Molecular marker linked with gossypium barbadense wilt-resistant major site qrFw-D03 and application

By developing molecular markers linked to the main effect locus qrFw-D03 of island cotton wilt resistance and using SNP loci for island cotton wilt resistance identification and breeding, the problem of slow progress in island cotton breeding was solved, rapid and accurate breeding selection was achieved, and resistance was improved.

CN120666092APending Publication Date: 2025-09-19JIANGSU ACAD OF AGRI SCI +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510941831.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-08
Publication Date
2025-09-19

AI Technical Summary

Technical Problem

Research on sea island cotton's resistance to wilt disease has been slow, and existing technologies make it difficult to effectively locate and utilize the main wilt-resistant loci of sea island cotton itself, resulting in slow breeding progress and narrow resistance.

Method used

A molecular marker linked to the main effect locus qrFw-D03 of sea island cotton wilt resistance was developed. Molecular markers of three SNP loci, SNP-1861791, SNP-2288438 and SNP-2367176, were used to identify and breed sea island cotton wilt resistance. The genotypes of these loci were detected to predict and screen resistant materials.

Benefits of technology

It significantly improved the resistance of sea island cotton to wilt disease, achieved rapid and accurate breeding selection, and improved breeding efficiency and speed.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120666092A_ABST
    Figure CN120666092A_ABST
Patent Text Reader

Abstract

The invention discloses a molecular marker linked with an anti-fusarium wilt major site qrFw-D03 of sea island cotton and application, and belongs to the technical field of molecular markers, the fusarium wilt resistance site is from a D03 chromosome of the sea island cotton, and the molecular marker linked with the major fusarium wilt resistance site is SNP-1861791, SNP-2288438 and SNP-2367176. According to the method, sea island cotton strains with extreme resistance and infection of fusarium wilt, namely 'Long Color Anti No.1' and 'Long Color Sensing No.1', are taken as parents, a segregation population is constructed, and through replacement mapping and QTL (Quantitative Trait Locus) positioning, the result shows that the sea island cotton fusarium wilt resistance site qrFw-D03 is closely linked with SNP-1861791, SNP-2288438 and SNP-2367176. 63 verified sea island cotton materials are used for verification, and the result shows that the fusarium wilt resistance of the cotton material with the genotype of CC / CC / GG is obviously higher than that of an individual with the genotype of TT / TT / AA. The sea island cotton fusarium wilt resistance site and the linkage marker thereof disclosed by the invention can be applied to sea island cotton fusarium wilt resistance molecular marker-assisted breeding, and the breeding process of fusarium wilt-resistant sea island cotton is accelerated.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular markers, and in particular relates to a molecular marker linked to a major wilt resistance locus qrFw-D03 of sea island cotton and its application. Background Art

[0002] Fusarium wilt (Fusarium wilt) is a soil-borne fungal disease of plants. Its pathogen is Fusarium oxysporum, which has hundreds of host species and severely harms crop production in my country. Cotton wilt is one of the most important diseases of cotton. The pathogen is the specialized fungus Fusarium oxysporum f.sp. vasinfectum, which belongs to the genus Fusarium in the subdivision Deuteromycetes. In 1891, Hamesen first discovered cotton wilt in Alabama, USA. Currently, cotton wilt is found in almost all cotton-growing countries around the world, with a very wide geographical distribution. In 1931, Mr. Feng Zhaochuan, a Chinese cotton expert, first discovered the disease in North China. Since then, with the continuous expansion of cotton-growing areas, the large-scale reproduction of cotton seeds and the transportation of them to multiple regions have accelerated the spread of cotton wilt, and the area affected by cotton wilt has expanded year by year. In the 1970s and early 1980s, major cotton-producing areas across China suffered annual losses of approximately 2 million quintals of lint due to this disease. With the widespread introduction of disease-resistant upland cotton varieties, the disease has been largely controlled in major upland cotton-producing areas. However, Zhang Guoli et al. sampled and isolated diseased plants at 47 cotton-growing sites in Xinjiang. Among 853 samples collected in northern Xinjiang, 11.1% contained the wilt pathogen, while among 391 samples collected in southern Xinjiang, 18.2% contained the wilt pathogen. In some areas, the incidence reached 30%. This study indicates that upland cotton wilt still occurs sporadically in parts of Xinjiang, with some plots experiencing particularly severe disease. With the expansion of mulching and direct-seeding cotton cultivation in my country, the incidence of wilt has been on the rise. In recent years, with the variation of wilt races, cotton wilt has become increasingly severe worldwide. For example, with the emergence and spread of Fusarium wilt race 4 in cotton-growing areas in the United States, cotton wilt has been steadily increasing in severity there. Currently, no single variety exhibits resistance to this race, and without effective countermeasures, it could pose a greater threat. Therefore, the problem of "new onset of old diseases" in our country should be given sufficient attention.

