Application of NtGRP1.8 gene

Abstract

The invention discloses an application of an NtGRP1.8 (NtGRP-1. 8) gene. In particular to application of the NtGRP1.8 gene in tobacco root system development, and the application refers to application of silent NtGRP1.8 gene in promoting tobacco root system development and / or application of overexpressed NtGRP1.8 gene in inhibiting tobacco root system development. The NtGRP1.8 gene provides a new thought for tobacco molecular breeding, shortens the breeding period, and has important significance on breeding of drought-enduring flue-cured tobacco varieties.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering, and in particular to the use of NtGRP1.8 gene. Background Art

[0002] Flue-cured tobacco is an important cash crop in my country and a vital component of the national economy. The tobacco root system is crucial for absorbing soil water and nutrients, synthesizing hormones and nicotine, and playing a crucial role in the tobacco plant's response to drought stress. Its root size, distribution, and vitality largely determine the amount of nutrients absorbed by the tobacco plant, significantly impacting its growth, development, leaf yield, and quality. Tobacco plants are tall and have large leaves, requiring a high level of water and nutrients for growth and development. The root system is a crucial organ for water and nutrient absorption. Root growth and vitality directly influence the growth and nutritional status of the aboveground parts of the plant, and are therefore closely linked to leaf quality and yield. Tobacco roots are conical, consisting of the taproot, lateral roots, and adventitious roots. When tobacco seeds germinate, the radicle breaks through the seed coat and grows directly into the taproot. Lateral roots, of varying sizes, originate from the pericycle. Roots originating from the stem are called adventitious roots. They typically form at the base of the stem, buried beneath the soil, and are abundant but shallowly distributed. As an essential plant organ, the root system absorbs soil nutrients and water to promote plant growth and development, and communicates with related organs aboveground to ensure normal plant growth and development. The root system also serves a supporting function. Its extended branches underground increase its contact area with the soil, firmly anchoring the plant in the soil and supporting the aboveground tobacco plant. Furthermore, the root system is a crucial organ for the synthesis of substances such as amino acids and plant hormones. Nicotine, a chemical component unique to tobacco, is 99.5% synthesized in the roots. Studies have shown that more developed tobacco root systems are associated with larger leaves and higher nicotine content. Plant roots also secrete various compounds. These root secretions are closely linked to the soil's rhizosphere microbiome, altering the physical and chemical properties and microbial activity of the rhizosphere, thereby improving the root system's nutrient absorption and utilization efficiency and its ability to adapt to environmental changes. Using tobacco varieties with well-developed root systems for cultivation and production is one of the methods to improve tobacco leaf yield and quality. Therefore, it is very important to screen and identify more effective root development genes through molecular biological methods and cultivate drought-resistant tobacco varieties that can be widely used in production.

[0003] GRP protein is a class of glycine-rich cell wall structural proteins, which are mainly divided into five categories according to their structure. They are involved in plant salt stress and osmotic stress, cold stress, cell elongation, xylem development, RNA binding activity and other processes, and play an important role in plant growth and development. When potatoes were inoculated with Phytophthora, high temperature, NaCl, ABA, IAA and other treatments, the expression levels of StGRPs changed to varying degrees. This shows that StGRPs may be involved in pathogen defense, osmotic pressure and heat pressure, and are related to hormone response. Fluorescence in situ hybridization results showed that the StGRP1 gene was specifically expressed in the vascular bundle. Under non-stress conditions, cell wall pectin binds to the cell wall-associated receptor kinase CpWAK1, and CpGRP1 is secreted into the cell wall and can bind to CpWAK1 to participate in growth regulation. During the water loss process, CpGRP1 accumulates and may bind to Ca 2+ Together they play a role in the modification of the existing pectin matrix. Alternatively, CpGRP1 and Ca 2+ The induced pectin structures may form complexes and bind tightly to CpWAK1. Changes in cell wall pectin are ultimately sensed by CpWAK1, activating the water loss signaling pathway. Drought stress stunts the growth and development of flue-cured tobacco, resulting in stunted plants, smaller and thicker leaves, delayed leaf maturity, and a significant reduction in both yield and quality (Wang Yaofu, 1994; Liu Shujie, 1985). The tobacco root system plays a crucial role in responding to drought stress. Summary of the Invention

[0004] The purpose of the present invention is to provide a new use of the NtGRP1.8 gene.

[0005] To achieve the above objectives, the present invention provides the use of the NtGRP1.8 gene for tobacco root development, characterized in that the use refers to the use of silencing the NtGRP1.8 gene to promote tobacco root development, and / or the use of overexpressing the NtGRP1.8 gene to inhibit tobacco root development.

