Application of PyAPX gene in regulation and control of crop salt tolerance and / or salt-tolerant crop breeding

Abstract

The invention belongs to the technical field of plant genetic engineering, and particularly relates to application of a PyAPX gene in regulation and control of crop salt tolerance and / or salt-tolerant crop breeding. The nucleotide sequence of the PyAPX gene disclosed by the invention is as shown in SEQ ID NO: 1. Compared with wild crops, overexpression of the PyAPX gene in the crops can effectively improve the seed germination rate, chlorophyll content, SOD and APX enzyme activity of the crops under salt stress, maintain high K < + > / Na < + > and reduce the content of malondialdehyde, so that the salt tolerance of the crops is effectively improved. Therefore, the invention provides a new way for creating salt-tolerant crops.

Description

Technical Field

[0001] The present invention belongs to the field of plant genetic engineering technology and specifically relates to PyAPX Application of genes in regulating crop salt tolerance and / or breeding of salt-tolerant crops. Background Art

[0002] Soil salinization is a major abiotic stress that severely restricts plant growth and development. Salt stress disrupts plant ion homeostasis, limits water uptake, and impairs nutrient acquisition. To combat salt-induced damage, plants activate a series of adaptive responses, including the induction of stress-responsive genes, accumulation of non-enzymatic antioxidants and compatible solutes, activation of antioxidant defense mechanisms, regulation of ion transport, and ion compartmentalization.

[0003] Plants are broadly divided into glycophytes and halophytes based on their tolerance to salt stress. Halophytes are highly salt-tolerant and can grow and reproduce in high salt concentrations, while glycophytes experience ionic, osmotic, and oxidative stresses under high salt concentrations. Seaweed is a typical halophyte and, due to its long-term immersion in seawater, possesses remarkable salt tolerance, enabling it to survive extreme salt stress environments. These halophytes are valuable plant genetic resources and potential sources of novel salt-tolerance genes that can be used in molecular breeding programs to enhance crop tolerance to abiotic stresses.

[0004] Porphyra yezoensis ( Pyropia yezoensis ) and Kappaphycus longicornis ( Kappaphycus alvarezii ) are widely cultivated, important marine commercial crops. They possess strong tolerance to salt stress and hold broad application prospects in screening for genes associated with salt tolerance. However, it is currently unclear whether the salt stress-related genes in Porphyra yezoensis and Kappaphysonii can improve salt tolerance in crops. Therefore, the application of genes identified from Porphyra yezoensis and Kappaphysonii that can regulate crop salt tolerance in crop breeding has become an urgent challenge in this field. Summary of the Invention

[0005] In order to solve the problem that the prior art lacks genes that can regulate the salt tolerance of crops screened from halophytes, the present invention provides PyAPX The application of genes in regulating crop salt tolerance and / or salt-tolerant crop breeding specifically includes the following technical solutions: The present invention provides PyAPX Gene or overexpression PyAPX The use of genetic biological materials, said use comprising any one of the following: 1) Improve crop salt tolerance; 2) Breeding of salt-tolerant crops; described PyAPX The nucleotide sequence of the gene is shown in SEQ ID NO: 1.

[0006] Preferably, the improvement of crop salt tolerance includes one or more of the following six items: (1) Improve seed germination rate; (2) Increase the chlorophyll content in crops; (3) Reduce the content of malondialdehyde; (4) Increase SOD enzyme activity; (5) Increase APX enzyme activity; (6) Maintain K + / Na + level.

[0007] Preferably, the salt-tolerant crop breeding comprises overexpressing PyAPX Genes can be used to improve the salt tolerance of crops and obtain salt-tolerant crops.

[0008] Preferably, the overexpression step comprises overexpressing PyAPX The biomaterial of the gene is transformed into crops to obtain crops with improved salt tolerance.

[0009] The present invention also provides an overexpression PyAPX Genetic biomaterials, including overexpression PyAPX one or more of a primer pair for a gene, a recombinant vector, and a recombinant microorganism; described PyAPX The nucleotide sequence of the gene is shown in SEQ ID NO: 1.

[0010] Preferably, the primer pair includes PyAPX-F and PyAPX-R, the sequence of PyAPX-F is shown in SEQ ID NO:4, and the sequence of PyAPX-R is shown in SEQ ID NO:5.

