Application of a KASP molecular marker in identifying downy mildew resistance in melons
The KASP molecular marker CmPcu9.6, developed using the polymorphic SNP site at chr09:22824300, solved the problems of long cycle and low efficiency in the breeding of melon downy mildew resistance. It achieved efficient and accurate identification and early screening of melon downy mildew resistance, thus improving breeding efficiency.
Patent Information
- Application Number
- CN202511182252.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-22
- Publication Date
- 2025-10-28
- Estimated Expiration
- 2045-08-22
AI Technical Summary
In existing technologies, the breeding of melons resistant to downy mildew relies on traditional phenotypic observation, which has the problems of long cycle and low efficiency, making it difficult to efficiently screen and breed melon varieties resistant to downy mildew.
Using KASP molecular marker technology, a high-density genetic map was constructed to locate major QTLs associated with downy mildew resistance in melons. A KASP molecular marker CmPcu9.6 based on the polymorphic SNP site at chr09:22824300 was designed for the identification and screening of downy mildew resistance in melons.
It enables efficient and accurate identification and early screening of downy mildew resistance in melons, significantly shortening the breeding cycle, reducing manpower and material costs, and improving breeding efficiency.
Smart Images

Figure CN120666111B_ABST
Abstract
Description
Technical Field
[0001] This application belongs to the field of molecular marker technology, and relates to the fields of melon genetics, molecular marker technology and plant protection. Specifically, it relates to the application of a KASP molecular marker in the identification of downy mildew resistance in melons. Background Technology
[0002] melon( Cucumis melo L) belongs to the Cucurbitaceae family ( Cucurbitaceae ) Melon genus ( Cucumis Melons, an annual vine-like herbaceous plant, possess advantages such as a short cultivation cycle, high market demand, good economic benefits, and high land utilization and multiple cropping index, making them an important horticultural crop in my country. However, in cultivation, melons are highly susceptible to pathogens. For example, downy mildew is one of the major diseases affecting melon production, causing yellowing and drying of leaves and plant death. Downy mildew spreads rapidly and is difficult to control, severely impacting melon yield and quality, thus hindering the sustainable development of the melon industry.
[0003] Downy mildew resistance is an important commercial trait in melons, and understanding its regulatory mechanisms is crucial for variety improvement, market segmentation, and germplasm resource utilization. Currently, the breeding of downy mildew resistance in melons mainly relies on traditional phenotypic observation, which suffers from problems such as long cycles and low efficiency. Summary of the Invention
[0004] The purpose of this application is to provide an application of KASP molecular markers in identifying downy mildew resistance in melons. The aim is to utilize molecular marker-assisted selection breeding to accurately identify the genotypes of downy mildew-resistant materials in melons, thereby efficiently screening and breeding melon varieties with downy mildew resistance.
[0005] To achieve the above objectives, this application provides an application of the KASP molecular marker in identifying downy mildew resistance in melons. When applying the KASP molecular marker to identify downy mildew resistance in melons, the identification method includes the following steps: extracting genomic DNA from the target melon, performing PCR amplification using the genomic DNA as a template, and performing fluorescence detection based on primers for the KASP molecular marker CmPcu9.6 to obtain the gene type of the target melon; determining the trait of the target melon based on the detected gene type; the KASP molecular marker CmPcu9.6 is designed based on the polymorphic SNP site at chr09:22824300.
[0006] In the above scheme, the KASP molecular marker CmPcu9.6 was obtained by constructing a high-density genetic map, locating a major QTL related to downy mildew resistance in melon, and using Melon (DHL92) v4 Genome as a reference genome to search for polymorphic SNP sites between the parents.
[0007] As some optional embodiments of this application, the nucleotide sequence of the SNP site is as shown in SEQ ID NO.1, the SNP site is located at the 51st base of the nucleotide sequence shown in SEQ ID NO.1, and the base of the SNP site is mutated from T to A.
[0008] As some optional embodiments of this application, the polymorphism of the KASP molecular marker is A or T, the AA genotype is a homozygous resistant type, the TT genotype is a homozygous susceptible type, and the AT genotype is a heterozygous susceptible type.
[0009] As some optional embodiments of this application, the gene type is obtained based on the following reaction system: 10 μL of Kaspar 2×reactionmix, 0.02 μL each of primer F1 and primer F2 at a concentration of 100 μM, 0.06 μL of primer R, and 1 μL of DNA.