[0006] Furthermore, the tobacco root system develops into the total length of the tobacco root system, and / or the total surface area of ​​the root system, and / or the total volume of the root system, and / or the number of root tips of the root system.

[0007] The present invention also protects the use of the NtGRP1.8 gene in tobacco breeding.

[0008] The present invention aims to study the function of tobacco glycine-rich cell wall structural protein NtGRP1.8 in root development, provide new ideas for tobacco molecular breeding, shorten the breeding period, and have important significance for the selection and breeding of drought-resistant flue-cured tobacco varieties.

[0009] The present invention utilizes high-throughput sequencing technology to identify and screen NtGRP1.8 mediated by Agrobacterium tumefaciens in tobacco. By constructing an overexpression vector and genetically transforming tobacco, it was found that the expression level of NtGRP1.8 in roots was significantly higher than in other tissues, and the expression difference was most obvious in the NtGRP1 family. The present invention explains the possible molecular mechanism by which NtGRP1.8 regulates the structure of the cell wall and thereby affects the development of the plant root system, which helps to further explore the gene regulatory mechanism that affects the development of the tobacco root system. The present invention promotes the breeding research of the tobacco root system development mechanism and provides reliable material and data support for the study of the molecular biological mechanism of enhancing the drought resistance of tobacco. It also provides new ideas for tobacco molecular breeding, shortens the breeding period, and is of great significance for the selection and breeding of drought-resistant flue-cured tobacco varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0010] Figure 1 This is a graph showing the electrophoresis results of the PCR amplification product of the NtGRP1.8 gene provided in Example 1 of the present invention, wherein M is Maker at 5000, and lanes 1 and 2 are the amplified NtGRP1.8 pregene.

[0011] Figure 2 This is a diagram of the electrophoresis results of the overexpression vector provided in Example 2 of the present invention, wherein lane M is a 5000 Marker, lanes 1, 3, 5, and 7 are for 35S-F and NtGRP1.8-8GWN-R detection, and lanes 2, 4, 6, and 8 are for G303-F and NtGRP1.8-8GWN-R detection.

[0012] Figure 3 This is a graph showing the electrophoresis results of detecting the subcellular localization vector provided in Example 3 of the present invention. M is a 5000 bp marker. Lanes 1, 4, and 7 were primed with 35S-F and NtGRP1.8-8GWN-GUS-R, lanes 2, 5, and 8 were primed with G303-F and NtGRP1.8-8GWN-GUS-R, and lanes 3, 6, and 9 were primed with NtGRP1.8-8GWN-F and GFP-R. A total of three monoclonal plaques were detected.

[0013] Figure 4 This is a transient expression result diagram provided in Example 3 of the present invention.

[0014] Figure 5 This is a diagram of the T0 generation culture process of the transgenic positive strain provided in Example 4 of the present invention.

[0015] Figure 6This is a graph showing the results of overexpression transgenic plant detection provided in Example 5 of the present invention. Lane M is 5000 Marker, lanes 1, 3, 5, and 7 are for 35S-F and NtGRP1.8-8GWN-R detection, and lanes 2, 4, 6, and 8 are for G303-F and NtGRP1.8-8GWN-R detection.

[0016] Figure 7 This is a diagram of the electrophoresis results of the detection of the silencing vector provided in Example 6 of the present invention, wherein lane M is 5000 Marker, and lanes 1, 2, 3, 4, 5, and 6 are 6 different monoclonal detections.

[0017] Figure 8 Figure 7 shows the NtGRP1.8 silencing detection and phenotypic identification provided in Example 7 of the present invention. Part A shows the relative expression level in silenced plants. Three controls and three silenced lines were tested, with quantification based on three technical replicates. Part B shows the roots of the control and silenced plants. Part C shows the control and 28-day-old silenced plants. Part D shows the root traits of the control and silenced plants. From left to right, they are root length, root surface area, root volume, and number of root tips, with a total of three biological replicates.

[0018] Figure 9 This is a graph verifying the transcriptional level of NtGRP1.8 provided in Inventive Example 8. Parts A, B, and C show the relative expression levels of three up-regulated genes related to cell wall regulation (ID numbers Nitab4.5_0000442g0110, Nitab4.5_0001815g0020, and Nitab4.5_0002131g0020, respectively). Parts D, E, and F show the relative expression levels of three down-regulated genes related to pectin methylesterase activity and pectin metabolism (ID numbers Nitab4.5_0000664g0150, Nitab4.5_0003093g0050, and Nitab4.5_0000055g0020, respectively).