[0003] Fusarium wilt is the primary threat to Xinjiang's island cotton production. With the gradual expansion of Xinjiang's island cotton planting area and the long-term continuous cropping in various cotton-producing areas, the incidence of island cotton wilt has become increasingly severe, becoming a major constraint to Xinjiang's island cotton development. It is estimated that over 80% of cotton fields in Xinjiang's island cotton-producing areas are experiencing yield reductions due to wilt, with 15% severely affected, and some plots even experiencing total crop failure. Currently, there are two main approaches to improving island cotton wilt resistance in my country. One is to transfer resistance loci from upland cotton to island cotton through interspecific hybridization. However, due to the degree of linkage drag associated with interspecific hybridization, the breeding of high-quality, high-yielding, and disease-resistant island cotton varieties is a long process and progress has been slow. The other approach is to cultivate disease-resistant varieties through intraspecific hybridization. Given the narrow genetic base of island cotton, using the limited existing resistance resources as sources of resistance would further narrow the genetic base. Therefore, with the continuous development of biotechnology, the use of molecular marker-assisted technology to cultivate wilt-resistant varieties will be one of the main directions of disease-resistant breeding in the future. The key to achieving this goal is to locate the main effect site of wilt resistance in sea island cotton and develop molecular markers closely linked to it.

[0004] Because different Fusarium wilt races have distinct pathogenicity and pathogenic mechanisms, and because different cotton varieties exhibit specialized resistance to different Fusarium wilt races, researchers using different Fusarium wilt pathogens and cotton materials have reached different conclusions about the genetic makeup of cotton resistance. Generally speaking, cotton Fusarium wilt is controlled by one or two complete or incomplete major loci (genes). To date, at least 27 QTLs associated with Fusarium wilt resistance have been identified on 16 of the 26 chromosomes or linkage groups in cotton, with 14 of these QTLs located on chromosomes 6 (A06), 17 (D03), and 19 (D05). Using resequencing data from 243 diploid cotton accessions, the China Cotton Research Institute conducted an association analysis with Fusarium wilt resistance and discovered that the GaGSTF9 gene, located on chromosome A11, plays a key role in Fusarium wilt resistance in Asian cotton. Huazhong Agricultural University conducted an association analysis of wilt resistance traits in upland cotton using resequencing data from 290 upland cotton accessions. The researchers found that a single-base mutation in the GhGLR4.8 gene on chromosome D03 significantly alters resistance to Fusarium wilt race 7. These two findings represent important advances in the identification of wilt resistance loci in cotton. The wilt resistance target gene studied in this project is also located on chromosome D03, but its location differs significantly from that of the GhGLR4.8 gene. Furthermore, analysis of parental resequencing results showed that the GhGLR4.8 gene exhibited no sequence variation between the parental materials used in this project. In summary, the mechanism of wilt resistance in island cotton differs from that in upland and Asian cotton. Research on the mechanism of wilt resistance in island cotton must be grounded in the cotton itself, leveraging both resistant and susceptible resources within the plant to specifically identify the primary loci responsible for wilt resistance. This will be a key research direction for marker-assisted selection of wilt resistance in island cotton. Summary of the Invention

[0005] One of the purposes of the present invention is to provide a main effect locus qrFw-D03 for resistance to Fusarium wilt in sea island cotton.

[0006] Another object of the present invention is to provide a molecular marker tightly linked to the main effect locus qrFw-D03 of sea island cotton resistance to wilt disease.

