GhKCS29 gene-based cotton fiber length-related SNP molecular marker and application thereof

Abstract

The invention belongs to the technical field of molecular markers and molecular marker assisted breeding, and particularly relates to a cotton fiber length related SNP molecular marker based on a GhKC29 gene and application of the cotton fiber length related SNP molecular marker. The SNP molecular marker is located at the 103827312bp site on the A13 chromosome in a cotton genome, and the SNP molecular marker has G / C base mutation; the cotton genome is a TM-1 genome. The SNP molecular marker has significant correlation with the cotton fiber length, a cotton fiber length molecular marker database is enriched, and research finds that the average fiber length of a cotton sample with a GG genotype is significantly greater than that of a cotton sample with a CC genotype, so that in the cotton breeding process, the average fiber length of the cotton sample with the GG genotype is significantly greater than that of the cotton sample with the CC genotype. Cotton samples with the GG genotype can be screened out. The SNP molecular marker is not only suitable for identification of fiber length, but also can be used for assisted breeding, variety improvement and early screening.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular markers and molecular marker-assisted breeding, and particularly relates to a cotton fiber length-related SNP molecular marker based on the GhKCS29 gene and an application thereof. Background Art

[0002] Cotton, a plant of the Malvaceae family, originates in subtropical regions and is now widely cultivated in many countries. Known as the "King of Fiber," cotton is a member of the genus Gossypium. With rising living standards, people have increasingly demanding cotton fiber products. High-quality cotton fiber products require high-quality cotton fibers. To meet this demand, cultivating high-quality cotton varieties has become a primary goal of cotton breeding.

[0003] Cotton fiber quality mainly includes five traits: fiber length, specific strength, micronaire value, uniformity and elongation. Among them, fiber length is one of the important indicators for evaluating cotton quality. Therefore, increasing the fiber length of cotton varieties is an important task to improve cotton fiber quality.

[0004] In the process of cotton fiber improvement and breeding, the identification of cotton fiber length has become a key phenotypic identification process. Traditional cotton fiber length identification methods rely primarily on phenotypic observation and physical measurement, such as manual measurement using a fiber length detector. These methods are time-consuming and labor-intensive, and are significantly affected by environmental factors and human error, making them difficult to achieve early, rapid, and large-scale screening. Furthermore, traditional methods have limited ability to distinguish varieties with similar fiber lengths, making it difficult to accurately select high-quality varieties.

[0005] With the development of high-throughput sequencing, the development and detection cost, reliability and timeliness of molecular markers are constantly moving towards research-favorable aspects. However, there are still few molecular markers related to cotton fiber length. Developing new cotton fiber length molecular markers and applying them is more urgent for the breeding of high-quality cotton fiber varieties. Summary of the Invention

[0006] The purpose of the present invention is to provide a cotton fiber length-related SNP molecular marker based on the GhKCS29 gene and its application. The SNP molecular marker has a significant correlation with cotton fiber length, which not only enriches the cotton fiber length molecular marker database, but also can be used to assist cotton breeding.

[0007] The present invention provides a SNP molecular marker related to cotton fiber length. The SNP molecular marker is located at the 103827312bp position on chromosome A13 in the cotton genome, and the SNP molecular marker has a G / C base mutation; the cotton genome is the TM-1 genome.

[0008] Preferably, the nucleotide sequence containing the SNP molecular marker is shown as SEQ ID NO: 1 or SEQ ID NO: 2.

[0009] The present invention also provides a primer pair for detecting the SNP molecular marker described in the above technical solution, wherein the nucleotide sequences of the upstream primer and the downstream primer of the primer pair are shown in SEQ ID NO: 3 and SEQ ID NO: 4, respectively.

[0010] The present invention also provides a kit, which includes the primer pair and PCR amplification reagent described in the above technical solution.

[0011] Preferably, the PCR amplification reagents include dNTPs, TaqDNA polymerase, MgCl2 and PCR reaction buffer.

[0012] The present invention also provides the use of the SNP molecular marker described in the above technical solution, or the primer pair described in the above technical solution, or the kit described in the above technical solution in cotton breeding and / or cotton variety improvement.

[0013] Preferably, the cotton breeding includes cotton fiber length assisted breeding.

