Application of rice OsPIL13 gene in cultivation of rice germplasm regulated by temperature

Abstract

The rice OsPIL13 gene is applied to cultivation of rice germplasm regulated and controlled by temperature. Relates to the technical field of gene engineering, and aims to provide novel application of the rice OsPIL13 gene. The rice OsPIL13 gene is used for cultivating rice germplasm regulated and controlled by temperature. OsPIL13 is overexpressed under the background of wild type rice SJ2 and a mutant osbzr4, it is determined that overexpression of the rice OsPIL13 gene promotes formation of embryo-free seeds, and the expression level of the OsPIL13 gene is induced by high temperature. The method provides an important theoretical basis for production and application of osbzr4 embryo-free rice, and has an important practical value for cultivation and production of temperature-sensitive regulation and control embryo-free rice.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and in particular to the application of rice OsPIL13 gene in cultivating temperature-regulated rice germplasm. Background Art

[0002] Rice is an important food crop. Rice seeds are both responsible for reproduction and a crucial source of food for humanity. The development of rice seeds directly impacts grain yield and quality. As early as the 1990s, a rice embryoless seed mutant was discovered. The embryoless rate of this mutant seed is regulated by temperature. However, the regulatory genes and mechanisms are still unclear.

[0003] The discovery of a temperature-regulated gene for embryoless seeds theoretically provides valuable genetic material for studying the mechanisms of rice seed development. In practice, temperature can be used to regulate the ratio of embryoless rice seeds, allowing the production of embryoless rice for food production under high temperatures and normal rice for seed production under low temperatures. This provides a revolutionary new approach to changing rice production methods and is therefore of great theoretical and practical value. Summary of the Invention

[0004] The purpose of the present invention is to provide a new use of the rice OsPIL13 gene, to provide an important theoretical basis for the production and application of osbzr4 embryoless rice, and to have important practical value for the cultivation and production of temperature-sensitive regulated embryoless rice.

[0005] The present invention provides application of rice OsPIL13 gene in cultivating temperature-regulated rice germplasm.

[0006] Furthermore, the application is to prepare OsPIL13 overexpressing transgenic rice using the rice OsPIL13 gene, wherein the OsPIL13 gene positively regulates the ratio of rice embryoless seeds.

[0007] Furthermore, the method for preparing the OsPIL13 overexpressing transgenic rice comprises the following steps:

[0008] First, the rice OsPIL13 gene was cloned using primers to obtain the CDS sequence of the OsPIL13 gene;

[0009] 2. ligating the OsPIL13 gene CDS sequence obtained in step 1 to a vector to obtain an OsPIL13 gene overexpression vector;

[0010] 3. The overexpression vector obtained in step 2 was transferred into the wild-type rice variety SJ2 or the rice mutant osbzr4 through Agrobacterium-mediated method to obtain OsPIL13 overexpressing transgenic rice.

[0011] Furthermore, the primers in step 1 are forward primer F7: 5'-GATCAATTCGAGCTCGGTACCATGGATGGCAATGCGAGATCG-3' and reverse primer R7: 5'-CAGGTCGACTCTAGAGGATCCCTAAATTCCATCAGAGGTTGGTGG-3'.

[0012] Furthermore, the expression of the rice OsPIL13 gene is induced by high temperature. Furthermore, the rice OsPIL13 gene is overexpressed in the wild-type rice variety SJ2, resulting in 1%-2% embryoless seeds and 4%-7% small embryo seeds.

[0013] Furthermore, the rice OsPIL13 gene is overexpressed in the rice mutant osbzr4, significantly increasing the ratio of osbzr4 embryoless seeds.