[0010] As some optional embodiments of this application, the PCR amplification includes the following steps:
[0011] Pre-denaturation at 94℃ for 15 min;
[0012] Denaturation at 94℃ for 20 seconds;
[0013] Annealing at 65℃-57℃ for 45 seconds;
[0014] 10 cycles, with the annealing extension temperature decreasing by 0.8℃ in each cycle;
[0015] Denaturation at 94℃ for 20 seconds;
[0016] Annealing at 57℃ for 60 seconds, 30 cycles.
[0017] As some optional embodiments of this application, the primer pairs for the KASP molecular marker CmPcu9.6 include allele primer CmPcu9.6-F1 as shown in SEQ ID NO.2, allele primer CmPcu9.6-F2 as shown in SEQ ID NO.3, and universal primer CmPcu9.6-R as shown in SEQ ID NO.4.
[0018] As some optional embodiments of this application, the primer pair of the KASP marker CmPcu9.6 can be used to prepare a kit for identifying KASP molecular markers for resistance to downy mildew in melons.
[0019] As some optional embodiments of this application, the primer pair of the KASP marker CmPcu9.6 can be used for breeding downy mildew resistant germplasm of melon.
[0020] In summary, this application has the following advantages:
[0021] 1. The molecular marker CmPcu9.6, which is closely linked to downy mildew resistance in melon, obtained in this application, is a KASP molecular marker developed by constructing a highly homozygous RIL population and combining it with whole-genome sequencing data. This marker is closely linked to downy mildew resistance in melon and can be stably inherited; moreover, compared with other molecular markers, it has the characteristics of batch processing, automation, and standardization, making it suitable for high-throughput detection of populations.
[0022] 2. The KASP marker developed in this application, which is closely linked to downy mildew resistance, provides an efficient technical means for genotyping of melon germplasm resources. This marker can be rapidly detected using a high-throughput genotyping system, significantly reducing the manpower and material costs of traditional identification methods. Secondly, the detection process is unaffected by environmental factors, ensuring the accuracy and reliability of the identification results. Finally, this technology enables early screening of downy mildew-resistant melon varieties, effectively shortening the breeding cycle, greatly improving breeding efficiency, and providing an important molecular marker-assisted selection tool for disease-resistant melon breeding. Attached Figure Description
[0023] Figure 1 The figures shown are phenotypic images of the disease-resistant melon material "PI390452", the susceptible melon material "HDZ", and F1 generation plants at different time points after downy mildew infection, according to embodiments of this application. Figure 1 (a) in the figure is the phenotype of "PI390452" at 0 dpi after downy mildew infection. Figure 1 (b) in the figure is the phenotype at 0 dpi after infection with "HDZ" downy mildew. Figure 1 (c) in the figure is the phenotypic diagram of F1 generation plants at 0 dpi after downy mildew infection. Figure 1 (d) in the figure is the phenotypic diagram of "PI390452" 7 dpi after downy mildew infection. Figure 1 (e) in the figure is the phenotypic diagram of "HDZ" 7 dpi after infection with downy mildew. Figure 1 (f) in the figure is the phenotypic diagram of F1 generation plants 7 dpi after downy mildew infection. Figure 1 (g) in the figure represents the phenotypic diagram of "PI390452" 15 dpi after downy mildew infection. Figure 1(h) in the figure represents the phenotypic graph of "HDZ" at 15 dpi after infection with downy mildew. Figure 1 (i) is the phenotypic diagram of F1 generation plants 15 dpi after infection with downy mildew.
[0024] Figure 2 The image shows the disease severity distribution of the BC and F2 populations of the disease-resistant melon material "PI390452" and the susceptible melon material "HDZ" involved in the embodiments of this application after infection with downy mildew.
[0025] Figure 3 The figure shows the initial QTL localization results for melon downy mildew resistance in the embodiments of this application.
[0026] Figure 4 The image shows the SNP site map of the melon KASP molecular marker CmPcu9.6 involved in the embodiments of this application, where PI390452.bam.Coverage and HDZ.bam.Coverage represent the resequencing data of PI390452 and HDZ, respectively.
[0027] Figure 5 The image shows the genotyping diagrams of the KASP marker CmPcu9.6 involved in this application's embodiments in the "PI390452", "HDZ", and RIL populations. Figure 5 (a) in the image shows the distribution plate of RIL population DNA samples. Figure 5 (b) shows the genotyping results of the RIL population under the KASP marker CmPcu9.6. Detailed Implementation
[0028] The principles and features of this application are described below with reference to embodiments. The examples are for illustrative purposes only and are not intended to limit the scope of this application. Unless otherwise specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products.
[0029] Compared to other prevention and control methods, the application and promotion of melon varieties containing downy mildew resistance genes is a relatively safe and effective measure to reduce downy mildew damage. In recent years, with the development of molecular biology and related molecular marker technologies, the use of molecular marker-assisted breeding has gradually become a new approach for disease-resistant melon breeding.