[0014] Preferably, the cotton fiber length assisted breeding includes any one of the following three items:

[0015] 1) Identify or assist in identifying cotton fiber length;

[0016] 2) Screening or assisting in the screening of long-fiber cotton varieties;

[0017] 3) Predict or assist in predicting cotton fiber length.

[0018] The present invention also provides a method for identifying or predicting cotton fiber length, comprising: detecting the genotype of the SNP molecular marker described in the above technical solution in a cotton sample to be tested;

[0019] The cotton fiber length of the cotton sample to be tested whose genotype at the 103827312bp site on chromosome A13 of the cotton genome is GG genotype is greater than the cotton fiber length of the cotton sample to be tested whose genotype at the 103827312bp site on chromosome A13 of the cotton genome is CC genotype.

[0020] The present invention also provides a method for screening long-fiber cotton varieties, comprising: detecting the genotype of the SNP molecular marker described in the above technical solution in a cotton sample to be tested;

[0021] A cotton sample to be tested having a genotype of GG at the 103827312 bp site on chromosome A13 of the cotton genome is selected to obtain the long-fiber cotton variety.

[0022] Beneficial effects:

[0023] The present invention provides a single-nucleotide polymorphism (SNP) molecular marker associated with cotton fiber length. The SNP molecular marker is located at the 103,827,312 bp position on chromosome A13 in the cotton genome, and exhibits a G / C base mutation. The cotton genome is the TM-1 genome. The SNP molecular marker described in the present invention has a significant correlation with cotton fiber length, enriching the cotton fiber length molecular marker database. Research has found that the average fiber length of cotton samples with the GG genotype is significantly greater than that of cotton samples with the CC genotype. During cotton breeding, cotton samples with the GG genotype can be screened out. This SNP molecular marker is not only suitable for fiber length identification, but can also be used to assist in breeding, variety improvement, and early screening.

[0024] On this basis, the present invention also provides a primer pair, a kit and a method for identifying or predicting cotton fiber length for detecting the SNP molecular marker. Based on the primer pair or the kit, cotton fiber length can be identified at any stage of cotton, especially in the early growth stage of cotton, without waiting for the fiber to mature, significantly shortening the identification cycle and being more efficient; at the same time, compared with the traditional cotton fiber length identification method, the present application directly predicts the fiber length through the genotype detection method, avoiding the subjective errors of traditional phenotypic observation and physical measurement, and is more accurate; furthermore, the molecular markers described in the present invention can also be combined with other molecular marker technologies for multi-trait collaborative screening, accelerating the cultivation of high-quality cotton varieties, and having better scalability. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments are briefly introduced below.

[0026] Figure 1 This is the result of the significance analysis of the difference in fiber length between the cotton sample with the GG genotype and the cotton sample with the CC genotype at the 103827312 bp site on chromosome A13 in the cotton genome in Example 1. DETAILED DESCRIPTION

[0027] The present invention provides a SNP molecular marker related to cotton fiber length. The SNP molecular marker is located at the 103827312bp position on chromosome A13 in the cotton genome, and the SNP molecular marker has a G / C base mutation; the cotton genome is the TM-1 genome.

[0028] As an embodiment, the nucleotide sequence containing the SNP molecular marker is as shown in SEQ ID NO: 1 or SEQ ID NO: 2; that is, the base at the 201bp position of the nucleotide shown in SEQ ID NO: 1 or SEQ ID NO: 2 is G or C, as follows, wherein the base position in bold italics and underline is the position of the SNP molecular marker.

[0029] 5'-GAAGACGACTACCTGATTTTCTTCAGTCAGTTAACTTGAAGTATGTGAAG TTAGGGTACCATTATTTGATCAACCATGGTATATATTTGGCTACCATACCTGTTTTGGTACTCGTTTTTAGTGCCGAAGTGGGTAGTCTTAGTAGGGAAGAGCTTTGGAAAAAGCTTTGGGAAGATGCTCGTTATGATCTCGCCACCGTG G TGTCTTTTTTCGCTGTTTTTGTGTTCACCGTTTCCGTTTACTTCATGTCACGCCCTCGTTCCATTTATCTAATTGATTTCGCTTGTTATCGTCCTCACGATGACTTAAAGGTGAAAAATAATGAACAATAATGAACATATGTTCATGCATGCATCTCGTCAACTATATTTCTCTATTTGGCCTTAAATTTTTTTTTCCAT-3' (SEQ ID NO: 1);