[0014] Beneficial effects of the present invention:

[0015] The present invention discloses the role of the rice gene OsPIL13 and its encoded protein in mediating temperature-regulated embryo development in the osbzr4 rice strain. By overexpressing OsPIL13 in wild-type rice SJ2 and the osbzr4 mutant, the present invention determined that overexpression of the rice gene OsPIL13 promotes the formation of embryoless seeds, and that the expression level of the OsPIL13 gene is induced by high temperature. The rice gene OsPIL13 mediates temperature-regulated embryoless seed production in the osbzr4 strain, providing an important theoretical basis for the production and application of osbzr4 embryoless rice and having significant practical value for the cultivation and application of temperature-sensitive embryoless rice. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 is the OsPIL13 gene expression level in SJ2 at room temperature (27°C) and high temperature (32°C) in Example 1;

[0017] Figure 2 Schematic diagram of the rice OsBZR4 gene editing vector structure;

[0018] Figure 3 are the genotypes of rice osbzr4 mutants in different backgrounds;

[0019] Figure 4 is the expression level of OsPIL13 in OsPIL13 OE rice in the wild-type rice variety Songjing 2 (SJ2);

[0020] Figure 5 is the expression level of OsPIL13 in OsPIL13 OE rice in the rice mutant osbzr4 background;

[0021] Figure 6 This is a statistical chart showing the proportions of embryoless, small, and normal embryos in OsPIL13 OE rice seeds under the wild-type rice variety Songjing 2 (SJ2) background;

[0022] Figure 7 Statistical chart showing the proportions of embryoless, small, and normal embryos in OsPIL13 OE rice seeds under the rice mutant osbzr4 background. DETAILED DESCRIPTION

[0023] The following embodiments of the present invention are described in detail. The following embodiments are implemented on the premise of the technical solution of the present invention, and detailed implementation plans and specific operating processes are given, but the protection scope of the present invention is not limited to the following embodiments.

[0024] Example 1: High temperature induces increased expression of the rice OsPIL13 gene

[0025] Two-week-old SJ2 rice seedlings were placed in two incubators at 32°C and 27°C, respectively, with other identical conditions. Approximately 200 mg of leaves were collected at 0, 1, 3, 6, and 12 hours, quickly frozen in liquid nitrogen, and then stored in a -80°C freezer. RNA was extracted and reverse transcribed using the PrimeScript™ II 1st Strand cDNA Synthesis Kit (6210A) from Takara Biosciences to synthesize cDNA. RT-qPCR was performed using OsPIL13-specific primers, forward primer F1 and reverse primer R1, to analyze the effects of different temperatures on OsPIL13 expression levels. Figure 1 As shown, Figure 1 The middle curve NT represents 27°C (normal temperature), and the curve HT represents 32°C (high temperature). Compared with 27°C, the expression level of OsPIL13 was significantly increased at 32°C, indicating that the expression of the rice OsPIL13 gene is induced by high temperature.

[0026] Forward primer F1: 5′-TGGAGCTGCTATGGCACAAC-3′

[0027] Reverse primer R1: 5′-GCTGCGTGTAGAGGTCCTTC-3′

[0028] Example 2: Preparation of mutant osbzr4 in SJ2 background:

[0029] 1. Construction of editing vector for rice OsBZR4 gene

[0030] Knockout target sites were designed based on the rice OsBZR4 gene. The rice OsBZR4 gene is 3399 bp long, containing two exons and one intron. The coding region of the OsBZR4 gene is 1056 bp long. The online software CRISPR-GE (http: / / skl.scau.edu.cn / ) was used to screen the target sequences for gene editing. Two target sequences were selected and named Target 1 and Target 2. The gene locations of the two target sites are shown in Figure 2. Figure 2 As shown, they are all located in the first exon, with the start sites located at 85 bp and 117 bp respectively.