[0011] Preferably, the basic vector of the recombinant vector includes a plasmid vector; the plasmid vector includes a pCAMBIA1301 vector.

[0012] Preferably, the starting microorganism of the recombinant microorganism comprises the GV3101 Agrobacterium strain.

[0013] The beneficial effects of the present invention are: The present invention provides PyAPX Gene or overexpression PyAPX Application of genetic biological materials in improving crop salt tolerance and / or in salt-tolerant crop breeding, PyAPX The nucleotide sequence of the gene is shown in SEQ ID NO: 1. Compared with wild-type crops, the overexpression in crops PyAPXThe gene can improve the seed germination rate, chlorophyll content, SOD and APX enzyme activities of crops under salt stress, maintain a high K + / Na + , and reduce the content of malondialdehyde, thereby effectively improving the salt tolerance of crops. It can be seen that the present invention provides a new way to create salt-tolerant crops. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments are briefly introduced below.

[0015] Figure 1 The seed germination rates of ZH11 and each gene overexpression group in Example 1 of the present invention under ultrapure water and saline treatments; Among them, CK represents ultrapure water treatment, NaCl represents 0.8% by mass NaCl treatment; different letters indicate significant differences. P <0.05; ZH11 represents the germination rate of Zhonghua 11, PyMnSOD-3 and PyMnSOD-8 represent different rice PyMnSOD Germination rate of seeds produced by transgenic lines; PyAPX-14 and PyAPX-16 represent different rice PyAPX The germination rate of seeds produced by transgenic lines; KaNa + / H + -30, KaNa + / H + -26 indicates different rice varieties KaNa + / H + Germination rate of seeds produced by transgenic lines; Figure 2 The test results of the physiological and biochemical indicators of each group of rice in Example 2 of the present invention are as follows; Among them, A is the test result of rice plant height in each group, and different letters indicate significant differences. P <0.05; B is the root length test results of rice in each group, different letters indicate significant differences, P <0.05; C is the chlorophyll a content test results of rice in each group, different letters indicate significant differences, P <0.05; D is the chlorophyll b content test results of rice in each group, different letters indicate significant differences, P <0.05; Figure 3 The test results of the physiological and biochemical indicators of each group of rice in Example 2 of the present invention are as follows; Among them, A is the test result of propylene glycol content in rice of each group, and different letters indicate significant differences. P <0.05; B is the SOD enzyme activity test results of rice in each group, different letters indicate significant differences, P <0.05; C is the test results of POD enzyme activity content of rice in each group, different letters indicate significant differences, P <0.05; D is the test result of CAT enzyme activity content of rice in each group, different letters indicate significant differences, P <0.05; E is the detection result of APX enzyme activity content of rice in each group, different letters indicate significant differences, P <0.05. DETAILED DESCRIPTION

[0016] The present invention provides PyAPX Gene or overexpression PyAPX Application of biomaterials containing genes, said application comprising any one of the following two items: 1) improving salt tolerance of crops; 2) breeding of salt-tolerant crops; PyAPX The nucleotide sequence of the gene is shown in SEQ ID NO: 1.

[0017] PyAPXGene (SEQ ID NO: 1): 5'--3'.

[0018] As an embodiment, the method of improving crop salt tolerance according to the present invention includes one or more of the following six items: (1) Improve seed germination rate; (2) Increase the chlorophyll content in crops; (3) Reduce the content of malondialdehyde; (4) Increase SOD enzyme activity; (5) Increase APX enzyme activity; (6) Maintain K + / Na + level.

[0019] As an embodiment, the salt-tolerant crop breeding includes overexpressing PyAPX Gene, improve the salt tolerance of crops, and obtain salt-tolerant crops. As an embodiment, the overexpression PyAPX The gene-transferring step includes constructing a recombinant vector, using the recombinant vector to construct a recombinant microorganism, and then using the Agrobacterium transformation method to transform the recombinant microorganism into the target crop to obtain a salt-tolerant crop. As an embodiment, the salt tolerance of the salt-tolerant crop includes one or more of the following six items: (1) improving the seed germination rate; (2) increasing the chlorophyll content in the crop; (3) reducing the malondialdehyde content; (4) increasing the SOD enzyme activity; (5) increasing the APX enzyme activity; (6) maintaining K + / Na + level.