[0030] 5'-GAAGACGACTACCTGATTTTCTTCAGTCAGTTAACTTGAAGTATGTGAAG TTAGGGTACCATTATTTGATCAACCATGGTATATATTTGGCTACCATACCTGTTTTGGTACTCGTTTTTAGTGCCGAAGTGGGTAGTCTTAGTAGGGAAGAGCTTTGGAAAAAGCTTTGGGAAGATGCTCGTTATGATCTCGCCACCGTG CTGTCTTTTTTCGCTGTTTTTGTGTTCACCGTTTCCGTTTACTTCATGTCACGCCCTCGTTCCATTTATCTAATTGATTTCGCTTGTTATCGTCCTCACGATGACTTAAAGGTGAAAAATAATGAACAATAATGAACATATGTTCATGCATGCATCTCGTCAACTATATTTCTCTATTTGGCCTTAAATTTTTTTTTCCAT-3' (SEQ ID NO: 2).

[0031] The SNP molecular marker of the present invention has a significant correlation with cotton fiber length, and the average fiber length of cotton samples with the GG genotype is significantly greater than that of cotton samples with the CC genotype.

[0032] The present invention also provides a primer pair for detecting the SNP molecular marker described in the above technical solution, wherein the nucleotide sequences of the upstream primer and the downstream primer of the primer pair are shown in SEQ ID NO: 3 and SEQ ID NO: 4, respectively.

[0033] The present invention also provides a kit comprising the primer pairs described in the above technical solution and a PCR amplification reagent. In one embodiment, the PCR amplification reagent comprises dNTPs, Taq DNA polymerase, MgCl2, and a PCR reaction buffer. In another embodiment, the PCR amplification reagent can be prepared in-house or purchased as a pre-mixed PCR amplification reagent from conventional commercial channels. The present invention does not specifically limit the dosage of the components of the PCR amplification reagent; the components can be combined as needed.

[0034] The present invention also provides the use of the SNP molecular markers described in the above technical solution, or the primer pairs described in the above technical solution, or the kit described in the above technical solution in cotton breeding and / or cotton variety improvement. In one embodiment, the cotton breeding can be assisted cotton fiber breeding; in another embodiment, the assisted cotton fiber breeding can be assisted cotton fiber length breeding; in another embodiment, the assisted cotton fiber length breeding includes any of the following three items: 1) identifying or assisting in the identification of cotton fiber length; 2) screening or assisting in the screening of long-fiber cotton varieties; 3) predicting or assisting in the prediction of cotton fiber length.

[0035] The present invention also provides a method for identifying or predicting cotton fiber length, comprising: detecting the genotype of the SNP molecular marker described in the above technical solution in the cotton sample to be tested; the cotton fiber length of the cotton sample to be tested whose genotype at the 103827312bp site on chromosome A13 of the cotton genome is GG genotype is greater than the cotton fiber length of the cotton sample to be tested whose genotype at the 103827312bp site on chromosome A13 of the cotton genome is CC genotype.

[0036] As an embodiment, the step of detecting the genotype of the SNP molecular marker in the cotton sample to be tested includes: using the genomic DNA of the cotton sample to be tested as a template, and performing PCR amplification using the primer pair or kit described in the above technical solution to obtain a PCR amplification product; performing electrophoresis detection and sequencing on the PCR amplification product to obtain a genotyping result; identifying or predicting the fiber length of the cotton sample to be tested based on the genotype in the genotyping result; the cotton fiber length of the cotton sample to be tested whose genotype at the 103827312bp site on chromosome A13 of the cotton genome is the GG genotype is greater than the cotton fiber length of the cotton sample to be tested whose genotype at the 103827312bp site on chromosome A13 of the cotton genome is the CC genotype.