[0019] Figure 10 This is a diagram of the phenotypic identification results of overexpression plants provided in Example 9 of the present invention. DETAILED DESCRIPTION

[0020] Below in detail embodiments of the present invention, the example of described embodiment is shown in the accompanying drawings, wherein identical or similar reference numerals represent identical or similar elements or elements with identical or similar functions throughout. The embodiment described below by reference to the accompanying drawings is exemplary, is intended to be used for explaining the present invention, and is not to be construed as limiting the present invention. In the embodiment, those not indicating specific techniques or conditions are carried out according to the technology or conditions described in the document in this area or according to the product specification. Reagents used or instruments not indicating manufacturers are conventional products that can be obtained commercially.

[0021] The formulas and preparation methods of the culture media and reagents used in the following examples are: Agrobacterium culture: 1. Streak Agrobacterium on LB+Rif plates and incubate at 28°C. 2. Pick a single colony and inoculate it into a sterile 50ml centrifuge tube with 10ml of LB+Rif at 28°C, 200 rpm. Incubate overnight. 3. Transfer 1-2ml (at a 1:50 or 1:100 ratio) of the culture to 100ml of LB liquid medium containing 100µl of Rif. Incubate at 28°C, 200 rpm, until OD600 = 0.5.

[0022] MS liquid culture medium: Add 4.43 g of MS dry powder, 30 g of sucrose, and distilled water to 1 L. The final pH is adjusted to about 5.8.

[0023] Example 1: Cloning of tobacco NtGRP1.8 gene Design primer sequences and add the NotI restriction site GCGGCCGC to the 5' end of the upstream primer and the SbfI restriction site CCTGCAGG to the 5' end of the downstream primer. The primer sequences (5' to 3') are as follows: NtGRP1.8-8GWN-F: CCTCAGCGCGGCCGCATGGCTTCCTCAGTTATGTCSEQ ID NO:1; NtGRP1.8-8GWN-R: CCCGGGACCTGCAGGTTAGTAGCCTTCGGGCTTGTSEQ ID NO:2.

[0024] Using the designed specific primers, the desired target fragment was cloned from mixed cDNAs from different parts of tobacco through seamless cloning. PCR reactions were then performed using the following reaction system (Table 1) and cycling parameters (Table 2).

[0025] Table 1 Reaction system

[0026] Table 2 Reaction schedule

[0027] The final PCR product was recovered after agarose gel electrophoresis (refer to EZNA ® Gel Extraction Kit instructions). The results are as follows Figure 1 As shown, Figure 1This is the electrophoresis result of the PCR amplification product of the NtGRP1.8 gene provided in Example 1 of the present invention. M is Maker 5000, and 1 and 2 are the amplified NtGRP1.8 pregene. It can be seen that the expected target fragment of about 858 bp was amplified according to the PCR reaction system.

[0028] The nucleic acid sequence of the NtGRP1.8 gene is: ATGGCGAAGCTTAAAGTTGTTAACATTGTTTTCTTTCTTTTATTGGGTATAGGAATATGTTCAGCTGCTAGAACACTCCTCACTTATGATCATGTAGGTGTTGGGGGTGAGGTAGGCGCTTATGGTGCAGGCCATGGCATTGGTGGTGGCGCTGGTGGTGGTGTTGCTGGTGGAGGCTATGCAGGTGGCGGTGGAGGAGGTTCCGGTGGAGGTGGTGGATATGGAGCTGCAGGTGACCATGGTTATGCCAGCGGAGGTGGCAGTGGAGGCGGAGCCGGTGGTGGTTCGGGCTATGCAGCTGGAGGAGAGCATGGTGCTGGATATGCTGGAGGAGGTGGTGGTGGAAGCGGGGCAGGAGGTGGCTATGCTGGTGGAGGACACGATGCTGGACATGCAAGTGGTGGTGGTGAAGGTGGTGGTAGCGGATATGGTGCTGGAGGAGCACCGGGTGGTGGTTATGGTGCTGGAGGTGGTGGAGGCAGTGGTGGCGGCGGAGCAGCTGCAGGTGGAGCACATGATGGTGGATATGCTGAAGGCGCAGGAGGAGGTAGTGGTGGCGGCTATGGTGCTGGTGGGGCATCAGGCGGTGGATATGGTGGTGGAGGTGGGCATGGAGGTGGCGGCGGTGGTGCTTATGCTGGAGGAGCAGGGGGAGCAGCAGCTGGTGGATACGGTAGTGGAGGAGGAGCCGGTGGTGGTGCAGGAGGAGCACATGGCGGAGCATATGGAGGCGGTGGTGGCGGTAGTGGTGCCGGTGGAGGTGGAGCTTACGCTGGAGGAGGTGAGCATGCTGGTGGATATGGAGGAGGTGCTGGAGGTGGTGAAGGTGGTGGACACGGTGGTGGCTACGCCCCTTGA。

[0029] SEQ ID NO:3。

[0030] Example 2: Construction of the overexpression vector of tobacco NtGRP1.8 gene (1)Double digestion of the pCAMBIA2300 vector Construct a vector enzyme digestion system using NotI and SbfI endonucleases. After adding all samples on ice, gently mix and digest in a PCR instrument at 37°C. The PCR program is shown in Table 3. PCR products were identified by 1% agarose gel electrophoresis and recovered.

