Gene for regulating and controlling vine length and fruit length of muskmelon as well as encoding protein and application of gene

Abstract

The invention relates to a gene for regulating and controlling vine length and fruit length of muskmelon as well as an encoding protein and application thereof, a nucleotide sequence of a gene encoding region is shown as a sequence 1, and a protein sequence encoded by the gene is shown as a sequence 2. Through overexpression of the CmOVATE gene in muskmelon, it is found that the CmOVATE gene is an important regulation and control gene for growth and development of muskmelon, high expression of the CmOVATE gene enables the vine length and fruit length of muskmelon plants to be remarkably shortened, and the CmOVATE gene and encoded protein thereof have important application value and breeding prospects when applied to regulation and control of the vine length and / or fruit length of muskmelon.

Description

Technical Field

[0001] The present invention relates to the technical field of plant genetic engineering, and in particular to a gene for regulating melon vine length and fruit length, its encoding protein and use. Background Art

[0002] Muskmelon (Cucumis melo L.) is an important horticultural crop in the Cucurbitaceae family. Its nutritious and delicious fruit is highly sought after by consumers. Vine length is a key agronomic trait of melon and is of great significance to its production and cultivation. Most existing melon varieties have long vines, reaching vines exceeding 2.5 meters in length. Exploiting short-vine genes to develop compact (dwarf) varieties suitable for dense planting can fully utilize land and sunlight resources, increase yield per unit area, save labor, reduce production costs, and ultimately improve economic efficiency. Furthermore, with improving living standards, people's demands for melon quality are increasing. "Quality, Nutrition, and Health" are gradually becoming the criteria for high-end melons. Melon quality primarily encompasses appearance, internal quality, and storage and processing qualities. Appearance is the most prominent factor in product sales, directly affecting the quality and value of the product. Fruit shape is a key visual quality trait of melons. Genetic improvement of melon fruit shape has important research value for the cultivation and marketing of high-quality melon varieties and better meeting public demand.

[0003] Research on melon vine length began early. In 1962, American scholar Denna reported a dwarf melon accession, UC Topmarkbush, characterized by a compact plant and short internodes. Paris et al. demonstrated that this accession carried the si-1 gene and was influenced by one or more modifier genes. Wang Jianshe et al. conducted genetic analysis of two short-vine accessions, 1A533 and 1A440, and found that their short vine trait was controlled by a pair of non-allelic recessive genes. Ma Jian et al. conducted genetic analysis and gene mapping of the short-vine gene in the melon short-vine mutant Z8, and discovered that its short vine trait was controlled by a recessive nuclear gene, Cmdm1. These genes are homologous to the Arabidopsis thaliana ERECTA gene. A T-to-G mutation at position 1995 downstream of the ATG leads to premature termination of protein translation and a complete loss of the subsequent kinase domain. Regarding fruit shape, OFP has been reported as a plant-specific transcriptional repressor with a conserved OVATE domain. First discovered in tomato, OFP is involved in fruit shape. In addition, OFP genes can regulate plant growth and development by directly regulating the expression of target genes or interacting with other transcription factors, including changes in fruit shape, embryo sac and pollen development, and secondary cell wall synthesis. In melon, Ma Jian et al., using the Yangjiaocui variety B8 and the oblate-fruited variety HP22 as parents, constructed a genetic population, located, and cloned the gene CmFSI8 / CmOFP13 that controls melon fruit shape. This gene encodes an OFP protein and is a homolog of AtOFP1 in Arabidopsis thaliana.

[0004] Using genetic and molecular biology techniques to identify new genes controlling vine length and fruit length has important theoretical significance and application value for promoting the development of melon industrialization.

[0005] In view of this, the present invention is proposed.

[0006] References:

[0007] Denna DW.1962.A study of the genetic,morphological and physiological basis for the bush and vine habit ofseveral cucurbits.ThesisCornell University,Ithaka(NY,USA).

[0008] Paris HS, Nerson H, Karchi Z. Genelics of internode length inmelons. Journal of Heredity, 1984, 75(5): 403-407.

[0009] Wang Jianshe, Zhang Lijie, Tang Xiaowei, Song Shuhui. Genetic analysis of short vine traits in melon. Acta Agriculturae Boreali-Sinica, 2003, 18(4): 58-60.

