DgCIN4 gene for regulating tillering and application thereof

By discovering and verifying the overexpression vector of the DgCIN4 gene, the limitations of existing Dactylis grass tillering regulatory genes were resolved, the breeding goals of high tiller number and high yield were achieved, and the breeding efficiency was improved.

CN120665898APending Publication Date: 2025-09-19SICHUAN AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510909633.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-02
Publication Date
2025-09-19

AI Technical Summary

Technical Problem

In the existing technology, the Duckgrass tillering regulatory genes DgCCD7 and DgCYC-C1 have limitations in practical applications, making it difficult to effectively promote high tillering and high yield, and the breeding process is complicated. New positive regulatory genes are needed to increase the tiller number and breeding efficiency.

Method used

For the first time, the DgCIN4 gene was discovered and confirmed to be involved in tillering regulation. A DgCIN4 gene overexpression vector was constructed. The DgCIN4 gene was overexpressed in Arabidopsis through transgenic technology to verify its regulatory ability. Transgenic technology was used to promote tillering formation in Dactylis grass and other Poaceae forage crops.

Benefits of technology

Overexpression of the DgCIN4 gene significantly increased the number of tillers by 70%, shortened breeding time, improved breeding efficiency, and promoted the development and utilization of high-quality grass forage.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120665898A_ABST
    Figure CN120665898A_ABST
Patent Text Reader

Abstract

The invention discloses a DgCIN4 gene for regulating tillering and application of the DgCIN4 gene. The nucleotide sequence of the DgCIN4 gene is as shown in SEQ ID NO. 1. The DgCIN4 gene is found for the first time, and the DgCIN4 gene is confirmed to participate in tillering regulation through QTL-seq. A DgCIN4 gene overexpression vector is constructed and transferred into arabidopsis thaliana for functional verification, and the tillering regulation and control capability is determined. Aiming at the defects of slow effectiveness and long period of the traditional forage grass improvement technology, the DgCIN4 is overexpressed by utilizing a transgenic technology, so that the tiller number of the dactylis glomerata can be obviously increased, the breeding time is shortened, the breeding efficiency is improved, and the development and utilization of high-quality gramineous forage grass dactylis glomerata are promoted.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a gene for regulating tillering, and in particular to a gene for regulating tillering. DgCIN4 Genes and their applications. Background Art

[0002] Tillers are specialized branches that develop from lateral buds at the base of the stem of grasses. Tillering primarily occurs during the vegetative growth phase, gradually transitioning to the reproductive phase and developing effective reproductive branches. This is a key determinant of crop yield. For cereal crops, prolific tillering during the reproductive phase is a crucial factor influencing yield. For forage crops, both productive and non-productive tillers during the vegetative and reproductive phases contribute significantly to biomass yield, while productive tillers during the reproductive phase are a significant contributor to forage seed yield. For perennial forage grasses in particular, tillering also influences their asexual reproduction capacity and regeneration potential. Furthermore, tillering is a key determinant of plant structure, influencing yield through photosynthesis and energy supply pathways. Therefore, tillering is a crucial agronomic trait in grasses, particularly perennial forage grasses.

[0003] As an important perennial forage crop in the world, Dactylum sinensis ( Dactylis glomerata L Duckgrass (Cockgrass) is a grass with significant economic and ecological value. Due to its robust tillering ability, high nutritional value, adaptability, and large biomass, Duckgrass is widely utilized and cultivated worldwide. Tillering plays a crucial role in the biomass, seed yield, regeneration potential, and reproduction of Duckgrass and other perennial grass forage crops. Despite its agronomic importance, elucidating the genetic basis of tillering in the perennial forage grass Duckgrass remains slow and challenging due to its complex, highly heterozygous genome.

[0004] So far, only two genes DgCCD7 and DgCYC-C1 It has been shown to regulate the tillering of orchardgrass (Afavorable natural variation in CCD7 from orchardgrass confers enhanced tiller number. Plant Journal, 2025; Genome-wide association analysis reveals novel candidate loci and a gene regulating tiller number in orchardgrass. Plant Physiology and Biochemistry, 2024). However, these two orchardgrass tillering regulatory genes DgCCD7 and DgCYC-C1There are limitations in practical applications, such as DgCCD7 Negative regulation of tillering requires knocking out this gene to obtain new varieties with high tillering and high yield, which is a relatively complicated process; DgCYC-C1 Although the gene can positively regulate tillering, the increase in tillering is small.