[0031] Table 3 Enzyme digestion system

[0032] (2) Connect the gel recovery product to the pCAMBIA2300 vector after double enzyme digestion Refer to the 2× Clone Express Mix reagent instructions and add the components of the ligation reaction system according to Table 4 below. Incubate at 50°C in a PCR instrument or metal bath for 15 minutes.

[0033] Table 4 Reaction system

[0034] After the reaction is completed, transform E. coli immediately: ① Place 50 µL of DH5α competent cells in a 1.5 mL sterile centrifuge tube, add 5.0 µL of the entire ligation product, flick gently to mix, and place on ice for 30 minutes; ② Heat shock at 42°C for 60 seconds, followed by an immediate ice bath for 2 minutes; ③ Add 500 µL of LB liquid medium (room temperature) to ②, place in a 37°C shaker at 225 rpm for about 1 hour, and incubate until the bacterial solution becomes turbid; ④ Evenly spread the bacterial solution onto LB solid medium containing Spec resistance and culture it upside down in the dark at 37℃ for about 12-14 hours.

[0035] (3) PCR identification of Escherichia coli culture.

[0036] ① Bacteria detection primer (5' to 3') 35S-F: ATGACGCACAATCCCACTATCCTTCSEQ ID NO:4; NtGRP1.8-8GWN-R: CCCGGGACCTGCAGGTTAGTAGCCTTCGGGCTTGTSEQ ID NO:2.

[0037] ② Pipette 1 µL of Spec and 1 mL of LB liquid culture medium into a 1.5 mL sterile centrifuge tube; ③ Use a pipette tip to pick a single white colony from the overnight culture and inoculate it into LB liquid medium. Incubate the culture on a shaker at 37°C and 225 rpm for 4-6 hours until the culture becomes turbid. Use primers 35S-F and NtGRP1.8-8GWN-R and the culture medium as a template to identify positive recombinant clones by PCR. The PCR reaction system is as follows: Table 5 Reaction schedule

[0038] ④ After the reaction is completed, perform electrophoresis on a 1.0% agarose gel and select the positive monoclonal bacterial solution with the correct band size and send it to Qingke Biotechnology Co., Ltd. for sequencing. After comparing the sequencing results with the tobacco genome database, use a plasmid extraction kit to extract the plasmid to obtain the pNtGRP1.8-8GWN-K303-GUS plasmid with the correct sequence. Figure 2 . Figure 2 This is the electrophoresis result of the overexpression vector provided in this example. Lane M is the 5000 marker, lanes 1, 3, 5, and 7 are for 35S-F and NtGRP1.8-8GWN-R detection, and lanes 2, 4, 6, and 8 are for G303-F and NtGRP1.8-8GWN-R detection. The results show that the approximately 300-bp target fragment can be amplified from the E. coli plasmids, confirming that the target gene overexpression vector plasmid has been successfully transferred and is ready for Agrobacterium transformation in the next step.

[0039] (4) Transformation of Agrobacterium ① Add 10 µL of the above-mentioned plasmid DNA (pNtGRP1.8-8GWN-K303-GUS plasmid) to the Agrobacterium GV1301 competent cells, gently pipette to mix, and immediately place on ice for 5 minutes; ② Place the centrifuge tube containing competent cells in liquid nitrogen for 5 minutes, heat shock in a 37°C water bath for 5 minutes, and then place it on ice for 5 minutes; ③ Add 500 µL of non-resistant liquid LB medium, incubate at 225 rpm and 28°C for 4-6 hours, then spread 100 µL of the bacterial solution on an LB plate containing kan and rif, and incubate in the dark at 28°C for 36-48 hours. ④ Pick a single clone from the LB plate and place it in liquid LB medium containing kan and rif, and culture it at 28°C and 250 rpm for 1-2 days to obtain a bacterial suspension.

[0040] ⑤ Perform PCR identification on the bacterial solution, and the primers and detection system are the same as those for Escherichia coli testing.

[0041] ⑥The PCR products were detected by agarose gel electrophoresis, and the monoclonal bacterial solution with the correct band size was selected.

[0042] ⑦ Take an appropriate amount of fresh Agrobacterium culture medium and add it to 100 ml LB liquid medium containing 100 μL Kan and 100 μL Rif. Incubate at 28°C and 250 rpm on a shaker until the culture medium becomes turbid. This is used for tobacco genetic transformation.

