Application of Fd2 gene in enhancing PVY resistance of plants

Abstract

The invention belongs to the technical field of crop disease-resistant molecular breeding, and particularly relates to application of an Fd2 gene in enhancing PVY resistance of plants. The application of the Fd2 gene in enhancing the PVY resistance of the plant is characterized in that the virus accumulation amount after PVY infection is reduced by improving the expression level of the Fd2 gene in the plant; wherein the gene Fd2 is shown as SEQ ID NO. 1 or SEQ ID NO. 6. After the tomato SlFd2 is silenced, the PVY CP gene expression quantity is obviously higher than that of a control group, so that more PVY is accumulated in the silenced plant, and the SlFd2 plays a positive regulation role in the PVY infection resisting process of the tomato.

Description

Technical Field

[0001] The invention belongs to the technical field of crop disease resistance molecular breeding, and in particular relates to an application of an Fd2 gene in enhancing plant PVY resistance. Background Art

[0002] Potatovirus Y (PVY), a representative species of the plant genus Potyvirus, can infect over 170 plant species across 34 genera, including those in the Solanaceae, Chenopodiaceae, and Leguminosae families. Nearly 400 host species have been documented. PVY is particularly detrimental to crops such as tobacco, tomatoes, and potatoes, often causing symptoms such as mosaic, necrosis, and leaf deformities, severely impacting crop quality and yield, leading to significant economic losses in agricultural production.

[0003] Ferredoxins (Fd) are a class of soluble iron-containing electron transport proteins found widely in prokaryotes and eukaryotes. Their core characteristic is the presence of an iron-sulfur (Fe-S) cluster, which enables them to participate in a variety of redox reactions. As a key component of the photosynthetic electron transport chain, changes in Fd expression are associated with plant disease resistance.

[0004] Fd is also important in the plant antiviral response process. The replication-related protein RepA of Oat dwarf virus (ODV) can cause HR in Nicotiana benthamiana (Qian et al., 2016). Subsequent analysis showed that the expression of RepA inhibited plant photosynthesis, silencing NbFD1 accelerated the RepA-induced HR response and H2O2 accumulation, while silencing NbTsip1 had the opposite effect (Hou et al., 2018). After ToCV (Tomato chlorosis virus) infected tomatoes, the expression of the Fd2 gene decreased significantly between 8 and 30 days ( et al., 2021). In contrast, in the SCMV-resistant sugarcane genotype B-48, ferredoxin expression is upregulated, enhancing photosystem stability and antiviral capacity (Akbar et al., 2021). These studies suggest that viruses weaken host defenses by repressing the expression of photosynthesis-related genes, while resistant varieties enhance resistance by upregulating these genes.

[0005] Fd also regulates plant resistance to viruses through RNAi mechanisms. PVX's silencing suppressor p25 interacts with NbFD1, and viral infection or expression of the p25 protein can inhibit the transcription and translation of NbFD1. After silencing NbFD1, the accumulation and infection rate of PVX were higher than those of the wild type. This is because silencing NbFD1 leads to a decrease in ABA and SA content. It is speculated that this may affect the activity of its silencing suppressor by targeting p25 to achieve antiviral effects (Cui et al., 2021). Similarly, RSV inhibits NbFD1 transcription through small interfering RNA and ABA-mediated ABI5 (ABA-insensitive 5) gene expression, promoting viral proliferation. Overexpression of NbFD1 effectively inhibits PVX and RSV infection, demonstrating its importance in antiviral defense (Cui et al., 2021). Summary of the Invention

[0006] The present invention provides an application of an Fd2 gene in enhancing plant resistance to PVY, illustrating that Fd2 plays a positive regulatory role in the process of plant resistance to PVY infection.

[0007] The present invention provides an application of the Fd2 gene in enhancing plant resistance to PVY, characterized in that the amount of virus accumulation after PVY infection is reduced by increasing the expression level of the Fd2 gene in the plant;

[0008] Furthermore, the Fd2 gene is SEQ ID NO.1 or SEQ ID NO.6.

[0009] Furthermore, the protein encoded by the gene is localized in plant chloroplasts.

[0010] Furthermore, the plant is a Solanaceae plant.

[0011] Furthermore, the Solanaceae plant is Nicotiana benthamiana or tomato.