[0005] Dactylis grass, an important perennial forage grass, is closely related to major crops such as rice, barley, and wheat. The discovery of genes regulating tillering in Dactylis grass can help diversify research on tillering in major crops like rice and barley, while also providing insights for other crops in the grass family. Therefore, there is an urgent need to identify new genes that can positively regulate Dactylis grass tillering and be used in production practices.

[0006] It should be noted that the information disclosed in the above background technology section is only used to enhance the understanding of the background of the present disclosure, and therefore may include information that does not constitute prior art known to ordinary technicians in the field. Summary of the Invention

[0007] The purpose of the present invention is to provide a method for regulating tillering. DgCIN4 Genes and their applications, first discovered DgCIN4 genes and confirmed by QTL-seq DgCIN4 Genes involved in tillering regulation.

[0008] In order to achieve the above object, the present invention provides a method for regulating tillering. DgCIN4 Gene, the DgCIN4 The nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0009] The second object of the present invention is to provide a DgCIN4 protein for regulating tillering, the amino acid sequence of the DgCIN4 protein is shown in SEQ ID NO.2.

[0010] The third object of the present invention is to provide a DgCIN4 Gene expression vector.

[0011] The fourth object of the present invention is to provide a DgCIN4 Engineering bacteria with gene expression vectors.

[0012] The fifth object of the present invention is to provide the DgCIN4 The application of the gene, or the DgCIN4 protein, or the expression vector, or the engineered bacteria in regulating tillering.

[0013] Preferably, the method is used in regulating tillering of gramineous forage crops.

[0014] The sixth object of the present invention is to provide a method for constructing the DgCIN4 A method for overexpressing a gene vector, the method comprising: Construct containing the DgCIN4 The recombinant vector of the gene; using the recombinant vector as a template DNA, the upstream primer DgCIN4-p2-F shown in the sequence of SEQ ID NO.5 and the downstream primer DgCIN4-p2-R shown in the sequence of SEQ ID NO.6 were amplified containing the Sali and PstI restriction sites. DgCIN4 Gene; The vector pCAMBIA1300-35S digested with Sali and PstI was cloned with the vector containing Sali and PstI restriction sites. DgCIN4 The gene is connected in vitro; the connection product is transformed into competent cells to obtain DgCIN4 Gene overexpression vector.

[0015] Preferably, the recombinant vector is constructed using pMD19-T vector.

[0016] Preferably, the amplification system comprises: 2×PCR Buffer for KOD FX Neo, dNTPs, upstream primer DgCIN4-p2-F, downstream primer DgCIN4-p2-R, template DNA, KOD FX Neo and ddH2O; the PCR reaction program is: pre-denaturation at 95°C for 3 min; cycles of denaturation at 95°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 2 min, 35 cycles; and extension at 72°C for 5 min.

[0017] Preferably, the in vitro ligation system comprises: 10×T4 DNA Ligase Buffer, DgCIN4 Gene, vector pCAMBIA1300-35S digested with Sali and PstI, T4 DNA Ligase and ddH2O.

[0018] The seventh object of the present invention is to provide a method for constructing the DgCIN4 A method for overexpressing a gene in a plant, the method comprising: The overexpression vector constructed by the method is transformed into Agrobacterium; the Agrobacterium is resuspended in a sucrose solution to obtain an impregnation solution; a surfactant is added to the impregnation solution and plants are impregnated; the impregnated plants are bagged and cultured in a dark room in a moist state to ensure sufficient water; seeds are harvested after maturity, and transgenic seeds are screened using a plate containing hygromycin antibiotics; after the transgenic seeds are germinated on an MS+hygromycin plate, positive plants are transferred to soil for further culture.

[0019] Preferably, the positive plants are verified by PCR using the upstream primer DG349-F with a sequence as shown in SEQ ID NO.7 and the downstream primer DG349-R with a sequence as shown in SEQ ID NO.8.