[0030] Early research on molecular markers primarily utilized random amplified polymorphic DNA markers (RAPD), restriction fragment length polymorphism (RFLP), and PCR-based dominant molecular marker systems (SRAP) to screen for multiple linkage markers, with genetic distances to resistance genes ranging from 7.85 cM to 9.9 cM. Later research shifted to simple repeat sequence (SSR) markers combined with block segregation analysis (BSA) and genetic linkage mapping, reducing the linkage distance to 3.6 cM. Although RFLP, RAPD, and SSR markers play important roles in genetic mapping, they typically still have a certain distance from the target gene, their universality needs verification, and their operation is relatively complex, limiting the direct application of molecular markers in breeding.
[0031] Therefore, developing novel molecular markers with higher specificity, accuracy, and faster and more convenient operation is crucial for accelerating the breeding of melons resistant to downy mildew.
[0032] Firstly, this application provides an application of the KASP molecular marker in identifying downy mildew resistance in melons. The KASP (competitive allele-specific PCR) technology, developed based on functional SNP sites, can rapidly, economically, and reliably determine SNP genotypes, playing a significant role in gene mapping, marker-assisted selection, and germplasm identification. Therefore, the KASP marker developed and applied in this application for identifying downy mildew resistance in melons is of great significance for the efficient screening and breeding of downy mildew-resistant melon varieties. Furthermore, this application also relates to primer pairs associated with the KASP molecular marker, and a kit containing these specific primer pairs, designed for the efficient identification of downy mildew resistance in melons under laboratory conditions. This application is not limited to providing these molecular markers and kits; it further elaborates on the specific application methods of these tools in the breeding process of downy mildew-resistant melon germplasm. Meanwhile, based on the KASP molecular markers, primer pairs, and kits provided above, this application also details a method for identifying downy mildew resistance in melons. This method includes steps such as extracting DNA from melon samples, performing PCR amplification, and using KASP technology for genotyping analysis, thereby achieving accurate identification of downy mildew resistance in melons.
[0033] Firstly, the KASP molecular marker used in this application to identify downy mildew resistance in melons was identified as KASP molecular marker CmPcu9.6. This marker was developed by constructing a high-density genetic map to locate a major-effect QTL associated with downy mildew resistance in melons. Using the Melon (DHL92) v4 Genome as a reference genome, polymorphic SNP sites between parents were searched, and the marker was designed based on the single nucleotide polymorphism at position 22824300 on chromosome chr09. Further analysis showed that the SNP site at chr09:22824300 within this QTL was mutated from thymine (T) to adenine (A), and a set of KASP molecular markers closely linked to downy mildew resistance in melons was developed based on this site.
[0034] In the specific implementation, the nucleotide sequence of the SNP site is shown in SEQ ID NO.1. The sequence identifier SEQ ID NO.1 and its corresponding mutation site (the 51st base is mutated from T to A) are detailed below:
[0035] >chr09:22824300=CCAGCTGCCAAAGACGTACTGTCTTATCAACAGAAGATGACAGCAGAAGC[T / A]GCATAGAACACAAAATAATAATAAAAAAATTAGTGGCAATTGCAAAAATC.
[0036] Secondly, a primer pair for identifying the KASP molecular marker CmPcu9.6 resistance to downy mildew in melons in this application includes allelic primer CmPcu9.6-F1 as shown in SEQ ID NO.2, allelic primer CmPcu9.6-F2 as shown in SEQ ID NO.3, and universal primer CmPcu9.6-R as shown in SEQ ID NO.4.
[0037] (1) The sequence identifier SEQ ID NO.2 is detailed below:
[0038] 5'-GAAGGTGACCAAGTTCATGCTCAACAGAAGATGACAGCAGAAGCA-3'.
[0039] (2) The sequence identifier SEQ ID NO.3 is detailed below:
[0040] 5'-GAAGGTCGGAGTCAACGGATTCAACAGAAGATGACAGCAGAAGCT-3'.
[0041] (3) The sequence identifier SEQ ID NO.4 is detailed below:
[0042] 5'-CCACTAATTTTTTTTATTATTATTTTGTGTT-3'.
[0043] Thirdly, a kit for identifying the KASP molecular marker CmPcu9.6 for resistance to downy mildew in melons according to this application includes primer pairs for the KASP molecular marker CmPcu9.6 as described above, namely, allele primer CmPcu9.6-F1 as shown in SEQ ID NO.2, allele primer CmPcu9.6-F2 as shown in SEQ ID NO.3, and universal primer CmPcu9.6-R as shown in SEQ ID NO.4.