[0007] Another object of the present invention is to provide a molecular marker closely linked to the main effect locus qrFw-D03 of sea island cotton resistance to fusarium wilt and its application in the identification of sea island cotton resistance to fusarium wilt and molecular marker-assisted breeding.

[0008] In order to solve the above technical problems, the present invention adopts the following technical solutions:

[0009] The molecular markers linked to the main effect locus qrFw-D03 of sea island cotton wilt resistance, the main effect locus qrFw-D03 of sea island cotton wilt resistance is located on the cotton chromosome D03, and the molecular markers linked to the sea island cotton wilt resistance locus qrFw-D03 are SNP-1861791, SNP-2288438 and SNP-2367176.

[0010] The nucleotide sequence of 50 bp upstream and downstream of the molecular marker SNP-1861791 detection site is shown in SEQ ID NO.1 or SEQ ID NO.2, wherein the sequences of SEQ ID NO.1 and SEQ ID NO.2 differ in base C and T at position 51.

[0011] The nucleotide sequence of 50 bp upstream and downstream of the molecular marker SNP-2288438 detection site is shown in SEQ ID NO.3 or SEQ ID NO.4. There is a difference in base C and T at position 51 between SEQ ID NO.3 and SEQ ID NO.4.

[0012] The nucleotide sequence of 50 bp upstream and downstream of the molecular marker SNP-2367176 detection site is shown in SEQ ID NO.5 or SEQ ID NO.6. There is a difference between the bases G and A at position 51 between SEQ ID NO.5 and SEQ ID NO.6.

[0013] The primer pairs for amplifying the molecular markers are as follows:

[0014] The primer pairs corresponding to the molecular marker SNP-1861791 are:

[0015] SNP-1861791-F1: GAAGGTGACCAAGTTCATGCTccatccggtcagcttctgC;

[0016] SNP-1861791-F2:GAAGGTCGGAGTCAACGGATTtccatccggtcagcttctgT;

[0017] SNP-1861791-R:GCTGACTACTAAGAATGAAAGGTGTGA;

[0018] The primer pairs corresponding to the molecular marker SNP-2288438 are:

[0019] SNP-2288438-F1: GAAGGTGACCAAGTTCATGCTgtgcaacttgaacctagactacacC;

[0020] SNP-2288438-F2:GAAGGTCGGAGTCAACGGATTgtgcaacttgaacctagactacacT;

[0021] SNP-2288438-R: AAGAGAACCTTATGTGTTGTACCGA;

[0022] The primer pairs corresponding to the molecular marker SNP-2367176 are:

[0023] SNP-2367176-F1: GAAGGTGACCAAGTTCATGCTattagtcaagccatcaggatcG;

[0024] SNP-2367176-F2:GAAGGTCGGAGTCAACGGATTaattagtcaagccatcaggatcA;

[0025] SNP-2367176-R:AAATAGCAATCTAGAGAAAACTGTTAGAA.

[0026] In addition, in addition to the above-mentioned molecular markers, reagents, kits or gene chips containing the molecular marker primer pairs also fall within the scope of protection of the present invention.

[0027] The main purpose of the present invention is to provide the use of the above-mentioned molecular marker or a reagent, kit or gene chip containing the molecular marker primer pair, wherein the use includes at least one of the following:

[0028] (1) Application of molecular marker-assisted breeding for resistance to Fusarium wilt in sea island cotton;

[0029] (2) Application in improving sea island cotton germplasm resources resistant to wilt disease;

[0030] (3) Application in the identification or screening of wilt resistance traits in sea island cotton.

[0031] Based on the above application, the present invention provides a method for identifying the resistance of sea island cotton to wilt disease using the molecular marker, comprising: extracting the genomic DNA of the sea island cotton material to be tested, detecting the genotype of the SNP site, and the wilt resistance of the cotton material with the genotype of CC / CC / GG is significantly higher than that of the individual with the genotype of TT / TT / AA.