[0020] The present invention also provides an overexpression PyAPX Genetic biomaterials, including overexpression PyAPX One or more of a primer pair for a gene, a recombinant vector, and a recombinant microorganism; described PyAPX The nucleotide sequence of the gene is shown in SEQ ID NO: 1.

[0021] In one embodiment, the primer pair includes PyAPX-F and PyAPX-R, the sequence of PyAPX-F is shown in SEQ ID NO:4, and the sequence of PyAPX-R is shown in SEQ ID NO:5.

[0022] SEQ ID NO: 4: 5'-TTTACACTTTATGCTTCCGGCTATGGTGTCTGACCTGGAGAAGG-3'; SEQ ID NO: 5'-ACAAGTAAAGCGGCCGCGACTTCACGCCCAAACCGCGCCCAAC-3'; As an embodiment, the basic vector of the recombinant vector includes a plasmid vector. As an embodiment, the plasmid vector includes a pCAMBIA1301 vector.

[0023] In one embodiment, the starting microorganism of the recombinant microorganism comprises bacteria. In one embodiment, the bacteria comprises Agrobacterium tumefaciens strain GV3101.

[0024] In order to further illustrate the present invention, the following is a diagram of the present invention with reference to the accompanying drawings and embodiments. PyAPX The application of the gene in regulating crop salt tolerance and / or salt-tolerant crop breeding is described in detail, but they should not be understood as limiting the scope of protection of the present invention.

[0025] Unless otherwise specified, the reagents used in the present invention are all purchased conventionally in the art; the experimental methods used in the present invention are all conventional operations in the art.

[0026] Example 1 Methods for obtaining transgenic rice T1 generation According to prior art reports, the present invention selects genes related to seaweed salt tolerance: PyAPX 、 PyMnSOD 、 KaNa + / H + Gene experiments were conducted to verify the feasibility of using seaweed salt-tolerance-related genes in improving crop salt tolerance.

[0027] According to SEQ ID NO: 1 to SEQ ID NO: 3 PyAPX 、 PyMnSOD 、 KaNa + / H + The gene sequence was synthesized.

[0028] PyAPX The gene sequence is shown in SEQ ID NO: 1 as described above.

[0029] PyMnSOD Genes and KaNa + / H + The DNA sequence of the gene is shown below: PyMnSOD(SEQ ID NO:2):5'-ATGGCGTTTGCTCTGCCCCCCCTGCCCTATGCGTACGATGCCCTCGAGCCGTACATCGACTCGACGACGATGAACATCCACCACACCAAGCACCACAACACATATGTGACCAACGTCAACAACGTGCTCGCAGGCGAGAATGGCGGCGCCCTCAAGGGCCTGAGCCTGAGCGCCATCCAGAAGGAAGTCGTGACCCTGCCCGACTCCATCAAGACGGCGGTGCGCAACAGCGGTGGCGGCCACTGGAACCACTCCTTCTTTTGGAGTGTCATGGGCAAGACCGGCAGCATTGCCGAGGCCCCGACGGGTGACCTCAAGTCGAGCATTGAGTCTACCTTTGGCTCCCTCGACGAGATGCAAAAGAAGTTCAACACGGCCGCGGCGTCCCGCTTTGGCTCTGGCTGGGCGTGGCTTTCCGTGAACGCTGACGGGCAGCTGTTCATCAGCAGCACTCCCAACCAGGACAACCCACTCATGGAGGGCATCGTCGACCAGCCGGGGACGCCCATTTTGGGCCTGGATGTGTGGGAGCACGCCTACTACCTCAAGTACCAGAACCGCCGGCCGGAGTATATTGCGTCGTGGTGGAAGACCGTCGACTTTGACGTCATTGCCAAGAACTACTCCGCGGCCAAGTCGGGTGGGCTGCCTGCCTTTGACACGCCGCTGGTGTAA-3'; KaNa + / H +(SEQ ID NO:3):5'--3'.