[0012] Furthermore, the gene is derived from Nicotiana benthamiana or tomato.

[0013] The present invention provides a method for constructing a PVY-resistant plant, comprising the following steps:

[0014] (1) Amplify the target gene using the primer pair of SEQ ID NO. 4 and SEQ ID NO. 5 to obtain a PCR product;

[0015] (2) Construction of NbFd2-OE overexpression vector;

[0016] (3) transforming the NbFd2-OE overexpression vector obtained in step (2) into Escherichia coli and extracting the positive clone plasmid;

[0017] (4) The plasmid is transformed into Agrobacterium, which infects plant callus tissue to obtain transgenic plants.

[0018] Furthermore, the NbFd2-OE overexpression vector was constructed as follows:

[0019] The vector plasmid pCAMBIA1302 was digested with restriction endonucleases EcoRI and BamHI, and then ligated with the PCR product to construct the NbFd2-OE overexpression vector.

[0020] The present invention provides a method for cultivating PVY-resistant plants, comprising the following steps:

[0021] (1) introducing the Fd2 gene described in claim 1 into a target plant to obtain a transgenic plant;

[0022] (2) Plants overexpressing the gene were screened, and their PVY resistance was higher than that of the wild type.

[0023] Compared with the prior art, the present invention has the following beneficial effects:

[0024] The GFP fluorescence of NbFd2 overlaps with the autofluorescence of chloroplasts (red), demonstrating that NbFd2 is localized in chloroplasts. NbFd2 expression remained unchanged in the control (inoculated with 1× PBS buffer) group. However, after PVY inoculation, NbFd2 gene expression was suppressed 4 days after PVY inoculation, then increased slightly 6 and 8 days before decreasing again after 10 days, showing a dynamic pattern of initial increase followed by decrease. PVY infection significantly inhibits NbFd2 gene expression. The GFP fluorescence intensity of the NbFd2-OE overexpressing line was weaker, and the corresponding PVY CP gene expression was also lower, indicating that NbFd2 transgenic plants are more resistant to disease. PVY CP gene expression was significantly higher in tomato plants after SlFd2 silencing compared to the control group, indicating greater PVY accumulation in silenced plants. This suggests that SlFd2 may play a positive regulatory role in tomato resistance to PVY infection. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 This is the subcellular localization map of NbFd2 in Nicotiana benthamiana leaves from Example 1. The empty vector pCaMV35S-GFP is a negative control, and Chloroplast represents chloroplast autofluorescence. Bar = 20 μm.

[0026] Figure 2This is a graph showing the expression analysis of the NbFd2 gene at different times (0, 4, 6, 8, and 10 days) after PVY inoculation in Nicotiana benthamiana in Example 2; wherein, Mock is PBS, error bars represent the standard error of three biological replicates, Student's t-test (*p value < 0.05; **p value < 0.01; ***p value < 0.001), and NbActin is the internal reference gene of Nicotiana benthamiana;

[0027] Figure 3 Figure 3 shows that overexpression of the NbFd2 gene enhances the resistance of Nicotiana benthamiana to PVY. (A) Western blot detection of protein accumulation in NbFd2-overexpressing plants, OE2-1, OE3-6, OE4-8, and OE7-5 represent NbFd2 transgenic lines; Anti-RFP was used to detect the protein level of NbFd2 in transgenic lines; (B) qRT-PCR detection of the expression level of the corresponding gene in NbFd2-overexpressing plants; (C) GFP fluorescence observation under UV light 10 days after inoculation of PVY-GFP in NbFd2-overexpressing plants; (D) qRT-PCR detection of PVY accumulation in NbFd2-overexpressing plants after inoculation of PVY-GFP; error bars represent the standard error of three biological replicates, Student's t-test (**p value < 0.01; ***p value < 0.001; ****p value < 0.0001); NbActin is the internal reference gene of Nicotiana benthamiana, and the expression level of PVY CP gene is used to represent the accumulation of PVY mRNA;