[0044] Fourthly, a KASP molecular marker for identifying downy mildew resistance in melons, as described in this application, was developed using the following method:
[0045] (1) Using the highly resistant downy mildew material “PI390452” (P1) as the female parent and the highly susceptible downy mildew material “HDZ” (P2) as the male parent (both resistant and susceptible materials were provided by the Biological Breeding Laboratory of Xinjiang Academy of Agricultural Sciences), a RIL population (F2S6) was constructed.
[0046] (2) Whole-genome sequencing was performed on 106 individual plants of the RIL population using the Illumina platform. A high-density genetic map was constructed based on the whole-genome sequencing data to locate QTLs for resistance to downy mildew in melon. Using the Melon (DHL92) v4 Genome as the reference genome, SNP sites with differences between parents within the localization interval were screened using the IGV software (IGV-2.11.9). 50 bp sequences before and after each SNP site were extracted, and the SNP site sequences were compared using the Cucurbitaceae genome database alignment tool. KASP primers were designed based on flanking sequences of specific SNP sites.
[0047] (3) Two allele-specific upstream primers and one universal downstream primer were designed using the online software Primer3Plus based on the flanking sequences around the SNP; the polymorphic SNP primers were converted into KASP markers.
[0048] Fifthly, the application of the KASP molecular marker for identifying downy mildew resistance in melons in this application, wherein the identification method for applying the KASP molecular marker to identify downy mildew resistance in melons includes the following steps:
[0049] Genomic DNA was extracted from the target melon, and PCR amplification was performed using the genomic DNA as a template. Fluorescence detection was performed based on primers with the KASP molecular marker CmPcu9.6 to obtain the gene type of the target melon. Based on the detected gene type, the trait of the target melon was determined.
[0050] In this specific implementation, the gene type was determined based on the following reaction system: 10 μL of Kaspar 2×reactionmix, 0.02 μL each of primers F1 and F2 (100 μM), 0.06 μL of primer R, and 1 μL of DNA. The Kaspar 2×reactionmix contained 50 mM glucose, 25 mM Tris-HCl (pH 8.0), and 10 mM EDTA (pH 8.0). Tris-HCl is tris(hydroxymethyl)aminomethane hydrochloride, and EDTA is ethylenediaminetetraacetic acid.
[0051] In a specific implementation, PCR amplification includes the following steps:
[0052] Pre-denaturation at 94℃ for 15 min;
[0053] Denaturation at 94℃ for 20 seconds;
[0054] Annealing at 65℃-57℃ for 45 seconds;
[0055] 10 cycles, with the annealing extension temperature decreasing by 0.8℃ in each cycle;
[0056] Denaturation at 94℃ for 20 seconds;
[0057] Annealing at 57℃ for 60 seconds, 30 cycles.
[0058] In a specific implementation, if the detected gene type is AA, it will exhibit homozygous resistance and will show resistance after downy mildew infection.
[0059] If the detected gene type is AT, it will be a heterozygous susceptible type, and will be susceptible to downy mildew after infection.
[0060] If the detected gene type is TT, it indicates a homozygous susceptible type, and all individual plants will show susceptibility after downy mildew infection.
[0061] In a specific implementation, the identification of downy mildew resistance in melons includes the following steps:
[0062] (1) Inoculate both parents and the RIL population with downy mildew and perform phenotypic identification;
[0063] (2) Extract genomic DNA from the parents and the RIL population of melons. Using the genomic DNA of the target melon as a template and KASP marker CmPcu9.6 as a primer, perform PCR amplification on the Matrix Cycler and Matrix Scanner of the Gene Matrix™ high-throughput genotyping system (HC Scientific, Chengdu).
[0064] (3) Genotype data analysis was performed using Matrix Master software;
[0065] (4) Determine the characteristics of the target melon based on the detected base types.
[0066] The KASP marker CmPcu9.6 in this application is polymorphic between the parents and can accurately distinguish the genotypes of the parents and F1 plants. In the RIL population, the KASP marker CmPcu9.6 co-segregates with downy mildew resistance, which indicates that the KASP marker CmPcu9.6 is closely linked to downy mildew resistance in melons and can be further used to identify whether melons have downy mildew resistance.
[0067] The reagents used in this application are: ultrapure water, Tween 20, Kaspar 2×reactionmix, and commonly used reagents are domestically produced analytical grade reagents.