[0030] Using pCAMBIA1301 as the base vector, BamH I and Kpn I double enzyme digestion linearized vector; using the synthesized gene sequences of SEQ ID NO: 1 to SEQ ID NO: 3 as templates, using amplification primers PyAPX-F / PyAPX-R, PyMnSOD-F / PyMnSOD-R and KaNa + / H + -F / KaNa + / H+ -R respectively obtain PyAPX 、 PyMnSOD and KaNa + / H + gene fragment; under the action of homologous recombinase, PyAPX 、 PyMnSOD and KaNa + / H + The gene fragments were ligated with the linearized pCAMBIA1301 vector to obtain pCAMBIA1301-35S:PyAPX, pCAMBIA1301-35S:PyMnSOD and pCAMBIA1301-35S:KaNa + / H + The expression vectors obtained in the above steps were transformed into Agrobacterium GV3101 to obtain vectors carrying pCAMBIA1301-35S:PyAPX, pCAMBIA1301-35S:PyMnSOD and pCAMBIA1301-35S:KaNa + / H + The GV3101 Agrobacterium strain overexpressing the vector was used to transform rice into the rice Zhonghua 11 (ZH11) strain. Transformed seedlings were screened on resistance plates containing hygromycin at a final concentration of 15 mg / L to obtain positive T1 transgenic rice seedlings.

[0031] PyAPX-F (SEQ ID NO:4): 5'-TTTACACTTTATGCTTCCGGCTATGGTGTCTGACCTGGAGAAGG-3'; PyAPX-R (SEQ ID NO:5): 5'-ACAAGTAAAGCGGCCGCGACTTCACGCCCAAACCGCGCCCAAC-3'; PyMnSOD-F (SEQ ID NO:6): 5'-TTTACACTTTATGCTTCCGGCTATGGCGTTTGCTCTGCCCCCCC-3'; PyMnSOD-R (SEQ ID NO:7): 5'-ACAAGTAAAGCGGCCGCGACTTTACACCAGCGGCGTGTCAAAG-3'; KaNa + / H +-F (SEQ ID NO:8): 5'-TTTACACTTTATGCTTCCGGCTATGGCAGACCTCTTCATTCCAT-3'; KaNa + / H + -R (SEQ ID NO:9): 5'-ACAAGTAAAGCGGCCGCGACTTCATAATCCTAGGGAGGCCGTT-3'.

[0032] Salt treatment during rice germination period: The seeds of rice Zhonghua 11 and PyAPX 、 PyMnSOD 、 KaNa + / H + The seeds of T1 transgenic rice with positive gene were used as experimental materials in this example.

[0033] Before seed germination, seeds of ZH11 and positive T1 transgenic rice were placed in 50 mL centrifuge tubes, and 70% ethanol solution was added until the seeds were submerged. After standing for 1 min for disinfection, the seeds were shaken with 1% sodium hypochlorite for 30 min. After the shaking, the seeds were rinsed with sterile water 5 times and then placed on a plate (9 cm diameter) containing three layers of filter paper.

[0034] Convert the above ZH11 and PyAPX 、 PyMnSOD 、 KaNa + / H + 180 T1 transgenic rice seeds of each gene were evenly distributed in a Petri dish. Each culture medium served as a replicate, and each treatment was replicated six times. Three of the six replicates in each treatment were treated with 20 mL of ultrapure water as a control, and the remaining three replicates were treated with 20 mL of 0.8% NaCl solution. The ultrapure water or 0.8% NaCl solution in the Petri dish was replaced every 24 hours.

[0035] The culture dish was placed in an incubator at 28°C with a 16 h light / 8 h dark cycle. The germination rate of rice seeds was statistically analyzed after 6 days of treatment, using the appearance of radicle as the criterion for seed germination. Figure 1 shown.

[0036] Depend on Figure 1 It can be seen that under the control group (ultrapure water) conditions, PyAPX , PyMnSOD and KaNa+ / H + There was no difference in germination rate between the overexpression strains and the wild type Zhonghua 11; 0.8% NaCl treatment had a certain inhibitory effect on seed germination of all strains, among which, PyAPX The germination rate of the overexpression strain was significantly higher than that of the wild-type control. PyMnSOD and KaNa + / H + The germination rate of the overexpression strain was significantly lower than that of the wild-type control. PyAPX Gene can improve the germination rate of rice seeds under salt stress.