[0032] More specifically, the SNP-1861791 site is located at the 51st position of the nucleotide sequence shown in SEQ ID NO.1 or SEQ ID NO.2, and there is a base polymorphism C / T at this site. The genotype in the wilt disease-resistant material is CC, and the genotype in the wilt disease-susceptible material is TT; the SNP-2288438 site is located at the 51st position of the nucleotide sequence shown in SEQ ID NO.3 or SEQ ID NO.4, and there is a base polymorphism C / T at this site. The genotype in the wilt disease-resistant material is CC, and the genotype in the wilt disease-susceptible material is TT; the SNP-2367176 site is located at the 51st position of the nucleotide sequence shown in SEQ ID NO.5 or SEQ ID NO.6, and there is a base polymorphism G / A at this site. The genotype in the wilt disease-resistant material is GG, and the genotype in the wilt disease-susceptible material is AA.

[0033] Advantages of the present invention:

[0034] 1. The present invention provides a major wilt resistance locus, qrFw-D03, in sea island cotton, which significantly enhances its resistance to wilt. Therefore, the qrFw-D03 locus can be applied to cotton molecular breeding, significantly improving its resistance to wilt.

[0035] 2. The present invention provides a SNP molecular marker linked to the main effect site qrFw-D03 of island cotton wilt resistance and its primer sequence, which can be used for early prediction and screening of island cotton wilt resistance, as well as molecular marker-assisted selection breeding of island cotton wilt resistance. It has the characteristics of rapidity, accuracy and high stability, and its use can significantly improve the breeding selection efficiency and breeding speed of island cotton wilt resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 This is the KASP genotyping diagram for SNP markers SNP-1861791, SNP-2288438, and SNP-2367176. The horizontal axis shows a higher proportion of FAM fluorescence, indicating homozygous type 1 (circles); the vertical axis shows a higher proportion of HEX fluorescence, indicating homozygous type 2 (squares); the middle region shows an equal proportion of both fluorescence types, indicating heterozygous type (triangles).

[0037] Figure 2 The qrFw-D03 locus is located in the segregating population. R1, R2, and R3 represent the results of three independent replicates, respectively. DI represents the disease index, and DR represents the mortality rate.

[0038] Figure 3 The figure shows the difference in disease index of Fusarium wilt in natural populations of cotton with different genotypes. The vertical axis represents the disease index of different genotypes, and the horizontal axis represents different genotypes. DETAILED DESCRIPTION

[0039] The present invention will be further described below with reference to specific examples, and the advantages and features of the present invention will become more apparent as the description proceeds. However, the specific experimental methods involved in the following examples, unless otherwise specified, are all conventional methods or are performed under the conditions recommended by the manufacturer's instructions.

[0040] Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art. The experimental methods in the following examples are all conventional methods unless otherwise specified. Unless otherwise specified, the reagents and materials used can be purchased from the market.

[0041] Unless otherwise defined, all technical and scientific terms used herein have the same meanings as those familiar to those skilled in the art. Furthermore, any methods and materials similar or equivalent to those described herein can be applied to the present invention. The preferred embodiments and materials described herein are for illustrative purposes only.

[0042] 1. Segregating populations were constructed using Changcaikang 1 and Changcaigan 1, two near-isogenic lines of sea island cotton that show significantly different resistance to wilt disease, as parents. The average wilt index of Changcaikang 1 was 6.90, with an average mortality rate of 0.06%; the average wilt index of Changcaigan 1 reached 91.14, with an average mortality rate of 82.14%.

[0043] 2. Plant the F2 population to produce 636 individual plants. Take the young leaves of the F2 individual plants and extract DNA using the CTAB method for later use. 2:3 strains.

[0044] 3. For 636 F 2:3 The strains were tested for resistance to indoor wilt disease. The specific identification method was as follows: 636 F 2:3 The strains were planted in a substrate mixed with wilt pathogens, 30 plants were planted per strain, and the number of plants was increased every 30 days. 2:3 Plant one copy of Changcaikang No. 1 and one copy of Changcaigan No. 1 respectively, and investigate F 2:3 The disease level of each strain, and the disease index and mortality rate of each strain were calculated. 2:3 The identification of resistance to Fusarium wilt was repeated three times.