[0010] Ma Jian, Li Congcong, Wang Jianshe. Fine mapping and candidate gene analysis of the melon short vine gene Cmdm1. Chinese Journal of Agricultural Sciences, 2020, 53(4): 802-810.

[0011] Wang S,Chang Y,Ellis B.Overview of OVATE FAMILY PROTEINS,A NovelClass of Plant-Specific Growth Regulators.Frontiers in Plant Science,2016,7:417.

[0012] Ma J, Li C, Zong M, Qiu Y, Liu Y, Huang Y, Xie Y, Zhang H, Wang J. CmFSI8 / CmOFP13 encoding an OVATE family protein controls fruit shape inmelon. Journal of Experimental Botany, 2022, 73(5): 1370-1384. Summary of the Invention

[0013] The technical problem to be solved by the present invention is to provide a gene for regulating the vine length and fruit length of melon, its encoding protein and its use.

[0014] According to the annotation data of the melon genome, the present invention obtains the target gene CmOVATE from the melon material using high-fidelity DNA polymerase. The nucleotide sequence of the gene coding region is shown in Sequence 1, and the protein sequence encoded by it is shown in Sequence 2.

[0015] The present invention further constructed a plant overexpression vector of the gene. By overexpressing the CmOVATE gene in melon, it was found that the CmOVATE gene is an important regulatory gene for melon growth and development. High expression of this gene can significantly shorten the vine length and fruit length of melon plants, proving that the gene and its encoded protein can be used to regulate the vine length and / or fruit length of melon.

[0016] In order to solve the above problems, the primary purpose of the present invention is to provide a biological material for regulating the expression of the gene CmOVATE.

[0017] Another object of the present invention is to provide a use of a biological material for regulating the expression of the gene CmOVATE.

[0018] A third object of the present invention is to provide a method for regulating melon vine length and / or fruit length.

[0019] To achieve the above-mentioned purpose, the present invention provides the following technical solutions:

[0020] The first aspect of the present invention provides a biomaterial for regulating the expression of the gene CmOVATE, wherein the biomaterial is any one of the following (1) to (4):

[0021] (1) the nucleotide sequence encoding the gene CmOVATE shown in Sequence 1 in the sequence listing or the nucleotide sequence encoding the amino acid sequence shown in Sequence 2 in the sequence listing;

[0022] (2) an expression cassette containing the nucleotide sequence described in (1);

[0023] (3) a recombinant vector containing the nucleotide sequence described in (1) or a recombinant vector containing the expression cassette described in (2);

[0024] (4) A recombinant microorganism containing the nucleotide sequence described in (1), a recombinant microorganism containing the expression cassette described in (2), or a recombinant microorganism containing the recombinant vector described in (3).

[0025] In the present invention, the coding nucleotide sequence (CDS) of the gene CmOVATE may be any one of (a1) to (a3) ​​in addition to that shown in SEQ ID NO: 1.

[0026] (a1) a nucleotide sequence derived from the nucleotide sequence shown in SEQ ID NO: 1 by adding, substituting or deleting one or more nucleotides, and the encoded protein has the function of regulating the vine length and fruit length of melon;

[0027] (a2) a nucleotide sequence that hybridizes with the nucleotide sequence shown in SEQ ID NO: 1 under stringent conditions and encodes a protein that has the function of regulating the vine length and fruit length of melon;

[0028] (a3) The nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO: 2.

[0029] In the present invention, the stringent conditions may be hybridization at 65° C. in a 0.1×SSPE solution containing 0.1% SDS or a 0.1×SSC solution containing 0.1% SDS, and washing the membrane with the solution.

[0030] In the present invention, a recombinant vector containing the gene CmOVATE can be constructed using basic vectors known in the art, including but not limited to plasmids, bacteriophages (such as lambda phage or M13 filamentous phage), cosmids (i.e., cosmids), Ti plasmids, plant vectors, or viral vectors. Preferably, a plant binary vector is used to construct the recombinant vector, i.e., an overexpression vector containing the CmOVATE gene; further, the plant binary vector is the plant binary vector pYBA1302.

[0031] In the present invention, the recombinant vector may contain an expression cassette comprising the CmOVATE gene and a strong promoter for initiating transcription of the CmOVATE gene. In other words, the expression cassette or the recombinant vector contains a strong promoter for initiating transcription of the CmOVATE gene.