[0037] Example 2 Salt stress treatment of rice seedlings Middle Flower 11 and Transfer PyAPX 、 PyMnSOD 、 KaNa + / H + Seeds of the T1 transgenic rice strains positive for the gene were grown in culture baskets. Six baskets were planted for each of the ZH11 and each of the positive T1 transgenic rice strains, with 18 rice plants per basket. After three weeks of normal growth, the water in three baskets of ZH11 and each of the positive T1 transgenic rice strains was replaced with a 250 mM NaCl solution, equivalent to the normal watering volume, to serve as salt stress treatments. The remaining three baskets were irrigated with ultrapure water, equivalent to the normal watering volume, to serve as control treatments. After two weeks of growth, rice samples from the control (plants grown in water) and salt stress treatments were collected for subsequent phenotypic and physicochemical characterization. The physiological and biochemical parameters tested and their results are shown below.

[0038] (1) Plant height and root length measurement The plant height and root length of the seedlings in each treatment were measured.

[0039] Table 1 Plant height and root length of crops in each group (cm)

[0040] Note: Different letters in the same column of data in Table 1 indicate significant differences ( P <0.05).

[0041] The results of the test are as follows Figure 2 As shown in A and B and Table 1, under CK conditions, KaNa + / H + Overexpression of α-aminobutyric acid increased the plant height of rice; under 250 mM NaCl treatment, the plant height of each line was significantly inhibited.PyAPX , PyMnSOD and KaNa + / H + The plant heights of the overexpression lines were all higher than those of the wild-type control. PyAPX The overexpression lines had the highest plant height; the root lengths of the overexpression lines had no significant differences from those of the wild type under the control and salt stress conditions. PyAPX Overexpression of β-catenin enhances salt tolerance in rice seedlings.

[0042] (2) Determination of chlorophyll content 0.1 g of rice leaves were taken from each group, placed in a pre-cooled mortar, and ground into powder with liquid nitrogen. 20 mL of 95% ethanol solution was added and mixed with the powder to extract the chlorophyll in the powder. The mixture of ethanol and powder was centrifuged at 4000 r / min for 10 min, and the supernatant was collected. The absorbance of the supernatant was measured at 440 nm, 649 nm, and 665 nm, respectively. The contents of chlorophyll a and chlorophyll b were calculated according to the formula shown below.

[0043] Chlorophyll a concentration (mg / L) = 12.71 × A 665 -2.59×A 649 ; Chlorophyll b concentration (mg / L) = 22.88 × A 649 -4.67×A 665 .

[0044] Table 2 Chlorophyll a and chlorophyll b content of crops in each group (mg / L)

[0045] Note: Different letters in the same column of data in Table 2 indicate significant differences ( P <0.05).

[0046] The results are as follows Figure 2 As shown in C and D in Table 2, it can be seen that PyAPX , PyMnSOD and KaNa + / H + The chlorophyll a content of the overexpression strain had no significant difference compared with the wild type ZH11 under both control and salt treatment conditions; PyAPX The chlorophyll b content of the overexpression strain was significantly higher than that of the wild type ZH11 under salt stress conditions. PyMnSOD and KaNa + / H +The chlorophyll b content of the overexpression strain was not different from that of the wild type ZH11, indicating that PyAPX The overexpression strain has higher salt tolerance and can increase the chlorophyll b content of rice under salt stress conditions.

[0047] (3) Determination of malondialdehyde (MDA) content For each of the above groups, 0.1 g of rice leaves were collected and placed in a pre-chilled mortar and pestle, then ground into a powder with liquid nitrogen. 3 mL of 10% trichloroacetic acid (TCA) was added and mixed thoroughly. The mixture was centrifuged at 4000 rpm for 10 min. 800 μL of the supernatant was transferred to a new 2 mL centrifuge tube, and 800 μL of 0.6% thiobarbituric acid (TBA) was added to prepare a mixed solution. The mixture was heated at 100°C for 15 min and then immediately cooled in an ice bath. The cooled mixture was centrifuged at 10,000 rpm for 15 min. 200 μL of the supernatant was transferred to an ELISA plate, and the absorbance was measured at 450 nm, 532 nm, and 600 nm. MDA content was calculated according to the formula shown below.