[0043] Example 3: Transient expression (1) Construction of the pNtGRP1.8-8GWN-K303-GFP subcellular localization vector ① Double enzyme digestion of pCAMBIA2300 vector The vector digestion system is shown in Table 3. Using NotI and SbfI, all samples were added on ice, gently mixed, and digested in a PCR instrument at 37°C. The PCR program is shown in the table. PCR products were identified by 1% agarose gel electrophoresis and recovered.

[0044] ② Ligation and transformation of gene fragments and pCAMBIA2300 The double-enzyme-digested gene fragment and GFP expression vector were ligated with T4 ligase, and the sample was added according to the reaction system in Table 6. After gentle mixing, the ligation system was ligated overnight at room temperature. The ligation product was transformed into Escherichia coli DH5α competent cells according to the method shown in (2) in Example 2.

[0045] Table 6 T4 ligase ligation reaction system

[0046] ③ Escherichia coli detection and plasmid extraction Bacterial testing was performed using 35S-F (SEQ ID NO: 4), NtGRP1.8-8GWN-R (SEQ ID NO: 2), and GFP-R (SEQ ID NO: 6). The PCR protocol was the same as in Table 5. Plasmids were extracted according to the Fast Pure® Plas mid Mini Kit instructions and sent to Qingke Biotechnology Co., Ltd. for sequencing. Sequencing results were compared with the Chinese Tobacco Genome Database to obtain the correct sequence of the pNtGRP1.8-8GWN-GFP plasmid.

[0047] ④ Construction of subcellular localization vector pNtGRP1.8-8GWN-GFP recombinant E. coli was identified using three pairs of primers: 35S-F (SEQ ID NO: 4) and NtGRP1.8-8GWN-R (SEQ ID NO: 2), G303-F (SEQ ID NO: 5); and NtGRP1.8-8GWN-R (SEQ ID NO: 2), GFP-R (SEQ ID NO: 6) and NtGRP1.8-8GWN-F (SEQ ID NO: 1); after PCR amplification, the results were detected by 1% agarose gel electrophoresis. Figure 3 The results were consistent with expectations. The successfully identified recombinant E. coli were sent to Qingke Biotechnology Co., Ltd. for sequencing, and the results were essentially consistent with the target gene. Therefore, the NtGRP1.8 green fluorescent expression vector was successfully constructed. The recombinant E. coli plasmid was subsequently extracted and transformed into Agrobacterium for future use.

[0048] The sequence of G303-F is: GGCTTGTCCCGCGTCATCGGCGGGSEQ ID NO: 5; The sequence of GFP-R is: GAAGTCGTGCTGCTTCATGT SEQ ID NO: 6.

[0049] ⑤Injection and observation When the Nicotiana benthamiana seedlings have grown to 6-8 leaves, select intact and healthy leaves for injection. Use a 1mL syringe to draw up the p8GWN-GFP empty vector and pNtGRP1.8-8GWN-K303-GFP Agrobacterium, avoid the leaf veins, gently press the tobacco leaves, and slowly inject the bacterial solution into the leaves. After 36-48 hours of expression, observe the fluorescence under a confocal microscope. The results are shown in Figure 2. Figure 4 As shown. GFP is green fluorescent protein expressed throughout the cell; Bright serves as a positive control; Merge is the superposition of the first two fields. The K303 empty control (i.e., leaves injected with the empty p8GWN-GFP vector) exhibited clear fluorescence in the cell membrane, cytoplasm, and nucleus. The NtGRP1.8-GFP-K303 (i.e., leaves injected with pNtGRP1.8-8GWN-K303-GFP Agrobacterium) fluorescence was detected in the nucleus, cell membrane, and surrounding membranes, indicating that NtGRP1.8 is localized in the nucleus, cell membrane, and surrounding membranes, suggesting that NtGRP1.8 functions in these subcellular structures.

[0050] Example 4: Genetic transformation of tobacco (1) Obtaining sterile tobacco seedlings ① Wash tobacco (Safflower Dajinyuan) seeds once with an appropriate amount of 70% alcohol, and then let it rest for 2 minutes; ②Wash the seeds twice more with ddH2O and shake; ③ Continue washing with an appropriate amount of NaClO until the seed color changes from dark brown to yellow; ④ Wash away the NaClO on the seeds by shaking with ddH2O; ⑤Pour the seeds onto filter paper, pick up the seeds with a sterilized toothpick and then spot them on MS solid culture medium, 3-5 seeds per bottle; ⑥ First culture in the dark for 48 hours, then culture at 25℃ and 1500lx light. Seedlings will emerge in about a week. Continue to culture to obtain sterile wild-type Honghua Dajinyuan. (2) Leaf disc infection ① Centrifuge the prepared Agrobacterium culture solution at 4000 rpm for 10 min, discard the supernatant, and wash with MS liquid medium. Repeat twice to collect Agrobacterium cells. ②Resuspend the cells in ① in 20 mL of ice-cold MS liquid medium to an OD600 of 0.6-0.8; ③ Take the leaves of the sterile tobacco seedlings and use a punch to process them into leaf discs with a diameter of 0.5 cm. ④ Transfer the fresh leaf disc to the suspension and infect for 10 minutes, shaking it intermittently to promote infection; ⑤ Transfer the infected leaves to sterilized filter paper, dry the excess bacterial liquid on the surface, and transfer to differentiation medium and culture at 28℃ for 2 days; ⑥After 2 days, transfer the leaf disc to the screening medium for culture, and change the screening medium every 14 days or so; ⑦ When the adventitious buds grew to 0.5 cm, they were transferred to MS solid medium containing Cef and Kan to take root and obtain T0 generation overexpression lines (see Figure 5 ).