[0037] The present invention does not specifically limit the method for extracting genomic DNA; any conventional genomic DNA method in the art, such as the CTAB method or kit extraction, may be used. As one embodiment, the reaction system for PCR amplification described in the present invention is: 1 μL each of upstream and downstream primers, 1 μL of DNA template, 10 μL of TaqMix, and 7 μL of water. As one embodiment, the PCR amplification procedure is: pre-denaturation at 95°C for 3 minutes; denaturation at 95°C for 10 seconds, annealing at 55°C for 30 seconds, and extension at 72°C for 50 seconds, for 35 cycles; and extension at 72°C for 10 minutes. As one embodiment, the electrophoresis detection is performed by electrophoresis of the PCR amplification products using 1% agarose gel electrophoresis.

[0038] The present invention also provides a method for screening long-fiber cotton varieties, comprising: detecting the genotype of the SNP molecular marker described in the above technical solution in a cotton sample to be tested; and selecting a cotton sample to be tested having a GG genotype at the 103827312 bp site on chromosome A13 of the cotton genome, thereby obtaining the long-fiber cotton variety. The specific steps for detecting the genotype of the SNP molecular marker in the cotton sample to be tested are the same as those described in the above technical solution and are not further described.

[0039] By detecting the genotype at the 103827312bp site on chromosome A13 of the cotton genome, the present invention can quickly predict fiber length in the early stages of cotton growth (such as the seedling stage), screen target plants, significantly shorten the screening and breeding cycle, and save land and manpower and material costs; secondly, the present invention found that the average fiber length of cotton samples with the GG genotype was significantly higher than that of the CC genotype, providing a clear molecular marker standard, which can more accurately screen high-quality cotton germplasm; furthermore, by selecting cotton samples with the GG genotype as parents, the present invention can selectively cultivate long-fiber varieties and improve breeding efficiency.

[0040] In order to further illustrate the present invention, the technical solution provided by the present invention is described in detail below with reference to the accompanying drawings and embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0041] Example 1

[0042] The development of SNP molecular markers related to cotton fiber length is as follows:

[0043] In this example, whole-genome resequencing data from 409 cotton populations was combined with cotton fiber length (FL) phenotypic data for genome-wide association analysis to identify a gene associated with cotton fiber length, GhKCS29_At. A single polymorphism (SNP) locus was identified within this gene, located at position 103827312 on chromosome A13 of the reference genome of the upland cotton standard line TM-1. The polymorphism at this locus is G / C. The nucleotide sequence containing this SNP is shown in SEQ ID NO: 1 or SEQ ID NO: 2, respectively:

[0044] There are two corresponding genotypes: GG and CC. The GG genotype is a homozygous form of G at position 103,827,312 on chromosome A13 of the cotton genome, while the CC genotype is a homozygous form of C at position 103,827,312 on chromosome A13 of the cotton genome. It was found that cotton fibers with the GG genotype were significantly longer than those with the CC genotype.

[0045] Example 2

[0046] Amplification primers for cotton fiber length SNP molecular markers and their validation in cotton fiber length

[0047] 1. Cotton fiber length SNP molecular markers and their amplification primers

[0048] A specific primer pair was designed based on the SNP site and its upstream and downstream nucleotide sequences obtained in Example 1, wherein the nucleotide sequences of the upstream primer and the downstream primer are shown in SEQ ID NO: 3 and SEQ ID NO: 4, respectively, as follows:

[0049] Upstream primer: 5′-ATGGCTAGAAATGAGCAAGA-3′ (SEQ ID NO: 3);

[0050] Downstream primer: 5'-CTAAGCTCTCACAGGGTATC-3' (SEQ ID NO: 4).

[0051] 2. Identification of cotton fiber length:

[0052] 2.1 Sample collection and determination of cotton fiber length

[0053] Samples of 409 cotton germplasms were collected at maturity, and the cotton fiber length of the 409 cotton germplasms was counted by physical measurement. The variety and fiber length phenotypic information of the 409 cotton germplasms are shown in Table 1.

[0054] Table 1 Varieties and fiber length phenotypes of 409 cotton germplasms (mm)

[0055]

[0056]

[0057]

[0058]

[0059]

[0060]

[0061]

[0062]

[0063]

[0064]

[0065] Note: In the sixth column “Genotype” of Table 1, “G” indicates GG homozygous genotype, “C” indicates CC homozygous genotype, “W” indicates GC heterozygous genotype, and “-” indicates missing.