[0048] MDA content (μmol / g) = (6.45 × (A 532 -A 600 )-0.56×A 450 )*(3 / 0.8) / 0.1.

[0049] Table 3 MDA content in crops of each group (μmol / g FW)

[0050] Note: Different letters in the same column of data in Table 3 indicate significant differences ( P <0.05).

[0051] The results are as follows Figure 3 As shown in Figure A and Table 3, it can be seen that salt stress caused the MDA content in each strain to increase significantly; under salt stress conditions, KaNa + / H + The MDA content in the overexpression lines was significantly higher than that in the wild-type control. PyMnSOD and PyAPX The MDA content in the overexpression strain was significantly lower than that in the wild-type control. PyAPX The content in the overexpressing plants was the lowest.

[0052] (4) Determination of oxidative clearance-related enzyme activity 0.1 g of rice leaves from each group were collected and the levels of superoxide dismutase, peroxidase, catalase, and ascorbate peroxidase were measured. Specific methods for activity determination are provided in the instructions for the superoxide dismutase (SOD) activity assay kit (D799593-0050), peroxidase (POD) activity assay kit (D799591-0050), catalase (CAT) activity assay kit (D799597-0050), and ascorbate peroxidase (APX) activity assay kit (D799461-0050) from Shanghai Shenggong Co., Ltd. All four enzyme activities were assayed using ultraviolet colorimetry.

[0053] Table 4 Contents of oxidative scavenging enzymes in crops of each group

[0054] Note: Different letters in the same column of data in Table 4 indicate significant differences ( P <0.05).

[0055] The results are as follows Figure 3 As shown in Figures B to E and Table 4, KaNa + / H + The overexpression of had no effect on the activities of SOD, CAT, POD, and CAT enzymes in rice seedlings under normal conditions and salt treatment conditions; PyMnSOD The SOD activity of the overexpression plants was significantly higher than that of the wild-type control under both control and salt treatment conditions. PyAPX The SOD and APX activities in the overexpression plants were significantly higher than those in the wild-type control under both control and salt treatment conditions.

[0056] (5) Na + and K + Content determination The wild type and PyAPX Roots and leaves of the overexpression lines under control and salt treatment conditions were dried at 65°C for 3 days to constant weight, and the dry weight of the samples was recorded. The samples were digested in nitric acid at 110°C for 6 h. Na was then measured using an optical emission spectrometer (ICP, Optima 8000, PerkinElmer, USA). + and K + content.

[0057] Table 5 Na + and K + Content determination results

[0058] Note: Different letters in the same column of data in Table 5 indicate significant differences ( P <0.05).

[0059] As shown in Table 5, under salt stress, overexpression PyAPX The Na⁺ level in leaves of rice with ZH11 gene did not increase significantly compared with that of ZH11, while the Na⁺ level in roots was significantly lower than that of ZH11. PyAPX K in leaves and roots of overexpressing lines + The level dropped significantly, but PyAPX K in leaves and roots of overexpressing lines + The decrease is relatively small. PyAPX Overexpression lines have stronger K + Retention capacity and less Na + Accumulation effect, thus maintaining high K + / Na + .

[0060] Under salt stress, sodium ions Na + Excessive accumulation of Na can disrupt cytoplasmic ion homeostasis. + The steady state is mainly composed of Na + / H + Antiporters (NHX) maintain, by limiting Na + Salt stress also triggers the overproduction of reactive oxygen species (ROS), including superoxide anions (O 2- ), hydrogen peroxide (H2O2), singlet oxygen (¹O2) and hydroxyl radicals (HO·). These reactive oxygen species are produced in various cellular compartments under normal conditions and maintain a dynamic balance. At low concentrations, ROS act as important signaling molecules to regulate plant growth and stress responses. However, excessive ROS accumulation under salt stress can cause oxidative damage. In order to alleviate oxidative stress, plants have developed a powerful antioxidant defense system consisting of enzymatic and non-enzymatic components. The main enzymatic antioxidants include superoxide dismutase (SOD), catalase (CAT) and enzymes in the ascorbate-glutathione cycle, such as ascorbate peroxidase (APX), glutathione peroxidase (GPX), monodehydroascorbate reductase (MDHAR), dehydroascorbate reductase (DHAR) and glutathione reductase (GR). Among them, SOD plays a key role, converting O 2- The present invention is to overexpress PyAPX After the gene was expressed, the activity and content of oxidative clearance-related enzymes in crops were significantly increased, indicating that overexpression PyAPX Genes can improve the antioxidant capacity of crops under salt stress.