[0051] Example 5: Positive identification of overexpressing tobacco lines (1) Extraction of tobacco total DNA ① Add 2% β-mercaptoethanol to the CTAB extract and incubate in a 65°C water bath; ② Place 100 mg of material in a 2.0 mL centrifuge tube, place in liquid nitrogen, and then perform a sample extraction. Add 700 µL of the solution from step 1 to the centrifuge tube. ③ Lyse in a 65°C water bath for 45-60 min, mixing the centrifuge tube every 10 min; ④ After removing the tube, place it in an ice bath for 10 min, add 700 µL of freshly prepared chloroform:isoamyl alcohol (24:1), mix well, centrifuge and collect the supernatant; ⑤Repeat step ④; ⑥ Transfer the supernatant to a new centrifuge tube, add 450 μL of isopropanol, mix well, and store at -20°C. ⑦ Centrifuge the mixture from step ⑥ to obtain a white precipitated DNA. Add 600 µL of 75% ethanol to suspend the DNA and let it stand. Rinse with 75% ethanol and dehydrate with anhydrous ethanol. ⑧ Pour away the waste liquid, wait until the DNA is completely dry and then add ddH2O to dissolve it.

[0052] (2) PCR detection of overexpression lines DNA from overexpressing plants and Red Flower Dajinyuan was extracted and detected using two pairs of primers: 35S-F and pNtGRP1.8-8GWN--R, and pK303 forward primer G303-F and pNtGRP1.8-8GWN-R. The specific steps of PCR system and cycling parameters were the same as above. Figure 6 , Figure 6 This is a graph showing the results of overexpression transgenic plant detection provided in Example 5 of the present invention. Lane M is 5000 Marker, lanes 1, 3, 5, 7, and 9 are for 35S-F and NtGRP1.8-8GWN-R detection, and lanes 2, 4, 6, 8, and 10 are for G303-F and NtGRP1.8-8GWN-R detection.

[0053] Example 6: Construction of tobacco NtGRP1.8 gene silencing vector (1) Primer design VIGS silencing cloning primers and quantitative primers for the NtGRP1.8-TRV2 gene were designed using the Nicotiana tabacum Genome Data in the Solanaceae database (SGN). The SGN VIGS Tool was selected and the CDS fragment of NtGRP1.8 was input to obtain a 300 bp gene-specific fragment, which was then designed using Primer 5.0.

[0054] Primers were designed as follows (5' to 3'): pNtGRP1.8-VIGS-F:AAGGTTACC GAATTC GGAGGTGGTGGATATGGAGCSEQ ID NO:7; pNtGRP1.8-VIGS-R:CTCGGTACC GGATCC ACCTGCAGCTGCTCCGCCGCSEQ ID NO:8; pNtGRP1.8-VIGS-RT(F):AGCACATGATGGTGGATATGCTSEQ ID NO:9; pNtGRP1.8-VIGS-RT(R): CTCCTCCATATCCACCAGCATGSEQ ID NO:10.

[0055] Note: The underlined EcoRI and BamHI restriction sites in NtGRP1.8-VIGS-F and NtGRP1.8-VIGS-R are respectively; the underlined NotI and SbfⅠ restriction sites in pNtGRP1.8-8GWN-F and pNtGRP1.8-8GWN-R are respectively. The "CGAACGAT" and "GTTAATTAA" before the restriction sites are vector sequences. NtGRP1.8-VIGS-RT is the quantitative primer for NtGRP1.8-VIGS-RT.

[0056] (2) Obtain the target NtGRP1.8-VIGS fragment by seamless cloning (the method is the same as in Example 1, and the template is a mixed cDNA from different parts of tobacco); (3) Digest the pTRV2 vector with EcoRI and BamHI endonucleases using the same method as in Example 2; (4) Ligate the NtGRP1.8-VIGS gene and the pTRV2 linear vector using the same method as in Example 2 to obtain the recombinant vector pTRV2-NtGRP1.8.