[0031] Target 1 sequence: ATCGCGGCGAAGATCTACG

[0032] Target 2 sequence: GAAGCACTGCGACAACAACG

[0033] Based on the two target sites, target sgRNA expression cassettes were constructed. In this example, the sgRNA expression cassettes were constructed using the CRISPR / sgRNA vectors pYLgRNA-OsU3 and pYLgRNA-OsU6a as the backbone. First, primer sequences were synthesized to connect the target site and the sgRNA expression cassette. Subsequently, the first round of PCR was performed using the pYLgRNA-OsU3 plasmid as a template, with forward primer F2 and reverse primer R2 added; and the pYLgRNA-OsU6a plasmid as a template, with forward primer F3 and reverse primer R3 added. 25-28 cycles of 94°C for 10 seconds, 58°C for 15 seconds, and 68°C for 20 seconds were performed. Next, the pYLgRNA-OsU3 product from the first round of PCR was added with forward primer F4 and reverse primer R4. The pYLgRNA-OsU6a product from the first round of PCR was added with forward primer F5 and reverse primer R5. A second round of PCR was performed with 17-20 cycles of 95°C for 10 seconds, 58°C for 15 seconds, and 68°C for 20 seconds. Finally, the second-round PCR products were recovered by agarose gel electrophoresis to obtain the target sgRNA expression cassette.

[0034] Forward primer F2: 5′-GGCAGATCGCGGCGAAGATCTACG-3′

[0035] Reverse primer R2: 5'-AAACCGTAGATCTTCGCCGCGATC-3'

[0036] Forward primer F3: 5′-GCCGCGTTGTTGTCGCAGTGCTTC-3′

[0037] Reverse primer R3: 5'-AAACGAAGCACTGCGACAACAACG-3'

[0038] Forward primer F4: 5′-TTCAGAGGTCTCTCTCGCACTGGAATCGGCAGCAAAGG-3′

[0039] Reverse primer R4: 5′-AGCGTGGGTCTCGTCAGGGTCCATCCACTCCAAGCTC-3′

[0040] Forward primer F5: 5′-TTCAGAGGTCTCTCTCGCACTGGAATCGGCAGCAAAGG-3′

[0041] Reverse primer R5: 5′-AGCGTGGGTCTCGACCGGGTCCATCCACTCCAAGCTC-3′

[0042] In this example, the CRISPR / Cas9 vector used was pYLCRISPR / Cas9Pubi-H. The target sgRNA constructed above, pYLCRISPR / Cas9Pubi-H, DNA ligase, and endonuclease Bsa I were mixed and ligated to the CRISPR / Cas9 vector pYLCRISPR / Cas9Pubi-H using a cleavage-and-ligation method for 10-15 cycles: 37°C for 5 min; 10°C for 5 min; 20°C for 5 min; and finally 37°C for 5 min to obtain a ligation product.

[0043] The pYLCRISPR / Cas9Pubi-H vector has been published in the following article: Ma X, Zhang Q, ZhuQ, Liu W, Chen Y, Qiu R, Wang B, Yang Z, Li H, Lin Y, et al. (2015) A robust CRISPR / Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot plants. Mol Plant 8: 1274–1284.

[0044] The ligation product was transformed into Escherichia coli, and high-purity plasmids were extracted. Enzyme digestion was performed for identification, and plasmids with the correct product size were sequenced to obtain a CRISPR / Cas9 vector for knocking out the rice OsBZR4 gene, as shown in FIG. Figure 3 This is the rice OsBZR4 gene editing vector.

[0045] 2. Genetic transformation of rice callus using the rice OsBZR4 gene editing vector

[0046] The rice OsBZR4 gene editing vector plasmid obtained in step 1 was transformed into competent cells of Agrobacterium. In this embodiment, competent cells of Agrobacterium tumefaciens EHA105 were transformed by heat shock method, and single colonies were picked for PCR identification to obtain strains containing positive clones. Subsequently, rice callus was transformed using Agrobacterium-mediated method, and the specific operation steps were as follows:

[0047] (1) Induction of rice seed callus

[0048] Mature seeds of the rice variety SJ2 were dehulled, disinfected and cleaned in 75% alcohol and 50% sodium hypochlorite, and then placed on a rice callus induction medium. Subsequently, the seeds were cultured in a 30°C light incubator for 2-3 weeks until callus tissue grew. Afterwards, the seeds were subcultured for 1-2 generations, and callus tissue with good growth conditions was selected for Agrobacterium infection.