[0061] (6) Yield experiment The T1 generation transgenic plants are planted according to conventional operations, and T2 generation transgenic seeds are obtained after the crops mature.

[0062] The control group was transformed into flower 11 and T2 PyAPX 、 PyMnSOD 、 KaNa + / H + The plants with the gene were planted in ponds with salinity of 0% (control group) and 0.8%. Each material was planted in ponds with different salinity for 25 m 2 , three replicates were arranged in random blocks, and the yield per mu data after harvest are shown in Table 6.

[0063] Table 6 Transgenic rice yield data under salt stress

[0064] Note: Different letters in the same column of data in Table 6 indicate significant differences ( P <0.05).

[0065] As shown in Table 6, under normal conditions, the yield of Zhonghua 11 was 505.5 kg per mu, and the yield of the three transgenic lines was around 500 kg, with no significant difference compared with the control. However, under 0.8% NaCl stress, the yield of Zhonghua 11 was 420.3 kg per mu, a decrease of about 16.9% compared with normal conditions; PyAPX The yield of the rice with the gene was 452.7 kg / mu, which was about 9.7% lower than that under normal conditions, but 7.7% higher than that of the control under the same conditions. PyMnSOD and KaNa + / H + The rice with the gene was basically the same as the control under salt stress conditions, with no significant difference.

[0066] In summary, the present invention uses seaweed Pyropia yezoensis in PyAPX and PyMnSOD and seaweed Kappaphycus alvarezii in KaNa + / H + Overexpression was performed in rice (Zhonghua 11), and the results of salt stress treatment during the germination and seedling stages showed that PyAPX Overexpression of α-aminobutyric acid can improve the seed germination rate of rice under salt stress conditions, increase the chlorophyll content of seedlings under salt stress, reduce the content of malondialdehyde, increase the activity of SOD and APX enzymes, and maintain a high K + / Na +The invention provides a new approach for breeding crops to improve their salt tolerance.

[0067] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments like this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.

Claims

1. PyAPX Gene or overexpression PyAPX Application of genetic biomaterials, characterized in that The application includes either of the following: 1) Improve crop salt tolerance; 2) Breeding of salt-tolerant crops; described PyAPX The nucleotide sequence of the gene is shown in SEQ ID NO:

1.

2. The use according to claim 1, characterized in that Improving crop salt tolerance includes one or more of the following six items: (1) Improve seed germination rate; (2) Increase the chlorophyll content in crops; (3) Reduce the content of malondialdehyde; (4) Increase SOD enzyme activity; (5) Increase APX enzyme activity; (6) Maintain K + / Na + level.

3. The use according to claim 1, characterized in that The salt-tolerant crop breeding includes overexpression in crops PyAPX Genes can be used to improve the salt tolerance of crops and obtain salt-tolerant crops.

4. The use according to claim 3, characterized in that The overexpression step comprises overexpressing PyAPX The biomaterial of the gene is transformed into crops to obtain crops with improved salt tolerance.

5. Overexpression PyAPX Genetic biomaterial, characterized in that Including overexpression PyAPX One or more of a primer pair for a gene, a recombinant vector, and a recombinant microorganism; described PyAPX The nucleotide sequence of the gene is shown in SEQ ID NO:

1.

6. The biomaterial according to claim 5, wherein The primer pair includes PyAPX-F and PyAPX-R, the sequence of PyAPX-F is shown in SEQ ID NO:4, and the sequence of PyAPX-R is shown in SEQ ID NO:

5.

7. The biomaterial according to claim 5, wherein The basic vector of the recombinant vector includes a plasmid vector; the plasmid vector includes a pCAMBIA1301 vector.

8. The biomaterial according to claim 5, wherein The starting microorganisms of the recombinant microorganism include the GV3101 Agrobacterium strain.

Images