[0028] Figure 4 Figure 1 shows the effect of silencing the SlFd2 gene in tomato plants to promote PVY infection. (A) Phenotype of the positive control SlPDS (phytoene dehydrogenase) in money maker plants after 14 days of gene silencing. (B) GFP fluorescence observed under UV light in SlFd2-silenced plants 10 days after inoculation with PVY-GFP. (C) The SlFd2 gene fragment was constructed into the TRV2 vector and co-infiltrated with TRV1 in tomato plants for 14 days of gene silencing. TRV2:GUS served as a negative control. (D) Expression analysis of the PVY CP gene in gene-silenced plants. Error bars represent the standard error of three biological replicates. Student's t-test (**p value < 0.01). SlActin is the internal reference gene for tomato. DETAILED DESCRIPTION

[0029] Example 1

[0030] Subcellular localization of NbFd2

[0031] Bioinformatics prediction (WoLF PSORT II) showed that NbFd2 was localized in plant chloroplasts.

[0032] To further determine the subcellular localization of NbFd2, the pCaMV35S-NbFd2-GFP fusion expression vector was constructed:

[0033] Primers were designed based on the full-length CDS sequence of the NbFd2 gene (excluding the stop codon) and the restriction enzyme cleavage site sequence on the Vazyme online website (https: / / crm.vazyme.com / cetool / singlefragment.html).

[0034] Primers were synthesized by Qingke Biotechnology (NbFd2-GFP-F SEQ ID NO. 2: 5'-agctcgggtacccggggatccATGGCCAGTATTTCAGGTACCATG-3'; NbFd2-GFP-R SEQ ID NO. 3: 5'-cttgctcaccatggtgtcgacGGCAGTGAGCTCCTCCTCC-3'). High-fidelity Taq enzyme (TransStart FastPfu DNA Polymerase, Beijing Quanshijin Biotechnology Co., Ltd.) was used to amplify the target fragment.

[0035] Amplification program: pre-denaturation at 95°C for 5 min, denaturation at 94°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 1 min, 40 cycles, followed by extension at 72°C for 5 min and storage at 4°C.

[0036] After the PCR reaction, the size of the PCR product fragment was detected by 1% agarose gel electrophoresis at a voltage of 120 V for 20 min, using DL2,000 DNA Marker (Takara) as a control.

[0037] The PCR product with the correct band size was purified using the SanPrep column-type DNA gel extraction kit (Shanghai Sangon Biotech Co., Ltd.) according to the instructions. The recovered product was stored at -20°C until use. The PCR product of NbFd2 was obtained.

[0038] Then, the vector pCaMV35S-sGFP was double-enzyme digested with the following enzyme digestion system (50 μL): 5 μL 10× Buffer, 2 μL restriction endonuclease I, 2 μL restriction endonuclease II, 2 μg pCaMV35S-sGFP empty plasmid, supplemented with ddH2O to 50 μL, and reacted at 37°C for 2 h. The enzyme digestion products were identified by 1.2% agarose gel electrophoresis and then recovered.

[0039] Finally, the PCR product was ligated with the digested vector pCaMV35S-GFP using homologous recombinase. The ligation system (10 μL) consisted of 1 μL of double-digested product, 2 μL of target gene fragment, 5 μL of ligase, and ddH2O added to 10 μL. The ligation was performed at 50°C for 15 minutes. The resulting ligation product was immediately transformed into E. coli.

[0040] Positive colonies were picked to extract plasmids, and the recombinant plasmid pCaMV35S-NbFd2-GFP was obtained. After the recombinant plasmid was transformed into Agrobacterium, the obtained positive clones were injected into tobacco, and their subcellular localization was observed using a laser confocal microscope.

[0041] The results are as follows Figure 1 As shown, the GFP fluorescence of NbFd2 coincides with the autofluorescence of plant chloroplasts (red), demonstrating that NbFd2 is localized in chloroplasts.

[0042] Example 2

[0043] NbFd2 is involved in the resistance of Nicotiana benthamiana to PVY

[0044] To detect the expression level of NbFd2 gene during PVY infection, samples were collected at different times (0, 4, 6, 8, and 10 days) after PVY inoculation of Nicotiana benthamiana. RNA was extracted and reverse transcribed into cDNA. qRT-PCR was used to detect the expression of NbFd2 gene in each sample.