[0057] (5) The methods for E. coli bacterial liquid detection, plasmid extraction and sequencing were the same as in Example 2. The results are shown in Figure 7 . Figure 7 This is the electrophoresis result of the overexpression vector. Lane M is the 5000 marker, and lanes 1, 2, 3, 4, 5, and 6 are 6 different monoclonal detections. The results show that the target fragment of about 300 bp can be amplified in the E. coli plasmid, proving that the target gene overexpression vector plasmid has been successfully transferred and can be used for the next step of Agrobacterium transformation.

[0058] (6) The pTRV2-NtGRP1.8 plasmid was transformed into Agrobacterium. The primers for Agrobacterium detection were the same as those for Escherichia coli detection. The transformation method was the same as in Example 2.

[0059] Example 7: Silencing Detection and Phenotypic Identification (1) Prepare infection medium: Take 200 μL of Agrobacterium containing pTRV1, pTRV2, and pTRV2-NtGRP1.8, respectively, and inoculate into 20 mL of LB liquid medium. Add 20 μL of Kan solution and Rif solution (50 mg / ml), respectively. Incubate at 28°C and 225 rpm until the color of the bacterial solution changes from wine red to orange red. Centrifuge at 4000 rpm for 10 min, collect the cells, and resuspend them in an appropriate volume of infection buffer to an OD600 of 0.4-0.6 to obtain the infection medium.

[0060] (2) Mix the infection solution prepared in the previous step according to the concentration of pTRV1∶pTRV2=1∶1, pTRV1∶pTRV2-NtGRP1.8=1∶1, etc., let it stand at room temperature for 3 h, and prepare for infection.

[0061] (3) Infection: Take 200-400 μL of the infection solution mixed in proportion and inject it into the back of six true leaf-sized Nicotiana benthamiana leaves with a syringe. Mark the infected leaves. Infect 3-5 plants in each infection group. Incubate in the dark at 25℃ for one day and night, then culture normally at 25℃ with light for 12 hours in 5000 l, and observe the phenotypic changes of tobacco.

[0062] (4) Observation of properties. After infection is complete, observe NtGRP1.8 Silent tobacco strains (i.e. Figure 8 in NtGRP1.8-V ) and pTRV2 empty vector plants (i.e., CK) phenotypic changes, such as Figure 8 As shown in B and C. Figure 8 Figure 1 is the NtGRP1.8 silencing detection and phenotypic identification. A is the relative expression level detection of silenced plants. A total of 3 controls (CK-1, CK-2, CK-3) and 3 silenced lines ( NtGRP 1.8-V-1 ,NtGRP 1.8-V-2 ,NtGRP 1.8-V-3), quantification was based on 3 technical replicates; B is the control pTRV2 empty-loaded plant (CK) and silenced plant ( NtGRP 1.8-V) roots; C is the control (CK) and the plant after 28 days of silencing ( NtGRP 1.8-V); D is the control plant (CK) and silenced plant ( NtGRP 1.8-V) Root traits measured (from left to right): root length, root surface area, root volume, and number of root tips. Three biological replicates were set up in total.

[0063] (5) RT-qPCR analysis. After 28 days of cultivation, root phenotype changes were found. The roots of each treated tobacco plant after infection were taken, RNA was extracted, and reverse transcribed into cDNA. Then, 2×Q3 SYBR qPCR MasterMix enzyme of Tolo Harbor Biotechnology Co., Ltd. was used to perform RT-qPCR detection on the injected pTRV1:pTRV2 and pTRV2-NtGRP1.8 red flower Dajinyuan using NtGRP1.8 specific primers (i.e., pNtGRP1.8-VIGS-RT(F) and (R), SEQ ID NO:9 and 10) and GAPDH internal reference primers (GAPDH (F) and GAPDH (R), SEQ ID NO:11 and 12) according to the loading method in Table 7. The detection system and reaction procedure were the same as in Example 8. The results were analyzed by Excel using 2 ΔΔCtThe relative expression of genes was calculated using the prism software, and the relative expression of genes was plotted. Figure 8 As shown in A. Figure 8 This is the NtGRP1.8 silencing detection and phenotypic identification provided in this example. In the figure, part A is the relative expression level detection of silenced plants, a total of 3 controls and 3 silenced lines were tested, and the quantification was based on 3 technical replicates.

[0064] GAPDH (F): TGGGTGTCAACGAGAAGGAA; SEQ ID NO: 11; GAPDH (R): TCTGGGTGGCAGTAAGGGA; SEQ ID NO: 12.

[0065] Table 7 Fluorescence real-time quantitative PCR reaction system sample addition method

[0066] Reaction program: 95°C for 15 min, 94°C for 20 sec, 60°C for 34 sec, 40 cycles.

