as Figure 8 shown).

[0093] SEQ ID No.8 (16S-F): TGAGTGCTAGCTGTTGGGTG

[0094] SEQ ID No.9 (16S-R): CTGCGCGTTGCATCGAATTA

[0095] SEQ ID No.10 (Citrus 18S-F): AATTGTTGGTCTTCAACGAGGAA SEQ ID No.11 (Citrus 18S-R): AAAGGGCAGGGACGTAGTCAA

[0096] These results indicate that overexpression of CsRHY1A can significantly reduce the pathogen titer of Huanglongbing. This gene can be used independently for molecular breeding of disease resistance or in combination with other resistance or susceptibility genes in molecular breeding of Huanglongbing resistance in citrus.

[0097] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit the same. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that they can still modify or replace the technical solutions of the present invention with equivalents, and these modifications or equivalent replacements cannot cause the modified technical solutions to deviate from the spirit and scope of the technical solutions of the present invention.

Claims

1. Application of the CsRHY1A gene in improving resistance to citrus Huanglongbing disease, characterized in that: The nucleotide sequence of the CsRHY1A gene is shown in SEQ ID NO.

1.

2. The application according to claim 1, characterized in that The method for improving the resistance of citrus to Huanglongbing is to regulate the expression level of the citrus CsRHY1A gene, thereby improving the resistance of citrus to Huanglongbing.

3. An overexpression vector for improving citrus Huanglongbing resistance, characterized in that: The overexpression vector comprises the CsRHY1A gene according to claim 1.

4. A strain for improving resistance to citrus Huanglongbing, characterized in that: The strain comprises the overexpression vector according to claim 3.

5. A method for improving citrus Huanglongbing resistance using the CsRHY1A gene according to claim 1, characterized in that: The following steps are involved: S1, cloning of the citrus CsRHY1A gene; S2. Construction of CsRHY1A overexpression vector pLGNe-CsRHY1A; The overexpression vector pLGNe-CsRHY1A obtained in S3 and S2 was transformed into citrus, and transgenic plants with improved resistance to Huanglongbing were obtained after identification.

6. The method according to claim 5, characterized in that In S1, the cloned citrus CsRHY1A gene is specifically: Total RNA was extracted from citrus, reverse transcribed into cDNA as template, and PCR amplified using primers OE-CsRHY1A-F and OE-CsRHY1A-R. The CsRHY1A gene was obtained by digestion with BamHI and EcoRI. The nucleotide sequence of the primer OE-CsRHY1A-F is shown in SEQ ID NO.2, and the nucleotide sequence of the primer OE-CsRHY1A-R is shown in SEQ ID NO.

3.

7. The method according to claim 5, characterized in that In S2, the construction of the CsRHY1A overexpression vector pLGNe-CsRHY1A is specifically as follows: the CsRHY1A gene obtained in S1 is connected to the pLGNe vector recovered by digestion with BamHI and EcoRI to construct the overexpression vector pLGNe-CsRHY1A.

8. The method according to claim 5, characterized in that In S3, the overexpression vector pLGNe-CsRHY1A obtained in S2 is transformed into citrus specifically as follows: the overexpression vector pLGNe-CsRHY1A obtained in S2 is transformed into Agrobacterium tumefaciens EHA105 by heat shock method, and then the citrus explants are transformed by Agrobacterium-mediated transformation. The explant cells after genetic transformation are identified by GUS staining, PCR identification, and qRT-PCR analysis of the CsRHY1A expression level to obtain transgenic plants.

9. The method according to claim 8, characterized in that In the PCR identification, the PCR amplification primers were ID-CsRHY1A-F and ID-CsRHY1A-R; The nucleotide sequence of the primer ID-CsRHY1A-F is shown in SEQ ID NO.4, and the nucleotide sequence of the primer ID-CsRHY1A-R is shown in SEQ ID NO.

5.

10. The method according to claim 8, characterized in that: In the qRT-PCR analysis, the primers used for qRT-PCR detection were RT-CsRHY1A-F and RT-CsRHY1A-R; The nucleotide sequence of the primer RT-CsRHY1A-F is shown in SEQ ID NO.6, and the nucleotide sequence of the primer RT-CsRHY1A-R is shown in SEQ ID NO.7.

Citation Information

Patent Citations

  • Method for improving citrus liberobacter asiaticum resistance by using CsMEKK1-2 gene

    CN118126981A

  • Atypical MEKK protein CsMEKK1-1 for resisting citrus huanglongbing and preparation method of disease-resistant citrus

    CN118207182A

  • Method for improving citrus canker resistance through CsERF1 gene and application of CsERF1 gene

    CN118745439A

  • Method for improving citrus canker resistance through CsAHL15 gene and application of CsAHL15 gene

    CN119776421A

Cited By

  • Method for improving citrus canker resistance by using CsRHY1A interference

    CN121160790A