[0032] In the present invention, the strong promoter can be selected from any one or more of the following: CaMV 35S promoter, UBQ10 promoter, Nos promoter, Actin2 promoter or RbcS promoter, preferably CaMV 35S promoter.

[0033] Specifically, the biological material is the CmOVATE gene overexpression vector pYBA1302-35s::CmOVATE.

[0034] The biological material may also be a transgenic cell line or host bacteria containing an overexpression vector of the CmOVATE gene; the host bacteria may be Agrobacterium, preferably EHA105 Agrobacterium.

[0035] Specifically, the biological material is EHA105 Agrobacterium containing the CmOVATE gene overexpression vector pYBA1302-35s::CmOVATE.

[0036] A second aspect of the present invention provides a use of a biomaterial for regulating the expression of the gene CmOVATE, wherein the biomaterial acts by increasing the expression of the gene CmOVATE. The biomaterial is the biomaterial described in the first aspect above, and the use is one of the following:

[0037] (A) Use for regulating the shortening of melon vine length and / or fruit length;

[0038] (B) Use in the preparation of a product for regulating the shortening of melon vine length and / or fruit length;

[0039] (C) Use in breeding new melon varieties with shortened vine length and / or fruit length.

[0040] A third aspect of the present invention provides a method for regulating vine length and / or fruit length of melons, the method comprising the following steps: introducing into a melon material a biological material for regulating the expression of the gene CmOVATE described in the first aspect.

[0041] In the present invention, the muskmelon material includes any existing muskmelon variety, especially the Yangjiaocui variety.

[0042] After the biological material is successfully introduced into the melon material, the expression of the gene CmOVATE can be increased to shorten the vine length and fruit length of the melon.

[0043] Furthermore, the biomaterial can enhance the activity and / or increase the content of the protein encoded by the gene CmOVATE. By enhancing the activity and / or increasing the content of the protein encoded by the gene CmOVATE in the melon, the biomaterial shortens the vine length and fruit length of the melon.

[0044] In the present invention, the regulation of the expression of the gene CmOVATE by the biomaterial may be at least one of the following:

[0045] Regulation at the transcriptional level of the gene CmOVATE; regulation after the transcription of the gene CmOVATE (i.e., regulation of the splicing or processing of the primary transcript of the gene CmOVATE);

[0046] Regulation of RNA transport of the gene CmOVATE (i.e., regulation of the transport of mRNA of the gene CmOVATE from the nucleus to the cytoplasm);

[0047] Regulation of translation of the gene CmOVATE; regulation of mRNA degradation of the gene CmOVATE; post-translational regulation of the gene CmOVATE (i.e., regulation of the activity of the protein translated from the gene CmOVATE).

[0048] In the method of the third aspect of the present invention, further, the method further comprises the following step: detecting whether the biological material is successfully introduced to obtain the transgenic plant.

[0049] In the method of the third aspect of the present invention, further, the detection is performed using nucleic acid primers as shown in Sequence 7 and 8 in the sequence listing or a reagent or kit containing the primers.

[0050] The fourth aspect of the present invention provides the use of the transgenic melon obtained by the method according to the third aspect of the present invention in plant breeding.

[0051] In the application of the fourth aspect of the present invention, further, the breeding method includes but is not limited to transgenic, hybridization, backcrossing, selfing or asexual reproduction.

[0052] By means of the above technical solution, the present invention has at least the following significant beneficial effects:

[0053] (1) The present invention provides a melon gene CmOVATE (the nucleotide sequence of the open reading frame is shown in SEQ ID NO: 1) and its encoded protein (the amino acid sequence is shown in SEQ ID NO: 2).

[0054] (2) The present invention constructed an overexpression vector of the CmOVATE gene and obtained a transgenic melon plant overexpressing the gene, thereby achieving the regulation of melon vine length and fruit length.

[0055] (3) This invention reveals the role of the CmOVATE gene and its encoded protein in regulating vine and fruit length in melons. In the future, introducing the CmOVATE gene into melons through conventional hybridization, marker-assisted selection, or genetic engineering could improve vine and fruit length, providing a reference for the breeding of new varieties and possessing important theoretical and practical value. BRIEF DESCRIPTION OF THE DRAWINGS

[0056] Figure 1 This is the vector map of the plant binary vector pYBA1302.