[0049] (2) Agrobacterium activation

[0050] Take the Agrobacterium containing positive clones and inoculate it into liquid YEP medium containing kanamycin and rifampicin. Incubate it at 28°C in a shaker at 200 rpm until the OD 600 0.3-0.5; then, 1 mL of bacterial solution was inoculated again into fresh liquid YEP medium containing kanamycin and rifampicin, and cultured under the same conditions until OD 600 is 0.3-0.5; finally, the bacteria are collected by centrifugation and resuspended in AAM medium containing acetosyringone (AS) to obtain a bacterial solution.

[0051] (3) Co-cultivation of callus and Agrobacterium, screening of resistant callus, and rooting

[0052] The obtained callus tissue was immersed in the bacterial solution, infected for 30 minutes, and gently shaken; then, the excess bacterial solution was absorbed with sterilized filter paper, and the infected callus tissue was transferred to a co-culture solid culture medium and cultured in the dark at 28°C for 3 days; then, it was transferred to a screening medium containing hygromycin for culture; the resistant callus tissue obtained on the screening medium was transferred to a differentiation medium for differentiation and regeneration; the regenerated seedlings were moved to pots and managed according to routine procedures to obtain rice OsBZR4 gene-edited T0 generation plants.

[0053] (4) CRISPR / Cas9 knockout identification and phenotypic analysis of the rice OsBZR4 gene

[0054] Genomic DNA was extracted from leaves of the T0 generation OsBZR4 gene-edited plants obtained above. Forward primers F6 and reverse primers R6 were designed based on the target sequence to amplify a product of approximately 487 bp for sequencing. The sequencing results were aligned with the rice OsBZR4 gene sequence to identify the genotype of the gene-edited rice OsBZR4. Heterozygous OsBZR4 plants were subsequently cultivated until homozygous mutant osbzr4 plants were obtained on the SJ2 background.

[0055] Forward primer F6: 5′-TTACTGCTTCTCCGGCGTATTTAT-3′

[0056] Reverse primer R6: 5′-CAGCCGACGCAAATTAAGCAAG-3′

[0057] Example 3: Construction of rice OsPIL13 gene overexpression vector and genetic transformation

[0058] The CDS sequence of OsPIL13 (LOC_Os03g56950.2) was downloaded from the Rice Genome Annotation Database (https: / / rice.uga.edu / ). Full-length CDS primers were designed: forward primer F7 and reverse primer R7. 21 bp of Kpn I and BamH I sequences were introduced at either end of the primers into the pCAMBIA2300-ubiquitin vector. PCR amplification was performed using cDNA from the leaves of the rice cultivar Nipponbare as a template using Takara Biotech's high-fidelity PrimeSTAR HS DNA Polymerase with GC Buffer (R044A). Initial denaturation at 98°C for 5 min was followed by 35 cycles of (98°C denaturation for 30 s, 58°C annealing for 30 s, and 72°C extension for 60 s), followed by a final extension at 72°C for 5 min. Gel extraction was performed using a Silica Bead DNA Gel Extraction Kit purchased from Invitrogen. The pCAMBIA2300-ubiquitin vector was ligated with the ClonExpress II One-Step Cloning Kit (C112-02) from Novozymes and transformed into competent E. coli cells. The pCAMBIA2300-ubi-OsPIL13 vector contains the G418 resistance marker gene, and the OsPIL13 gene is driven by the UBI promoter.

[0059] Forward primer F7: 5′-GATCAATTCGAGCTCGGTACC ATGGATGGCAATGCGAGATCG-3′

[0060] Reverse primer R7:

[0061] 5'-CAGGTCGACTCTAGAGGATCCCTAAATTCCATCAGAGGTTGGTGG-3'