[0020] Preferably, the surfactant is Silwet-77.

[0021] The present invention regulates tillering DgCIN4 Genes and their applications have the following advantages: The present invention first discovered DgCIN4 genes and confirmed by QTL-seq DgCIN4 The gene is involved in tillering regulation. DgCIN4 The gene overexpression vector was transferred into Arabidopsis for functional verification to determine its regulatory ability on tillering.

[0022] The present invention DgCIN4 Genes similar to those reported in rice, Arabidopsis thaliana, and Brachypodium distachyon CIN4 The gene sequence similarity is about 76%, and there may be some differences in function. DgCIN4 The gene can promote the formation of tillers, which provides a reference for the future breeding of high-tillering and high-yield forage varieties, and can be applied to Dactylis and other grass forage crops. In view of the shortcomings of traditional forage improvement technology, which is slow to take effect and has a long cycle, the use of genetic modification technology can improve the DgCIN4 Overexpression can significantly increase the number of Dactylis grass tillers, shorten breeding time, improve breeding efficiency, and promote the development and utilization of high-quality Poaceae forage Dactylis grass.

[0023] The present invention DgCIN4 Compared with the previously reported positive regulatory genes for tiller number, the proportion of increased tiller number increased by over 50% to 70%. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Picture 1 The present invention identifies QTLs involved in tillering regulation. DgCIN4 Gene.

[0025] Picture 2 For the present invention DgCIN4 qRT-PCR results of gene expression at different tiller development stages.

[0026] Picture 3 For the present invention DgCIN4 PCR product identification results of Arabidopsis positive plants with gene overexpression.

[0027] Picture 4 For the present invention DgCIN4 Comparison of tillering phenotypes between gene-overexpressing Arabidopsis and wild type.

[0028] Picture 5 For the present invention DgCIN4 Statistical results of tiller numbers in gene-overexpressing Arabidopsis and wild type. DETAILED DESCRIPTION

[0029] The following is a clear and complete description of the technical solutions in the embodiments of the present invention. Obviously, the embodiments described are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making any creative efforts are within the scope of protection of the present invention.

[0030] Note: If specific conditions are not specified in the examples, the experiments were conducted under conventional conditions or those recommended by the manufacturer. Instruments used without manufacturer information are commercially available. Raw materials and reagents used without manufacturer information are commercially available or can be prepared by known methods.

[0031] Throughout this disclosure, all features, such as values, amounts, amounts, and concentrations, specified in numerical ranges or percentage ranges are provided for simplicity and convenience only. Accordingly, the description of numerical ranges or percentage ranges should be considered to encompass and specifically disclose all possible subranges and individual values ​​within those ranges (including integers and fractions).

[0032] The features described in this disclosure may be combined in any manner, and as long as there are no conflicts between the combinations of these features, all possible combinations should be considered within the scope of this specification. Each feature disclosed in this specification may be replaced by any alternative feature that provides the same, equivalent, or similar purpose. Therefore, unless otherwise specified, the features disclosed are merely general examples of equivalent or similar features.

[0033] The materials used in the following experimental examples are as follows: The high-tillering Duckweed variety "AKZ-NRGR667" was selected as the experimental material and planted in the Wenjiang campus of Sichuan Agricultural University.

[0034] Experimental Example 1 DgCIN4 Gene mapping Using the high-tillering Duckweed material "AKZ-NRGR667" and the low-tillering material "D20170203" as parents, the female parent "D20170203" and the male parent "AKZ-NRGR667" were crossed to obtain 9 F1 plants. The D-4-15 plant in the F1 was self-pollinated to produce an F2 population, and a total of 275 F2 plants with separated phenotypes were obtained. The number of tillers of all F2 plants was counted during the flowering period and arranged in descending order. Finally, the top 30 F2 plants with the highest number of tillers were selected to form the sequencing high-tiller pool, and the bottom 30 F2 plants with the lowest number of tillers were selected to form the sequencing low-tiller pool. The high-tiller and low-tiller pools were sequenced using BSA for QTL analysis, see [1]. Picture 1 In the candidate interval of Chr2 247Mb~251Mb, tillering regulatory genes were identified DgCIN4 .