[0057] Figure 2 This is the vector map of the CmOVATE gene overexpression vector pYBA1302-35S::CmOVATE.

[0058] Figure 3 This is the PCR detection of T0 generation transgenic plants.

[0059] Lane 1 is a DL2000 DNA ladder, lanes 2 to 4 are T0 generation melon plants overexpressing the CmOVATE gene; lane 5 is a pYBA1302-35S::CmOVATE plasmid positive control, and lane 6 is a negative untransformed B8 control.

[0060] Figure 4 Phenotypes of T2 transgenic and wild-type plants. Bar = 10 cm.

[0061] Figure 5 The fruit phenotypes of T2 transgenic plants and wild-type plants. bar = 15 cm. DETAILED DESCRIPTION

[0062] In order to enable those skilled in the art to better understand the present invention, the present invention will be further described below in conjunction with specific examples. It should be noted that the following description is exemplary and is not intended to limit the present invention. In the examples, unless otherwise specified, the experimental methods used are all conventional methods in the art, and the reagents used, etc., can all be obtained through commercial channels, and the instructions for use are carried out according to the conditions recommended by the manufacturer.

[0063] The test material B8 used in the following examples (recorded in: Ma Jian, Li Congcong, Huang Yating, Xie Yuli, Cheng Lingling, Wang Jianshe, Fine positioning and candidate gene analysis of melon seed coat color control gene CmSC1, Chinese Agricultural Science, 2021, 54(10): 2167-2178) is available to the public from the applicant. The biological material is only used to repeat the relevant experiments of the present invention and cannot be used for other purposes.

[0064] Plant binary vector pYBA1 302 ( Figure 1 ), with the gene accession number being GenBank: KU221178.1. According to the use record in the literature “Yang F, Liu G, Wu Z, Zhang D, Zhang Y, You M, Li B, Zhang X, Liang R, Cloning and Functional Analysis of TaWRI1Ls, the Key Genes for Grain Fatty Acid Synthesis in Bread Wheat, International Journal of Molecular Sciences, 2022, 23(10): 5293”, the vector in the present invention was purchased from Shanghai Newpu Biotechnology Co., Ltd. The public can obtain it from the applicant.

[0065] The quantitative tests in the following examples were all repeated at least three times, and the results were averaged.

[0066] Example 1. Acquisition of the CmOVATE gene sequence of melon

[0067] 1. According to the annotation of the melon reference genome (http: / / cucurbitgenomics.org / v2 / ), the CmOVATE gene does not contain intron sequences. Therefore, the coding region sequence of this gene was obtained directly from the melon genome. Specific amplification primers for this gene were designed using the online primer design software Primer-BLAST:

[0068] CmOVATE-1F: 5′-ATGATGACGCCAAAACGATTC-3′, sequence 3;

[0069] CmOVATE-1R: 5′-TCAGTTATTACAGAACAGAGA-3′, sequence 4.

[0070] Second, melon accession B8 was planted and seedling leaf samples were collected two weeks later. Genomic DNA was extracted using the CTAB method after grinding with liquid nitrogen. The extracted genomic DNA was used as a template to amplify the coding region of the CmOVATE gene using primers CmOVATE-1F and CmOVATE-1R.

[0071] The PCR reaction system was as follows: 25 μL of 2× PCR Buffer for KOD FX, 10 μL of dNTPs (2 mmol / L each), 2 μL of primers (10 μmol / L, 1 μL each of CmOVATE-1F and CmOVATE-1R), 1 μL of KOD FX enzyme (1 U / μL, TOYOBO), 2 μL of genomic DNA (50 ng / μL), and ddH O was added to 50 μL.

[0072] Amplification reaction conditions: pre-denaturation at 94°C for 2 min; denaturation at 98°C for 10 s, annealing at 59°C for 30 s, extension at 68°C for 1 min, 35 cycles; extension at 68°C for 5 min, and storage at 4°C.