[0045] The results are as follows Figure 2 As shown in the figure, there was no difference in the expression of NbFd2 in the control group (inoculated with 1× PBS buffer), but after PVY inoculation for 6d, 8d and 10d, the expression of NbFd2 gene was inhibited at 4d after PVY inoculation, and then increased slightly at 6d and 8d, and decreased again after 10d, showing a dynamic change of first increasing and then decreasing.

[0046] The above results indicate that PVY infection can significantly inhibit the expression of NbFd2 gene.

[0047] The RNA was extracted using the Trizol method, and the steps are as follows:

[0048] (1) Take 0.1 g of Nicotiana benthamiana leaf sample, place it in a sterilized centrifuge tube, quickly freeze it, and grind it into powder;

[0049] (2) Immediately add 1 mL of Trizol extract and shake thoroughly. After standing for 2 minutes, add 200 μL of RNA extract, shake immediately and let stand for 5 minutes.

[0050] (3) Centrifuge at 12000 rpm for 10 min at 4°C and transfer the supernatant to an RNase-free centrifuge tube;

[0051] (4) Immediately add an equal volume of pre-chilled isopropanol, gently invert and mix, and place in a -20°C refrigerator to settle for 30 minutes or at room temperature for 10 minutes;

[0052] (5) After standing, centrifuge at 4°C and 2000 rpm for 10 min. Carefully discard the supernatant and immediately add 1 mL of 70% alcohol to the precipitate to wash it. Repeat this step twice.

[0053] (6) Centrifuge at 12,000 rpm for 5 min at 4°C to carefully remove the alcohol and air dry. Dissolve the solution in 30 μL of DEPC water and store in a -80°C refrigerator until use.

[0054] cDNA synthesis according to III 1st Stand cDNA Synthesis Kit instructions: Synthesize cDNA using the extracted RNA as a template and store in a -20°C refrigerator until use.

[0055] Example 3

[0056] NbFd2 positively regulates the resistance of Nicotiana benthamiana to PVY

[0057] To test whether the NbFd2 gene has the function of resisting PVY infection, NbFd2 was stably overexpressed in Nicotiana benthamiana and NbFd2-OE overexpressing transgenic tobacco was constructed.

[0058] The full-length CDS amplification primers of NbFd2 (NbFd2-OE-F sequence: SEQ ID NO. 4:

[0059] 5'-tatgaccatgattacgaattcATGGCCAGTATTTCAGGTACCATG-3'

[0060] and NbFd2-OE-R sequence: SEQ ID NO.5:

[0061] 5'-caggtcgactctagaggatccGGCAGTGAGCTCCCTCC-3').

[0062] Using the designed primers, the gene was amplified from the cDNA synthesized in Example 2;

[0063] PCR amplification was performed using TransStart FastPfu FLy DNAPoLymerase (Full Gold);

[0064] Among them, the PCR amplification system is:

[0065]

[0066] PCR products were purified using Vazyme (DC301);

[0067] Construction of NbFd2-OE overexpression vector: The vector plasmid pCAMBIA1302 was digested with corresponding restriction endonucleases (EcoRI, BamHI) (Thermo, FastDiges) and the PCR products were ligated with homologous recombinases to construct the NbFd2-OE overexpression vector, namely NbFd2-pCAMBIA1302;

[0068] Ligation system (10 μL): 1 μL double enzyme digestion product, 2 μL target gene fragment, 5 μL ligase, add ddH2O to 10 μL, and ligate at 50℃ for 15 minutes.

[0069] The enzyme digestion system was (50 μL): 5 μL 10× Buffer, 2 μL restriction endonuclease I, 2 μL restriction endonuclease II, 2 μg pCAMBIA1302 empty plasmid, supplemented with ddH2O to 50 μL, reacted at 37°C for 2 h, and the digestion products were recovered after identification by 1.2% agarose gel electrophoresis.

[0070] The obtained NbFd2-OE overexpression vector was immediately transformed into Escherichia coli;

[0071] The positive clone plasmids were extracted and transformed into Agrobacterium GV3101 strain, which was then used to infect Nicotiana benthamiana callus tissue to obtain T3 transgenic plants.

[0072] The transcription and protein levels of T3 transgenic plants were detected, such as Figure 3 As shown in (A), Western blot analysis results showed that the Anti-RFP antibody could detect the NbFd2-specific band, indicating that the gene was successfully overexpressed in tobacco.