[0066] 2.2 Extraction of genomic DNA

[0067] The genomic DNA of the 409 cotton germplasm materials in step 2.1 was extracted using the rapid DNA extraction kit (model ND-26100rxn) from Beijing Nolay Enzyme Biotechnology Co., Ltd.

[0068] 2.3 PCR amplification

[0069] Using the genomic DNA extracted in step 2.2 as a template, amplify the SNP site using the PCR primers from step 1 to generate a PCR product. The amplification system is as follows: 1 μL each of the upstream and downstream primers, 1 μL of DNA template, 10 μL of Taq Mix, and 7 μL of water. The PCR amplification program is as follows: pre-denaturation at 95°C for 3 min; 35 cycles of denaturation at 95°C for 10 s, annealing at 55°C for 30 s, and extension at 72°C for 50 s; and extension at 72°C for 10 min.

[0070] 2.4 Electrophoresis detection

[0071] The products obtained by PCR amplification in step 2.3 were detected on 1% agarose gel electrophoresis and sequenced to obtain the genotypes of the test samples at the above SNP sites. The results are shown in Table 1.

[0072] Combining the phenotypic and genotypic data in Table 1, it can be concluded that among the 409 cotton germplasm resources, the average fiber length of the cotton germplasm with GG genotype is 29.22 mm, and the average fiber length of the cotton germplasm with CC genotype is 28.11 mm. The average fiber length of the cotton germplasm with GG genotype is significantly (P<0.01) higher than that of the cotton germplasm with CC genotype ( Figure 1 ). The reliability and practicability of the method were verified.

[0073] It can be concluded from the above examples that the SNP molecular markers in the present invention have a significant correlation with cotton fiber length, can be used for identification or prediction of cotton fiber length samples, and can be used for cotton fiber length assisted breeding.

[0074] Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.

Claims

1. A SNP molecular marker associated with cotton fiber length, characterized in that: The SNP molecular marker is located at the 103827312 bp position on chromosome A13 in the cotton genome, and the SNP molecular marker has a G / C base mutation; the cotton genome is the TM-1 genome.

2. The SNP molecular marker according to claim 1, characterized in that The nucleotide sequence containing the SNP molecular marker is shown in SEQ ID NO: 1 or SEQ ID NO:

2.

3. A primer pair for detecting the SNP molecular marker according to claim 1 or 2, characterized in that: The nucleotide sequences of the upstream primer and the downstream primer of the primer pair are shown in SEQ ID NO: 3 and SEQ ID NO: 4, respectively.

4. A kit, characterized in that The kit comprises the primer pair according to claim 3 and a PCR amplification reagent.

5. The kit according to claim 4, characterized in that The PCR amplification reagents include dNTPs, Taq DNA polymerase, MgCl2 and PCR reaction buffer.

6. Use of the SNP molecular marker according to claim 1 or 2, the primer pair according to claim 3, or the kit according to claim 4 or 5 in cotton breeding and / or cotton variety improvement.

7. The use according to claim 6, characterized in that The cotton breeding includes cotton fiber length assisted breeding.

8. The use according to claim 7, characterized in that The cotton fiber length assisted breeding includes any one of the following three items: 1) Identify or assist in identifying cotton fiber length; 2) Screening or assisting in the screening of long-fiber cotton varieties; 3) Predict or assist in predicting cotton fiber length.

9. A method for identifying or predicting cotton fiber length, characterized in that: include: Detecting the genotype of the SNP molecular marker according to claim 1 or 2 in a cotton sample to be tested; The cotton fiber length of the cotton sample to be tested whose genotype at the 103827312bp site on chromosome A13 of the cotton genome is GG genotype is greater than the cotton fiber length of the cotton sample to be tested whose genotype at the 103827312bp site on chromosome A13 of the cotton genome is CC genotype.

10. A method for screening long-fiber cotton varieties, characterized in that: include: Detecting the genotype of the SNP molecular marker according to claim 1 or 2 in a cotton sample to be tested; A cotton sample to be tested having a genotype of GG at the 103827312 bp site on chromosome A13 of the cotton genome is selected to obtain the long-fiber cotton variety.

Images