[0073] Third, the amplified PCR products were examined by 1% agarose gel electrophoresis. The target band was excised with a clean razor blade, and the target DNA fragment was recovered and purified using an agarose gel extraction kit (Beijing Biomed Gene Technology Co., Ltd.). The purified target DNA fragment was then sent to Beijing Tianyi Huiyuan Biotechnology Co., Ltd. for sequencing. The resulting sequences were assembled and aligned using DNAMAN software.

[0074] 4. The obtained nucleotide sequence is shown as Sequence 1 in the sequence listing, which is the coding region sequence of the CmOVATE gene, which encodes the CmOVATE protein, and its amino acid sequence is shown as Sequence 2 in the sequence listing.

[0075] Example 2: Construction of the melon CmOVATE gene overexpression vector YBA1302-35S::CmOVATE

[0076] 1. Obtaining the target fragment.

[0077] According to the reference genome sequence, the CmOVATE gene-specific amplification primers CmOVATE-1F and CmOVATE-1R in Example 1 were introduced into the vector homologous recombination sequence to obtain the vector-specific amplification primers for the gene:

[0078] CmOVATE-2F:

[0079] CGCTCTAGAACTAGTGG AGATGATGACGCCAAAACGATTC, sequence 5, the underlined sequence is the sequence used for homologous recombination;

[0080] CmOVATE-2R:

[0081] CTTGATATCGAATTCCTG TCAGTTATTACAGAACAGAGA, sequence 6, the underlined sequence is the sequence used for homologous recombination).

[0082] Using the specific amplified fragment of the CmOVATE gene obtained in Example 1 as a template, primers CmOVATE-2F and CmOVATE-2R were used as the second amplification primers, and the coding region fragment of the CmOVATE gene was amplified by high-fidelity KOD enzyme (TOYOBO). The PCR reaction system and procedure were as follows:

[0083] 25 μL of 2× PCR Buffer for KOD FX, 10 μL of dNTPs (2 mmol / L each), 2 μL of primers (10 μmol / L, 1 μL each of CmOVATE-2F and CmOVATE-2R), 1 μL of KOD FX enzyme (1 U / μL, TOYOBO), 1 μL of template DNA (specific amplification fragment of the CmOVATE gene obtained in Example 1), and ddH O were added to 50 μL.

[0084] Amplification reaction conditions: as in Example 1, Part II.

[0085] The amplified PCR products were identified by 1% agarose gel electrophoresis, and the target DNA fragments were recovered and purified using an agarose gel recovery kit (Beijing Biomed Gene Technology Co., Ltd.) for later use.

[0086] 2. Linearization of pYBA1302 plasmid.

[0087] The pYBA1302 plasmid was digested with the restriction endonucleases BamHI and PstI (Thermo Fisher Scientific Inc.). The digestion system was as follows: 2 μg of pYBA1302 plasmid, 2 μL of BamHI, 2 μL of PstI, 3 μL of 10X FastDigest Buffer, and ddH2O added to a 30 μL volume. The reaction mixture was digested in a 37°C water bath for 4 h. The digestion product was purified by 1% agarose gel electrophoresis and recovered for later use.

[0088] 3. Ligate the linearized plasmid and the target fragment.

[0089] Take 2 μL of the pYBA1302 linearized plasmid after enzyme digestion, 3 μL of the PCR products amplified and purified from CmOVATE-2F and CmOVATE-2R, and 5 μL of 2×Seamless Cloning Mix (Beijing Bomade Gene Technology Co., Ltd.), mix them well, and place them in a PCR instrument at 50°C for 15 minutes.

[0090] 4. Transformation of ligation products.

[0091] 10 μL of the ligation product was transformed into DH10B competent cells (Beijing Biomed Gene Technology Co., Ltd.), evenly spread on LB solid medium containing 50 μg / mL kanamycin resistance, and placed in an inverted incubator at 37°C for 16 h.

[0092] 5. Identification of transformants.

[0093] Pick a single clone and perform PCR identification using vector-specific identification primers 1302-F and 1302-R:

[0094] 1302-F: 5'-TGACGTAAGGGATGACGCAC-3', sequence 7;

[0095] 1302-R: 5'-CTCAACACATGAGCGAAACCC-3', sequence 8.