[0045] (1) Pathogen culture

[0046] The wilt pathogen used in this study was strain KEL-1 isolated from the diseased strain of Changcaigan No. 1. The wilt pathogen was spread on the surface of a solid potato culture medium (200 g of potato, 17 g of agar, 20 g of sucrose, and 1000 ml of distilled water) at 25°C. One week later, it was transferred to a liquid potato culture medium (200 g of potato, 20 g of sucrose, and 1000 ml of distilled water) and cultured with shaking at room temperature for 5 days. The bacterial solution was filtered through gauze, the spore concentration was measured, and the concentration was diluted to 5 × 10 7 spores / ml.

[0047] (2) Inoculation method

[0048] The Pintop culture medium was broken up and crushed until the medium was not clumped and the particles were uniform in size. 7 Pour spores / ml of Fusarium wilt fungus solution into the crushed substrate and rub several times to thoroughly mix the pathogen and substrate. Place the inoculated substrate into a 72-well tray and sow the seeds. Place the tray in a temperature-controlled, moisturizing environment. After four weeks, assess the disease severity of each F2:3 strain and calculate the disease index and mortality rate for each strain.

[0049] (3) Resistance identification method

[0050] The 5-grade classification system is used to identify resistance to Fusarium wilt. The main symptoms of cotton Fusarium wilt in the seedling stage are bacterial wilt and yellow reticulated pattern. The true leaves and cotyledons wilt, become soft and droop, the leaf margins begin to wither, the veins turn yellow, and eventually the leaves wilt and the cotton plant dies. The classification standards for each disease grade are as follows:

[0051] Level 0: The cotton plants are healthy, without diseased leaves, and growing normally.

[0052] Level 1: One to two cotyledons of the cotton plant turn yellow and wilt.

[0053] Level 2: Two cotyledons and one true leaf of the cotton plant turn yellow and wilt, and the leaf veins become yellow reticular.

[0054] Level 3: Two cotyledons and two or more true leaves of the cotton plant turn yellow and wilt, and the leaf veins appear yellow and reticular or withered; the cotton plant is stunted or wilted.

[0055] Level 4: All leaves of the cotton plant are infected and the cotton plant dies.

[0056] The disease index is represented by "DI", and the disease index (DI) = [∑(N i ×i) / (N×4)]×100; i=0~4, N i =Number of plants per level, N is the total number of plants surveyed. DR is expressed as "DR", mortality rate (DR) = N4 / N × 100%, N4 is the number of plants in level 4, N is the total number of plants surveyed.

[0057] 4. According to F2:3 To evaluate the disease index and mortality of the cotton lines, 30 lines exhibiting extreme resistance and susceptibility to Fusarium wilt were selected, and the corresponding F2 individual DNA was mixed to form a pool of extremely resistant and extremely susceptible DNA. This DNA, along with the DNA from the parental lines Changcaikang 1 and Changcaigan 1, was sequenced using second-generation molecular sequencing technology. Using BSA-seq, a major locus for Fusarium wilt resistance, qrFw-D03, was detected within the 3.1Mb region of Chr. 17 (D03). Within this candidate locus, 12 pairs of single-nucleotide polymorphism (SNP) molecular markers were developed using the genomic sequencing data from Changcaikang 1 and Changcaigan 1.

[0058] 6. Using the DNA of F2 individual plants as templates, PCR amplification was performed using 12 pairs of SNP molecular markers, and the genotypes of 636 F2 individual plants were subjected to KASP typing ( Figure 1 ) Phenotypic data from F2 plants and F2:3 lines were combined to map QTLs associated with Fusarium wilt resistance using QTLI CiMapping 4.2 software, the ICIM-ADD method, and a LOD value of ≥3.0. The linkage group contained 12 single-nucleotide polymorphisms (SNPs), with disease index as the phenotypic data. The first replicate detected a QTL between markers SNP-2056971 and SNP-2288438, while the second and third replicates both located between markers SNP-1861791 and SNP-2056971. The LOD values ​​for the three replicates were 52.0, 48.5, and 44.3, respectively, explaining 60.8%, 57.3%, and 54.2% of the phenotypic variation, respectively. Using mortality as the phenotypic data, the QTL detected in the first replicate was located between markers SNP-2288438 and SNP-2367176, the QTL detected in the second replicate was located between markers SNP-1861791 and SNP-2056971, and the QTL detected in the third replicate was located between markers SNP-2056971 and SNP-2288438. The LOD values ​​of the three replicates were 20.0, 37.3, and 41.0, respectively, explaining 30.3%, 48.8%, and 52.6% of the phenotypic variation, respectively (Table 1, Figure 2 ).