[0035] Experimental Example 2 DgCIN4 Gene qRT-PCR analysis Leaf tissue samples from AKZ-NRGR6667 were collected at five stages: tiller bud, fully expanded first leaf, fully expanded second leaf, fully expanded third leaf, and fully expanded fourth leaf, with three biological replicates. Samples were snap-frozen in liquid nitrogen and stored at -80°C for RNA extraction. Total RNA was extracted using the HiPure plant RNA Mini (Guangzhou, China). 1 μg of RNA was used as a template for reverse transcription. Reverse transcription was then performed using MonScript™ RTIII All-in-One Mix with dsDNase (Wuhan, China) to generate cDNA template. qRT-PCR reactions were then performed on a Bio-RAD CFX Connect (California, USA) using the MonAmp™ SYBR Green qPCR Kit (Wuhan, China) protocol.

[0036] The qRT-PCR reaction system was 10 μL and contained 5.0 μL SYBR Green qPCR Mix, 0.2 μL upstream and downstream primers, 3.6 μL HO, and 1 μL of a 4-fold diluted cDNA sample. The above experiments adhered to strict quantitative experimental standards and were performed with three biological replicates and three technical replicates. The sequences of the quantitative primers are as follows:

[0037] Forward primer q-CIN4-F: AGTATAACCCCGGAGGCACT; Reverse primer q-CIN4-R: TCCCGTACCATTGCAGGTTC; GAPDH was used as the internal reference gene, and the primer sequences used were as follows: Forward primer GAPDH-F: TCTGACCGTTAGACTTGAGAAGG; Reverse primer GAPDH-R: CTTGAGCTTACCCTCAGACTCCT.

[0038] With 2 -ΔΔCT The gene expression levels were calculated.

[0039] like Picture 2 As shown, the present invention DgCIN4 The expression of genes at different tiller development stages, where A_HB refers to the bud stage, A_L1 refers to the fully expanded first leaf of the tiller, A_L2 refers to the fully expanded second leaf, A_L3 refers to the fully expanded third leaf, and A_L4 refers to the fully expanded fourth leaf. Fluorescence quantitative results show that DgCIN4 They are highly expressed during the tiller bud formation period and may participate in the regulation of Dactylis glomerata tillering by regulating the formation of tiller buds.

[0040] Experimental Example 3 DgCIN4 Gene cloning 1. Amplification of target fragment Primers DgCIN4-p1-F and DgCIN4-p1-R were designed using the cDNA of the orchardgrass variety "AKZ-NRGR667" as a template. Amplification was performed using the TaKaRa PrimeSTAR Max DNA Polymerase Kit. The protocol was as described in the included instructions. The PCR amplification system is shown in Table 1. The reaction conditions were: initial denaturation at 95°C for 3 min; 35 cycles of denaturation at 95°C for 30 s, annealing at 60°C for 15 s, and extension at 72°C for 2 min; and a final run at 72°C for 10 min. PCR products were detected by 0.8% agarose gel electrophoresis.

[0041] The upstream primer DgCIN4-p1-F sequence (SEQ ID NO.3) is as follows: ttccatggccaatgcttgggcc; Downstream primer: DgCIN4-p1-R sequence (SEQ ID NO.4) is as follows: tcaacccgtatttacattcacttgt.

[0042] Table 1 PCR amplification system 2. Gene cloning Cut the gel under UV light and use TaKaRa's MiniBEST Agarose Gel DNA Extraction Kit to recover and purify the target fragment. For specific operations, refer to the enclosed instructions.

[0043] Take 4 μL of the purified DNA solution, add 1 μL of the pMD19-T vector and 5 μL of the solution (containing ligase), mix well, and react at 16°C for 30 minutes. After completion of the reaction, the pMD19-T-DgCIN4 recombinant plasmid is obtained. Add this plasmid to 100 μL of DH5α competent cells, incubate on ice for 30 minutes, heat at 42°C for 45 seconds, and then place on ice for 2 minutes. Add 800 μL of LB medium to the transformed competent cells and incubate at 37°C for 60 minutes. Plate the cells on LB medium containing ampicillin (AMP) and invert the plate to incubate overnight. After incubation, single colonies are selected and cultured, and PCR is performed to verify successful insertion of the target fragment. Paired-end sequencing is performed to confirm successful cloning.