[0096] The PCR amplification procedure was as described in Example 1. The target band size of the positive clone was approximately 1216 bp. The PCR product was then sent to Beijing Tianyi Huiyuan Biotechnology Co., Ltd. for sequencing. The obtained sequences were spliced ​​and aligned using DNAMAN software. The clone whose sequence obtained by sequencing contained the DNA sequence shown in SEQ ID NO: 1 was the correct positive clone. The clone was then shaken and the plasmid was extracted. The plasmid corresponding to the positive clone was the constructed CmOVATE gene overexpression vector pYBA1302-35S::CmOVATE( Figure 2 ).

[0097] Example 3: Acquisition and phenotypic identification of transgenic plants

[0098] 1. Transformation of Agrobacterium with recombinant plasmid pYBA1302-35S::CmOVATE

[0099] Take 100 ng of the gene overexpression vector pYBA1302-35S::CmOVATE prepared in Example 2, and use the heat shock method to transform the plasmid into EHA105 Agrobacterium competent cells (Beijing Bomade Gene Technology Co., Ltd.), evenly spread it on LB solid culture medium containing 50 μg / mL kanamycin and 50 μg / mL rifampicin resistance, and place it in an incubator at 28°C for 2-3 days.

[0100] A single colony was picked and placed in LB liquid culture medium containing 50 μg / mL kanamycin and 50 μg / mL rifampicin, and cultured with shaking at 28° C. overnight to obtain transformants.

[0101] 1 μL of bacterial solution was taken and PCR identification was performed using the vector-specific identification primers 1302-F and 1302-R and the method described in Example 2. The clone with the target band size of about 1216 bp was the positive recombinant bacterium, and the bacterial solution was then frozen at -80°C for later use.

[0102] 2. Obtaining melon plants overexpressing the CmOVATE gene

[0103] The recombinant bacteria pYBA1302-35S::CmOVATE were transformed into the recipient wild-type melon material B8 using the Agrobacterium-mediated melon genetic transformation method described by Xin et al. (Xin T, Tian H, Ma Y, Wang S, Yang L, Li X, Zhang M, Chen C, Wang H, Li H, Xu J, Huang S, Yang X. Targeted creating new mutants with compact plant architecture using CRIS PR / Cas9 genome editing by an optimized genetic transformation procedure in cucurbit plants. Horticulture Research. 2022, 9: uhab086), and finally three T0 generation transgenic plants were obtained, named #OE1, #OE2 and #OE3.

[0104] The genomic DNA of the three T0 generation plants was extracted using the CTAB method, and PCR identification was performed using the primer pair 1302-F and 1302-R and the method described in Example 2.

[0105] Identification results such as Figure 3 As shown, lane 1 is DL2000DNA ladde r Lanes 2 to 4 represent T0-generation muskmelon plants overexpressing the CmOVATE gene; lane 5 represents the positive plasmid DNA template, and lane 6 represents the wild-type B8 negative control. All three T0-generation plants amplified a band consistent with the vector size (1216 bp). The PCR amplification product was then sent to Beijing Tianyi Huiyuan Biotechnology Co., Ltd. for sequencing. The resulting sequence contained a portion of the vector and the nucleotide sequence shown in SEQ ID NO: 1 in the sequence listing, indicating that all three T0-generation regenerated plants were positive transgenic plants.

[0106] 3. Genotypic and phenotypic identification of melon plants overexpressing the CmOVATE gene

[0107] Three T0 generation positive transgenic plants were self-pollinated at the flowering stage to obtain T0 generation seeds; 10 T0 generation seeds were sown from each individual plant, and the genomic DNA of each individual plant was extracted using the CTAB method and PCR identification was performed using the primer pair 1302-F and 1302-R and the method described in Example 2. The positive individual plants were self-pollinated at the flowering stage to obtain T1 generation family seeds; subsequently, one family was randomly selected from the three T1 generation positive families and 15 T1 generation seeds were sown, and PCR identification was performed using the primer pair 1302-F and 1302-R and the method described in Example 2 to obtain a positive T2 generation family.

[0108] The wild-type B8 and positive T1 and T2 generation family plants were artificially pollinated at the flowering stage, and the vine length and fruit length of each individual plant were phenotypically measured at the fruit ripening stage.