[0059] Table 1 QTL information for resistance to Fusarium wilt on chromosome D03 of Gossypium barbadense

[0060]

[0061] In the present invention, qrFw-D03 was detected in three independent repeated experiments and could be calibrated by three SNP markers SNP-1861791, SNP-2288438 and SNP-2367176. The primer sequences for detecting the three sites are shown in Table 2. The SNP-1861791 site is located at the 51st position of the nucleotide sequence shown in SEQ ID NO.1 or SEQ ID NO.2, and there is a base polymorphism C / T at this site. The genotype of the resistant parent Changcaikang No. 1 is CC, and the genotype of the susceptible parent Changcaigan No. 1 is TT; the SNP-2288438 site is located at the 51st position of the nucleotide sequence shown in SEQ ID NO.3 or SEQ ID NO.4, and there is a base polymorphism C / T at this site. The genotype of the resistant parent Changcaikang No. 1 is CC, and the genotype of the susceptible parent Changcaigan No. 1 is TT; the SNP-2367176 site is located at the 51st position of the nucleotide sequence shown in SEQ ID NO.5 or SEQ ID NO.6, and there is a base polymorphism G / A at this site. The genotype of the resistant parent Changcaikang No. 1 is GG, and the genotype of the susceptible parent Changcaigan No. 1 is AA.

[0062] Table 2 SNP site primer sequence information

[0063]

[0064]

[0065] The three SNP markers were used to identify the genotypes of 63 approved sea island cotton varieties or preserved sea island cotton resources. When the three SNP sites were the same as the genotype of Changcaikang No. 1, that is, CC / CC / GG, the material had good resistance to wilt disease; when the three SNP sites were the same as the genotype of Changcaigan No. 1, that is, TT / TT / AA, the material had poor resistance to wilt disease ( Figure 3 ). This indicates that SNP markers (SNP-1861791, SNP-2288438, and SNP-2367176) within the qrFw-D03 interval are significantly effective in identifying resistance to Fusarium wilt in G. barbadense.

[0066] Among them, the sequences of SEQ ID NO. 1 to 6 are as follows:

[0067] SEQ ID NO.1:

[0068] TTCAAGGCAGCCATAGGAAACACGCTGAATGTCCATCCGGTCAGCTTCTG C TAGAAAAATTAGCTGAAGACAACATTCACACCTTTCATTCTTAGTAGTCA;

[0069] SEQ ID NO.2:

[0070] TTCAAGGCAGCCATAGGAAACACGCTGAATGTCCATCCGGTCAGCTTCTG T TAGAAAAATTAGCTGAAGACAACATTCACACCTTTCATTCTTAGTAGTCA;

[0071] SEQ ID NO.3:

[0072] TTTGGTTGAATTACAACAACGTCACTAGTGCAACTTGAACCTAGACTACA C CTGAACTATAAAAACTATATCGGTACAACACATAAGGTTCTCTTATTATT;

[0073] SEQ ID NO.4:

[0074] TTTGGTTGAATTACAACAACGTCACTAGTGCAACTTGAACCTAGACTACA T CTGAACTATAAAAACTATATCGGTACAACACATAAGGTTCTCTTATTATT;

[0075] SEQ ID NO.5:

[0076] AAGTTTTTCAAAATTGGATTAAGAATTGAATTAGTCAAGCCATCAGGATC G ATTCTCAATTCAATCGTTCTAACAGTTTCTCTAGATTGCTATTTTGATG;

[0077] SEQ ID NO.6:

[0078] AAGTTTTTCAAAATTGGATTAAGAATTGAATTAGTCAAGCCATCAGGATC A ATTCTCAATTCAATCGTTCTAACAGTTTCTCTAGATTGCTATTTTGATG。

[0079] The embodiments described above are only preferred embodiments of the present invention and are only used to explain the present invention, not to limit the scope of implementation of the present invention. For those skilled in the art, it is of course possible to easily make other implementation methods by replacing or changing the technical content disclosed in this specification. Therefore, all changes and improvements made on the principles of the present invention should be included in the scope of the patent application of the present invention.