[0044] DgCIN4 The gene fragment is 1752 bp in length and can encode a protein containing 585 amino acids. The gene sequence is shown in SEQ ID NO.1 and the protein sequence is shown in SEQ ID NO.2.

[0045] DgCIN4 The gene sequence (SEQ ID NO.1) is as follows:

[0046] The DgCIN4 protein sequence (SEQ ID NO. 2) is as follows: .

[0047] Experimental Example 4 DgCIN4 Gene transfer into Arabidopsis thaliana and functional analysis 1. Target gene amplification According to the map of the vector pCAMBIA1300-35S, Sali and PstI insertion sites were designed. Primers DgCIN4-p2-F and DgCIN4-p2-R were synthesized and amplified using a high-fidelity enzyme. The amplification system is shown in Table 2. The PCR reaction program included a 3-minute initial denaturation at 95°C, followed by 35 cycles of denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, and extension at 72°C for 2 minutes, followed by a 5-minute extension at 72°C. The PCR product was electrophoresed on a 1.8% agarose gel at 150 V for 15 minutes. The electrophoresis results were photographed and observed under UV light. The target band was then quickly excised. The target fragment was recovered using a gel extraction kit (OMEGA) according to the kit instructions.

[0048] The sequence of the upstream primer DgCIN4-p2-F (plasmid homology sequence-Sali-amplification primer) is as follows (SEQ ID NO. 5): cggggatcctctagagtcgacATGGCCAATGCTTGGGCC; The sequence of the downstream primer DgCIN4-p2-R (plasmid homologous sequence-PstI-amplification primer) is as follows (SEQ ID NO. 6): aatgtttgaacgatcctgcagTCAACCCGTATTTACATTCACTTGT.

[0049] Table 2 PCR amplification system 2. Overexpression vector construction (1) The target gene containing Sali and PstI restriction sites DgCIN4 In vitro ligation was performed with the vector pCAMBIA1300-35S digested with Sali and PstI. The ligation system is shown in Table 3. Table 3. Ligation system of target gene and pPic9K recombinant plasmid

[0050] Mix by pipetting, centrifuge and add mineral oil; ligate at 16°C for 2 h; store in a 4°C refrigerator overnight.

[0051] (2) Transformation of ligation products a. Sterilize the clean bench for 30 minutes, take out 100 μL of competent E. coli cells from the -70°C ultra-low temperature freezer, place them on ice, and pre-cool for 10 minutes; b. Take out an Eppendorf tube, mark it, place it on ice, and add 80 μL of competent cells (operate on ice); c. Add 10 μL of the ligation product, pipette to mix thoroughly, and place on ice for 30 minutes; d. After the ice bath, heat shock the tube in a 42°C water bath for 90 seconds, then quickly place it in ice and ice bath for 2 minutes. e. Pipette 500 μL of LB liquid culture medium without Kan into the Eppendorf tube, mix well, and place in a shaker at 160 rpm and 37°C for 1 hour; f. Take out the Eppendorf tube from the shaker, centrifuge at 2000-3000 rpm for 5 min, discard 300 μL of the supernatant, gently pipette and mix the remaining bacterial solution, add it to the LB solid culture dish containing Kan, spread it evenly with a glass spreading rod, and spread it dry; culture it in a 37°C constant temperature incubator for 16-20 h.