[0073] The strains with strong protein expression (NbFd2-OE3-6, NbFd2-OE7-5) were selected for gene expression analysis, e.g. Figure 3 As shown in (B), qRT-PCR results showed that the expression of NbFd2 gene in the above strains was significantly higher than that in the wild type.

[0074] Phenotypic determination was performed after further inoculation with PVY. The results of ultraviolet light observation showed that the GFP fluorescence intensity of the NbFd2-OE overexpression strain was weaker than that of the wild-type control ( Figure 3 C), and its corresponding PVY CP gene expression level was also lower ( Figure 3 D), indicating that NbFd2 transgenic plants are more disease-resistant.

[0075] Experimental Example 1

[0076] The tomato (Lycopersicon esculentum) variety is Moneymaker.

[0077] Tomato culture conditions: temperature 24 ° C, humidity 60%, light 16 h, dark 8 h.

[0078] Silencing the tomato SlFd2 gene promotes PVY infection

[0079] Tomato was selected as the research object, and TRV-mediated gene silencing method was used to silence genes in tomatoes.

[0080] The silencing method is as follows: a specific primer for silencing the SlFd2 gene (SlFd2-TRV2-F SEQ ID NO.7:

[0081] 5'-gtgagtaaggttaccgaattcATGGCTAGTATTTCTGGTACAATGATTA-3';SlFd2-TRV2-RSEQ ID NO.8:

[0082] 5'-cgtgagctcggtaccggatccAGCAGTAACTTTTCCAGCACAAGA-3'), and the fragments were amplified and constructed into the TRV2 vector.

[0083] (http: / / www.honorgene.com / product_list / carrier_library / 123303.html), and co-infiltrated tomato leaves with TRV1 for 14 days

[0084] The leaves of the silenced plants were then inoculated with PVY-GFP by friction and their infection status was analyzed.

[0085] The leaves and new leaves of the positive control TRV2:SlPDS system were all bleached, while the negative control TRV2:GUS did not show bleaching, indicating that the silencing effect was good ( Figure 4 A).

[0086] In order to detect the gene silencing efficiency, systemic leaves of the control group (TRV2:GUS) and the SlFd2 silenced group were taken, and the silencing efficiency of the above genes was detected by qRT-PCR. The results showed that the expression of the SlFd2 gene was significantly downregulated compared with the control, and the silencing efficiency was 88% ( Figure 4 B).

[0087] The silencing efficiency was calculated by dividing the average qRT-PCR expression of the SlFd2 gene in the silenced plants by that in the control group.

[0088] The leaves of the gene-silenced plants and the control plants were inoculated with PVY-GFP. The GFP fluorescence signal was observed under UV light 10 days after infection. The results showed that GFP fluorescence appeared in the leaves of the SlFd2 gene-silenced plants, and the fluorescence brightness and intensity were higher than those of the control TRV2:GUS plants ( Figure 4 C).

[0089] Subsequently, the RNA of the above samples was extracted and reverse transcribed, and the expression of PVY CP gene was detected by qRT-PCR. The results showed that the expression of PVY CP gene was significantly higher after silencing tomato SlFd2 than that of the control group ( Figure 4 D), showing that PVY accumulated more in silenced plants.

[0090] The above results indicate that SlFd2 plays a positive regulatory role in tomato resistance to PVY infection.

[0091] NbFd2 gene sequence, SEQ ID NO.1:

[0092] 5'-ATGGCCAGTATTTCAGGTACCATGGTTAGCACCTCTTTCCTCCCAAG GAAACCAGTAGTGACTAGCCTGAAAGCCATACCAAATGTTGGGCAAGCTCTCTTTGGTCTTAAATCTCAGAGGGGTGGTAGGATTACTTGCATGGCCAGTTACAAAGTGAAGCTTATTACACCAGAGGGAGCTGTTGAATTTGATTGTCCAGATGATGTTTACATTCTTGATCAAGCTGAGGAAATGGGACATGAT CTTCCTTACTCATGCAGAGCTGGTTCTTGCTCTTCTTGTGCTGGAAAAGTTACAGCTGGAAATGTTGATCAGTCTGATGGAAACTTTCTTGATGATGACCAAATGGCTGATGGATTTGTGCTAACCTGTGTTGCTTACCCACAGTCTGATGTTACTATTGAGACTCACAAGGAGGAGGAGCTCACTGCCTAA-3';