Claims

1. A molecular marker linked to the main effect locus qrFw-D03 of sea island cotton resistance to fusarium wilt, characterized in that: The main effect locus qrFw-D03 of sea island cotton resistance to fusarium wilt is located on the cotton chromosome D03, and the molecular markers linked to the sea island cotton resistance locus qrFw-D03 are SNP-1861791, SNP-2288438 and SNP-2367176. The nucleotide sequence of the molecular marker SNP-1861791 detection site 50 bp upstream and downstream is shown in SEQ ID NO.1 or SEQ ID NO.2, the nucleotide sequence of the molecular marker SNP-2288438 detection site 50 bp upstream and downstream is shown in SEQ ID NO.3 or SEQ ID NO.4, and the nucleotide sequence of the molecular marker SNP-2367176 detection site 50 bp upstream and downstream is shown in SEQ ID NO.5 or SEQ ID NO.

6.

2. The molecular marker according to claim 1, characterized in that The SNP-1861791 site is located at the 51st position of the nucleotide sequence shown in SEQ ID NO.1 or SEQ ID NO.2, and there is a base polymorphism C / T at this site. The genotype in the wilt disease-resistant material is CC, and the genotype in the wilt disease-susceptible material is TT; the SNP-2288438 site is located at the 51st position of the nucleotide sequence shown in SEQ ID NO.3 or SEQ ID NO.4, and there is a base polymorphism C / T at this site. The genotype in the wilt disease-resistant material is CC, and the genotype in the wilt disease-susceptible material is TT; the SNP-2367176 site is located at the 51st position of the nucleotide sequence shown in SEQ ID NO.5 or SEQ ID NO.6, and there is a base polymorphism G / A at this site. The genotype in the wilt disease-resistant material is GG, and the genotype in the wilt disease-susceptible material is AA.

3. A primer pair for amplifying the molecular marker according to claim 1, characterized in that: The primer pairs corresponding to the molecular marker SNP-1861791 are: SNP-1861791-F1: GAAGGTGACCAAGTTCATGCTccatccggtcagcttctgC; SNP-1861791-F2:GAAGGTCGGAGTCAACGGATTtccatccggtcagcttctgT; SNP-1861791-R:GCTGACTACTAAGAATGAAAGGTGTGA; The primer pairs corresponding to the molecular marker SNP-2288438 are: SNP-2288438-F1: GAAGGTGACCAAGTTCATGCTgtgcaacttgaacctagactacacC; SNP-2288438-F2:GAAGGTCGGAGTCAACGGATTgtgcaacttgaacctagactacacT SNP-2288438-R: AAGAGAACCTTATGTGTTGTACCGA; The primer pairs corresponding to the molecular marker SNP-2367176 are: SNP-2367176-F1: GAAGGTGACCAAGTTCATGCTattagtcaagccatcaggatcG; SNP-2367176-F2:GAAGGTCGGAGTCAACGGATTaattagtcaagccatcaggatcA; SNP-2367176-R:AAATAGCAATCTAGAGAAAACTGTTAGAA.

4. A reagent, kit or gene chip containing the molecular marker primer pair according to claim 3.

5. Use of the molecular marker according to claim 1 or the reagent, kit or gene chip according to claim 4, characterized in that: The application includes at least one of the following: (1) Application of molecular marker-assisted breeding for resistance to Fusarium wilt in sea island cotton; (2) Application in improving sea island cotton germplasm resources resistant to wilt disease; (3) Application in the identification or screening of wilt resistance traits in sea island cotton.

6. A method for identifying resistance to Fusarium wilt in Sea Island cotton using the molecular marker according to claim 1, characterized in that: The genomic DNA of the tested sea island cotton materials was extracted, and the genotypes of the three SNP sites were detected. The cotton materials with the genotype CC / CC / GG had significantly higher resistance to wilt than those with the genotype TT / TT / AA.