[0052] 3. Arabidopsis transformation (1) Agrobacterium transformation: Take out the competent GV3101 from the -80℃ refrigerator, thaw on ice for 2~3 minutes, add 3~5μL of recombinant plasmid, and place on ice for 5 minutes. Place the EP tube in liquid nitrogen for quick freezing for 1 minute, place in a 37℃ water bath for 5 minutes, place on ice for 2 minutes, add 800μL of antibiotic-free liquid LB medium, and culture at 28℃ shaker at 150rpm / min for 3 hours. Centrifuge at 8000rpm / min for 1 minute, discard 600μL of the supernatant, suspend, and apply to solid LB medium (containing 50μg / mL Kan and 50μg / mL rifampicin), and culture in an incubator at 28℃ for 48 hours. Pick a single clone and identify it by PCR using gene-specific primers DG349-F / R primers;

[0053] (2) Arabidopsis planting: Choose a soil with good water absorption and soft vermiculite mixed with substrate (mass ratio 2:1) as the soil for Arabidopsis planting. Choose a flower pot with a diameter of 9 cm and sow 50-100 seeds in each pot. After sowing, water and cover the soil to provide a moist environment for the growth of the plants. The growth conditions for Arabidopsis in the room are a light intensity of 2000-3000 lx, a light duration of 14 hours / day, and a humidity of 40-60%;

[0054] (3) Transplanting: 10-15 days after sowing, when the Arabidopsis seedlings have grown to four leaves, transplant them, 4-5 seeds per pot; (4) Topping: Water the plants every three days after transplanting and add nutrient solution every two weeks. After about 25 to 30 days, cut off the flower buds when the Arabidopsis first blooms. This can promote the proliferation of more flower branches on the side branches. The flowers of the plants suitable for transformation have not matured and have not produced fertilized siliques.

[0055] (5) Prepare the infection solution: Resuspend the aforementioned Agrobacterium in 5% sucrose solution to an OD of 600nm = 0.8. To keep the sucrose solution fresh, it can be prepared and used immediately without sterilization. 100-200 mL can be used to infect 2-3 small pots of plants, and 400-500 mL can be used to infect 2-3 9cm pots of plants. Add the surfactant Silwet-77 to a concentration of 0.05% (500 μL / L) before inoculation.

[0056] (6) Infection: Immerse the surface of the flower of Arabidopsis thaliana at the flowering stage in the Agrobacterium suspension for 20–30 seconds while gently rotating; (7) Dark culture: bag the infected plants and culture them in a dark room under high humidity for 24 hours; (8) Cultivation after immersion: Water every other day to ensure sufficient moisture; (9) Seed collection: Seeds can be collected after the seeds are mature and the siliques naturally crack; (10) Screening of transgenic seeds: Culture the seeds obtained by immersion on plates containing hygromycin antibiotics. About 200 seeds of 40 mg are vernalized for 2 days on 0.5×MS medium containing 10-50 μg / mL hygromycin, and then cultured under continuous light conditions for 7-10 days. Determine whether they are transgenic seeds based on their growth conditions. Seeds that have been successfully transferred with the recombinant plasmid can normally grow more than 4 true leaves on the resistant medium. Non-transgenic seeds cannot grow normally and can only grow 2 cotyledons. The growth of roots is also severely inhibited and they generally die after 10 days of germination.

[0057] (11) Transgenic plants were transferred to soil for cultivation: After the transgenic seeds germinated on MS+hygromycin plates for 2 weeks, the positive plants were transferred to soil for further cultivation. The specific method was as follows: genomic DNA was extracted from the leaves of the positive plants and PCR verification was performed using the target gene-specific primers DG349-F / R sequence. The PCR amplification system is shown in Table 4. The PCR reaction program was as follows: pre-denaturation at 98°C for 5 minutes; the cycle was denaturation at 98°C for 10 seconds, annealing at 55°C for 30 seconds, extension at 72°C for 1 minute, 35 cycles; extension at 72°C for 5 minutes.

[0058] The sequence of the upstream primer DG349-F is as follows (SEQ ID NO.7): gacatacatggttgctggac; The sequence of the downstream primer DG349-R is as follows (SEQ ID NO.8): cagtcatctacgacagcatc.

[0059] Table 4 Amplification system like Picture 3 As shown, the present invention DgCIN4 PCR product identification results of Arabidopsis thaliana positive plants with gene overexpression, among which OE1 ~ 12 are DgCIN4-OE1 ~ 12 The abbreviation of DgCIN4-OE1 ~ 12 for DgCIN4 Arabidopsis thaliana overexpressed the gene, WT is wild type Arabidopsis thaliana, it can be seen that DgCIN4 A band of 557 bp was amplified in the gene-overexpressing Arabidopsis.