[0062] The constructed vector pCAMBIA2300-ubi-OsPIL13 was transformed into rice callus tissue using Agrobacterium-mediated transfection. Transgenic plants expressing OsPIL13 were obtained in both the SJ2 and osbzr4 backgrounds. Primers for identifying transgenic plants were designed based on the G418 resistance gene: forward primer F8 and reverse primer R8. Transgenic plants were identified by PCR. RNA was extracted from leaves of transgenic plants and reverse transcribed using the PrimeScriptTM II 1st Strand cDNA Synthesis Kit (6210A) from Takara Biotech to synthesize first-strand cDNA. RT-qPCR was performed using primers specific for the OsPIL13 coding region, forward primer F1 and reverse primer R1, to analyze the expression levels of OsPIL13 in OsPIL13 transgenic plants under the backgrounds of wild-type SJ2 and mutant osbzr4. Three lines with higher expression levels were selected for subsequent studies, such as Figure 4 As shown in Figure 2, the expression levels of the OsPIL13 gene in the three OsPIL13 OE plants in the SJ2 background were increased by approximately 21-27 times compared to the wild type. Figure 5 As shown, the expression level of OsPIL13 gene in OsPIL13 OE plants in the osbzr4 background was increased by about 10-13 times compared with the control.

[0063] Forward primer F8: 5′-GGCTATGACTGGGCACAACA-3′

[0064] Reverse primer R8: 5′-GCAGGAGCAAGGTGAGATGAC-3′

[0065] Example 4: Overexpression of the rice OsPIL13 gene increases the proportion of embryoless seeds

[0066] The T2 generation OsPIL13 OE plants under the SJ2 and osbzr4 backgrounds and non-transgenic control rice were planted in the Harbin Rice Potting Farm during the normal rice growing season (May-October). The embryonic development phenotypes were analyzed after the seeds were harvested and matured. Figure 6 As shown in Figure 2, OsPIL13 OE plants in the SJ2 background produced approximately 1%-2% embryoless seeds and 4%-7% small-embryo seeds, which were significantly higher than those in the SJ2 control (0% embryoless seeds and 1%-2% small-embryo seeds). Figure 7As shown, approximately 90% of seeds produced were embryoless, while approximately 10% produced seeds with small or normal embryos. In contrast, under the same culture conditions, the osbzr4 control produced approximately 70% of seeds without embryos, and approximately 70% of seeds with small or normal embryos. These results suggest that overexpression of OsPIL13 inhibits rice embryo development, particularly in the osbzr4 background, where it further promotes the production of embryoless seeds.

Claims

1. Application of rice OsPIL13 gene in breeding temperature-regulated rice germplasm.

2. The use according to claim 1, characterized in that The application is to prepare OsPIL13 overexpressing transgenic rice using the rice OsPIL13 gene, wherein the OsPIL13 gene positively regulates the ratio of rice embryoless seeds.

3. The use according to claim 2, characterized in that The method for preparing the OsPIL13 overexpressing transgenic rice comprises the following steps: First, the rice OsPIL13 gene was cloned using primers to obtain the CDS sequence of the OsPIL13 gene; 2. ligating the OsPIL13 gene CDS sequence obtained in step 1 to a vector to obtain an OsPIL13 gene overexpression vector; 3. The overexpression vector obtained in step 2 was transferred into the wild-type rice variety SJ2 or the rice mutant osbzr4 with SJ2 as the background through Agrobacterium-mediated method to obtain OsPIL13 overexpressing transgenic rice.

4. The use according to claim 3, characterized in that The primers in step 1 are forward primer F7: 5'-GATCAATTCGAGCTCGGTACC ATGGATGGCAATGCGAGATCG-3' and reverse primer R7: 5'-CAGGTCGACTCTAGAGGATCCCTAAATTCCATCAGAGGTTGGTGG-3'.

5. The use according to claim 1, characterized in that The expression of the rice OsPIL13 gene is induced by high temperature.

6. The use according to claim 3, characterized in that The rice OsPIL13 gene is overexpressed in the wild-type rice variety SJ2, producing 1%-2% of embryoless seeds and 4%-7% of small-embryo seeds.

7. The use according to claim 3, characterized in that The rice OsPIL13 gene is over-expressed in the rice mutant osbzr4, significantly increasing the ratio of osbzr4 embryoless seeds.

Images