[0109] The results showed that: the wild-type B8 plant had a vine length of 266.3±34.7cm and a fruit length of 29.7±2.7cm; the T1 transgenic positive plants, #OE1 had a vine length of 141.7±1.5cm and a fruit length of 10.0±1.1cm, #OE2 had a vine length of 131.7±2.9cm and a fruit length of 11.4±0.7cm, #OE3 had a vine length of 121.3±6.1cm and a fruit length of 12.4±0.2cm; T2 The vine length of the first-generation transgenic plant family #OE1 was 139.9±2.9 cm, and the fruit length was 10.4±1.2 cm; the vine length of #OE2 was 135.3±1.9 cm, and the fruit length was 11.9±1.0 cm; the vine length of #OE3 was 124.8±3.0 cm, and the fruit length was 12.2±0.6 cm. These data indicate that overexpression of the CmOVATE gene significantly inhibited organ elongation, resulting in a significant shortening of the vine length and fruit length of melon plants ( Figure 4 and Figure 5 ).

[0110] From the above results, it can be seen that overexpressing the CmOVATE gene using the gene expression method of the present invention can quickly produce melon materials with altered vine length and fruit length, and this variation can be stably inherited. The melon plants overexpressing the CmOVATE gene can also be directly used in the creation and breeding of new melon germplasm through sexual hybridization, which has important application value and breeding prospects.

[0111] The above embodiments are merely exemplary descriptions of the present invention, but the implementation methods of the present invention are not limited to the varieties or materials in the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not violate the spirit and principles of the present invention should be considered as equivalent replacement methods and fall within the scope of protection of the present invention.

Claims

1. A biomaterial for regulating the expression of the gene CmOVATE, characterized in that: The biomaterial is any one of the following (1) to (4): (1) the nucleotide sequence encoding the gene CmOVATE as shown in Sequence 1 in the sequence listing or the nucleotide sequence encoding the amino acid sequence as shown in Sequence 2 in the sequence listing; (2) an expression cassette containing the nucleotide sequence described in (1); (3) a recombinant vector containing the nucleotide sequence described in (1) or a recombinant vector containing the expression cassette described in (2); (4) A recombinant microorganism containing the nucleotide sequence described in (1), a recombinant microorganism containing the expression cassette described in (2), or a recombinant microorganism containing the recombinant vector described in (3).

2. The biomaterial for regulating gene expression of CmOVATE according to claim 1, characterized in that: The promoter of the gene CmOVATE in the expression cassette or the recombinant vector is CaMV 35S.

3. The biomaterial for regulating gene expression of CmOVATE according to claim 1, characterized in that: The host bacteria for forming the recombinant microorganism is Agrobacterium EHA105.

4. The biomaterial for regulating gene expression of CmOVATE according to claim 1, characterized in that: The basic vector forming the recombinant vector is a plant binary vector.

5. The biomaterial for regulating gene expression of CmOVATE according to claim 4, characterized in that: The plant binary vector is the plant binary vector pYBA1302.

6. Use of a biomaterial for regulating the expression of a gene CmOVATE, characterized in that: The biomaterial functions by increasing the expression of the gene CmOVATE. The biomaterial is the biomaterial according to any one of claims 1 to 5. The use is one of the following uses: (A) Use for regulating the shortening of melon vine length and / or fruit length; (B) Use in the preparation of a product for regulating the shortening of melon vine length and / or fruit length; (C) Use in breeding new melon varieties with shortened vine length and / or fruit length.

7. A method for regulating melon vine length and / or fruit length, characterized in that: The method comprises the following steps: The invention relates to introducing the biological material for regulating the expression of the gene CmOVATE according to any one of claims 1 to 5 into a melon material; and detecting whether the biological material is successfully introduced to obtain a transgenic plant.

8. The method for regulating melon vine length and / or fruit length according to claim 7, characterized in that: The detection is performed using the following primer pair or a reagent or kit comprising the primer pair, wherein the forward primer and the reverse primer of the primer pair are: Forward primer: 5′-TGACGTAAGGGATGACGCAC-3′; Reverse primer: 5′-CTCAACACATGAGCGAAACCC-3′.

9. The method for regulating melon vine length and / or fruit length according to claim 7, characterized in that: The method for introducing the biological material into melon material is Agrobacterium transformation.

10. The method for regulating melon vine length and / or fruit length according to claim 7, characterized in that: The method further comprises a step of phenotypic identification of the transgenic plants.

Images