[0060] When the T3 generation transgenic plants grew to the bolting stage, the tillers of the transgenic Arabidopsis plants and the non-transgenic wild-type Arabidopsis plants were counted.

[0061] like Picture 4 As shown, the present invention DgCIN4 Gene overexpression in Arabidopsis thaliana ( DgCIN4-OE1 and DgCIN4-OE2 ) and wild type (WT) tillering phenotypes, such as Picture 5 As shown, the present invention DgCIN4 The results showed that the transgenic plants obtained by the present invention had a higher tiller number than the wild type plants. DgCIN4 The tillering ability of the genetic Arabidopsis strain was significantly higher than that of the wild-type Arabidopsis control, with the tillering increasing by more than 70%, indicating that DgCIN4 Gene overexpression can improve the tillering ability of plants.

[0062] Although the present invention has been described in detail through the above preferred embodiments, it should be understood that the above description is not intended to limit the present invention. After reading the above description, various modifications and substitutions of the present invention will become apparent to those skilled in the art. Therefore, the scope of protection of the present invention should be defined by the appended claims.

Claims

1. A method for regulating tillering DgCIN4 A gene characterized by Should DgCIN4 The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

2. A DgCIN4 protein for regulating tillering, characterized in that The amino acid sequence of the DgCIN4 protein is shown in SEQ ID NO.

2.

3. Containing the DgCIN4 Gene expression vector.

4. Containing the DgCIN4 Engineering bacteria with gene expression vectors.

5. The method according to claim 1 DgCIN4 Use of the gene, or the DgCIN4 protein according to claim 2, or the expression vector according to claim 3, or the engineered bacteria according to claim 4 in regulating tillering.

6. A method of constructing the method as claimed in claim 1 DgCIN4 The method for gene overexpression vector is characterized in that The method includes: Constructing a DgCIN4 Recombinant vectors of genes; The recombinant vector was used as template DNA, and the upstream primer DgCIN4-p2-F with the sequence shown in SEQ ID NO.5 and the downstream primer DgCIN4-p2-R with the sequence shown in SEQ ID NO.6 were used to amplify the Sali and PstI restriction sites. DgCIN4 Gene; The vector pCAMBIA1300-35S digested with Sali and PstI was cloned with the vector containing Sali and PstI restriction sites. DgCIN4 Genes were linked in vitro; The ligation product was transformed into competent cells to obtain DgCIN4 Gene overexpression vector.

7. The method according to claim 6, characterized in that The amplification system comprises: 2×PCR Buffer for KOD FX Neo, dNTPs, upstream primer DgCIN4-p2-F, downstream primer DgCIN4-p2-R, template DNA, KOD FX Neo, and ddH2O; the PCR reaction procedure is: pre-denaturation at 95°C for 3 minutes; cycles of denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, and extension at 72°C for 2 minutes, for 35 cycles; and extension at 72°C for 5 minutes.

8. The method according to claim 6, characterized in that The in vitro ligation system includes: 10×T4 DNA Ligase Buffer, DgCIN4 Gene, vector pCAMBIA1300-35S digested with Sali and PstI, T4 DNA Ligase and ddH2O.

9. A method of constructing the method as claimed in claim 1 DgCIN4 A method for gene overexpression in plants, characterized in that The method includes: Transforming the overexpression vector constructed according to any one of claims 6 to 8 into Agrobacterium; Resuspending the Agrobacterium in a sucrose solution to obtain an infection solution; adding a surfactant to the impregnation liquid to impregnate the plants; After the infection, bag the plants and keep them in a dark room to ensure sufficient water. The seeds were harvested after they matured, and transgenic seeds were screened using plates containing hygromycin antibiotics; After the transgenic seeds were germinated on MS+hygromycin plates, the positive plants were transferred to soil for further cultivation.

10. The method according to claim 9, characterized in that The positive plants were verified by PCR using the upstream primer DG349-F whose sequence is shown in SEQ ID NO.7 and the downstream primer DG349-R whose sequence is shown in SEQ ID NO.8.