[0093] NbFd2-GFP-F primer, SEQ ID NO. 2:

[0094] 5'-agctcgggtacccggggatccATGGCCAGTATTTCAGGTACCATG-3';

[0095] NbFd2-GFP-R primer, SEQ ID NO.3:

[0096] NbFd2-GFP-R: 5'-cttgctcaccatggtgtcgacGGCAGTGAGCTCCTCCTCC-3';

[0097] NbFd2-OE-F: SEQ ID NO.4:

[0098] 5'-tatgaccatgattacgaattcATGGCCAGTATTTCAGGTACCATG-3';

[0099] NbFd2-OE-R: SEQ ID NO.5:

[0100] 5'-caggtcgactctagaggatccGGCAGTGAGCTCCTCCTCC-3'.

[0101] SlFd2 gene sequence, SEQ ID NO.6:

[0102] 5'-ATGGCTAGTATTTCTGGTACAATGATTAGCACTTCTTTCCTTCCAAGA AAGCCAGCTGTGACTAGCCTCAAAGCCATATCAAATGTTGGTGAAGCTTTGTTTGGTCTTAAATCTGGTAGAAATGGGAGGATTACTTGCATGGCCAGTTACAAAGTGAAGCTTATTACACCAGAAGGACCTATTGAATTTGAATGCCCAGATGATGTTTACATTCTTGACCAAGCTGAGGAAGAAGGACATGACCTTCCTTACTCATGCAGGGCTGGTTCTTGCTCATCTTGTGCTGGAAAAGTTACTGCTGGAAGTGTTGATCAGTCTGATGGAAACTTCCTTGATGAGGACCAAGAAGCTGCTGGATTTGTGCTTACTTGTGTTGCTTACCCAAAGGGTGATGTTACCATTGAGACTCACAAGGAGGAGGAGCTTACTGCTTAA-3';

[0103] SlFd2-TRV2-F primer, SEQ ID NO. 7:

[0104] 5'-gtgagtaaggttaccgaattcATGGCTAGTATTTCTGGTACAATGATTA-3';

[0105] SlFd2-TRV2-R primer, SEQ ID NO.8:

[0106] 5'-cgtgagctcggtaccggatccAGCAGTAACTTTTCCAGCACAAGA-3'.

[0107] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. Application of the Fd2 gene in enhancing plant PVY resistance, characterized in that: By increasing the expression level of the Fd2 gene in plants, the accumulation of viruses after PVY infection is reduced; Among them, the Fd2 gene is SEQ ID NO.1 or SEQ ID NO.

6.

2. The use according to claim 1, characterized in that The protein encoded by the gene is localized in plant chloroplasts.

3. The use according to claim 1, characterized in that The plant is a Solanaceae plant.

4. The use according to claim 3, characterized in that The Solanaceae plant is Nicotiana benthamiana or tomato.

5. The use according to claim 1 or 2, characterized in that: The gene is derived from Nicotiana benthamiana or tomato.

6. A method for constructing a PVY-resistant plant, characterized in that: The following steps are involved: (1) Amplify the target gene using the primer pair of SEQ ID NO. 4 and SEQ ID NO. 5 to obtain a PCR product; (2) Construction of NbFd2-OE overexpression vector; (3) transforming the NbFd2-OE overexpression vector obtained in step (2) into Escherichia coli and extracting the positive clone plasmid; (4) The plasmid is transformed into Agrobacterium, which infects plant callus tissue to obtain transgenic plants.

7. The method according to claim 6, characterized in that The NbFd2-OE overexpression vector was constructed as follows: The vector plasmid pCAMBIA1302 was digested with restriction endonucleases EcoRI and BamHI, and then ligated with the PCR product to construct the NbFd2-OE overexpression vector.

8. A method for cultivating PVY-resistant plants, characterized in that: The steps include: (1) introducing the Fd2 gene described in claim 1 into a target plant to obtain a transgenic plant; (2) Plants overexpressing the gene were screened, and their PVY resistance was higher than that of the wild type.

Images