[0067] Example 8: Verification of transcriptional levels (1) Extraction of tobacco RNA When tobacco seedlings reached the 5-6 leaf stage, detached leaves from plants of similar growth were infected in vitro. Samples were taken at 0, 24, and 48 hours, with three biological replicates. Tobacco total RNA was extracted using the Tiangen Polysaccharide and Polyphenol Plant Total RNAprep PureRNA Extraction Kit.

[0068] (2) Reverse transcription of mRNA ① Removal of genomic DNA reaction Prepare the reaction mixture on ice according to the following ingredients. To ensure the accuracy of the reaction mixture preparation, when performing each reaction, you should first prepare the Master Mix according to the number of reactions + 2, then divide it into each reaction tube, and finally add the RNA sample. The reaction system is shown in Table 8: Table 8 Reaction system

[0069] Reaction procedure: 42°C, 2 min reaction, then place on ice at 4°C ②Reverse transcription reaction The reaction solution was prepared on ice, mixed gently and then immediately started reverse transcription. The reaction system is shown in Table 9: Table 9 Reaction system

[0070] Reaction procedure: 37°C, 15 min, 85°C, 5 sec. After the reaction, place on ice.

[0071] Dilute the synthesized cDNA 10-fold for subsequent experiments. If not in use, store it in a -20°C freezer for future use.

[0072] (2) Fluorescence quantitative PCR ① Fluorescence quantitative PCR primer sequences (5' to 3') are as follows: Table 10 Primer sequence list

[0073] ②The fluorescence quantitative PCR system is the same as Table 7.

[0074] The present invention quantitatively verified the expression pattern of NtGRP1.8 in regulating cell wall. Three up-regulated genes related to cell wall regulation (ID numbers are Nitab4.5_0000442g0110, Nitab4.5_0001815g0020, and Nitab4.5_0002131g0020) and three down-regulated genes related to pectin methylesterase activity and pectin metabolism (ID numbers are Nitab4.5_0000664g0150, Nitab4.5_0003093g0050, and Nitab4.5_0000055g0020) were selected for verification. RT-qPCR results showed (see Figure 9 , Figure 9 This is a transcriptome validation of NtGRP1.8 provided in this example. In the figure, sections A, B, and C show the relative expression of three upregulated genes related to cell wall regulation (Nitab4.5_0000442g0110, Nitab4.5_0001815g0020, and Nitab4.5_0002131g0020, respectively). Sections D, E, and F show the relative expression of three downregulated genes related to pectin methylesterase activity and pectin metabolism (Nitab4.5_0000664g0150, Nitab4.5_0003093g0050, and Nitab4.5_0000055g0020, respectively). The detected relative gene expression levels are generally consistent with the transcriptome sequencing results, indicating the high accuracy and credibility of the transcriptome sequencing data.

[0075] Example 9: Phenotypic Identification of Overexpressing Plants The overexpressing plants (T0 generation see Figure 5 ) were self-pollinated to obtain T1 generation plants, which were used for phenotypic identification. Figure 10A) T2 generation and Honghua Dajinyuan seeds were uniformly managed with light, temperature, water and fertilizer. NtGRP1.8-OE overexpressing plants and Honghua Dajinyuan (WT) with consistent growth were transplanted into the same seedling tray. At the four-leaf stage, the overexpressing plants showed obvious phenotypes, with smaller plants and narrower leaves ( Figure 10 A, B and C). The phenotypic analysis was performed, and the results were as follows Figure 10 As shown in Figures E, F, G, and H, the total root length, total surface area, total volume, and number of root tips of the overexpressing plants were significantly increased. Moreover, the root phenotypic changes led to the stunted overall development of the plants, and the maximum leaf area was reduced ( Figure 10 D). Figure 10 This is a diagram of the phenotypic identification results of the overexpression plants provided in this example.

[0076] Although the embodiments of the present invention have been shown and described above, it will be understood that the above embodiments are illustrative and are not to be construed as limitations on the present invention. A person skilled in the art may change, modify, replace and modify the above embodiments within the scope of the present invention without departing from the principles and purpose of the present invention.

Claims

1. The use of the NtGRP1.8 gene for tobacco root development, characterized in that: The use refers to the use of silencing the NtGRP1.8 gene to promote the development of tobacco root system, and / or the use of overexpressing the NtGRP1.8 gene to inhibit the development of tobacco root system.

2. The use according to claim 1, characterized in that The tobacco root system development is the total length of the tobacco root system, and / or the total surface area of ​​the root system, and / or the total volume of the root system, and / or the number of root tips of the root system.

3. Application of NtGRP1.8 gene in tobacco breeding.

Images