[0068] The instruments used in this application include: brushes, beakers, filter paper, hemocytometers, L-type sprayers, nucleic acid detectors, pipettes, centrifuges, disposable pipette tips, centrifuge tubes, Illumina HiSeq™ PE150 sequencing platform, and GeneMatrix™ high-throughput genotyping system.
[0069] The technical solutions described in this application will be further explained below with reference to specific embodiments. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods. Unless otherwise specified, the materials and reagents used in the following embodiments can be obtained commercially.
[0070] Example 1
[0071] This embodiment provides a more detailed explanation of the identification of downy mildew resistance genes in melons and the development of KASP markers:
[0072] Step 1: In this study, the highly resistant downy mildew material PI 390452 (P1) was used as the female parent, and the highly susceptible downy mildew material "HDZ" (P2) was used as the male parent (both resistant and susceptible materials were provided by the Biological Breeding Laboratory of the Xinjiang Academy of Agricultural Sciences). Six generations of genetic populations (P1, P2, F1, F2, BC1P1, and BC1P2) were obtained. These six generations were inoculated with downy mildew, and phenotypic surveys were conducted. Resistance was determined based on the plant disease index.
[0073] The results of the identification are as follows Figure 1 (a) Figure 1 (b) and Figure 1 As shown in (c), on day 0 after inoculation, there were no lesions or mechanical damage on the leaf surfaces of the resistant parent "PI390452", the susceptible parent "HDZ", and the F1 generation plants.
[0074] like Figure 1 As shown in (d), on day 7 post-inoculation, the resistant parent 'PI390452' showed no obvious symptoms on its leaf surface, with a disease level of 0, indicating high resistance to downy mildew. Figure 1 As shown in (e), on the 7th day after inoculation, large areas of yellow lesions appeared on the leaf surface of the susceptible parent "HDZ," with downy mildew lesions covering 75% of the total leaf area, indicating a disease level of 5 and high susceptibility to downy mildew. Figure 1 As shown in (f), on the 7th day after inoculation, the leaf surface lesion area of F1 plants accounted for 60% of the total leaf area, with a disease level of 4, indicating susceptibility to downy mildew.
[0075] like Figure 1 As shown in (g), on day 15 post-inoculation, no obvious symptoms were observed on the leaf surface of the resistant parent 'PI390452'. Figure 1 As shown in (h), on day 15 post-inoculation, the lesions on the leaves of the susceptible parent "HDZ" had already dried out. Figure 1 As shown in (i), on day 15 after inoculation, the F1 plants had the same phenotype as the susceptible parent, with large areas of lesions appearing on the leaf surface, and the lesions had turned yellow and dried up.
[0076] like Figure 2 As shown, in the F2 generation segregating population, the disease level of all plants was continuously normally distributed between 0 and 5.
[0077] The disease severity distribution of BC1P1 progeny plants follows a normal distribution.
[0078] The disease severity of BC1P2 offspring tends to be susceptible, meaning the disease severity of BC1P2 is close to that of the male parent "HDZ," and it is more likely to be a backcross parent (e.g., Figure 2 (As shown).
[0079] Based on these data, it can be concluded that the downy mildew resistance trait in melons is controlled by a recessive polygenic gene. This discovery is of great significance for melon genetic breeding, as it reveals the genetic mechanism controlling downy mildew resistance in melons and provides a theoretical basis for future breeding work.
[0080] Step 2: To further identify SNP loci closely linked to downy mildew resistance in melons, a recombinant inbred line (F2S6) was constructed using the highly resistant downy mildew material “PI390452” (P1) as the maternal parent and the highly susceptible downy mildew material “HDZ” (P2) as the paternal parent. The RIL population was then inoculated with downy mildew and its phenotypic characteristics were determined. Samples from both parents and the RIL population were sent to Beijing Biomarker Biotechnology Co., Ltd. for whole-genome sequencing. A high-density genetic map was constructed based on the whole-genome sequencing data. QTL mapping was performed using individual plant phenotypic data from the RIL population, ultimately identifying the major QTLs for downy mildew resistance in melons. qDM9.1 Located on chromosome 9 (e.g.) Figure 3 (As shown).
[0081] Step 3: Based on the obtained QTLs for downy mildew resistance in melons qDM9.1 KASP molecular markers were further developed within the localization region.
[0082] Specifically, the KASP marker CmPcu9.6 was developed based on the SNP site at chr09:22824300 on chromosome 9 (e.g., Figure 4 As shown in the figure. This application designed three sets of primers, namely CmPcu9.6-F1 (45 base pairs in length), CmPcu9.6-F2 (45 base pairs in length), and CmPcu9.6-R (30 base pairs in length).
[0083] Subsequently, young tissues from both parents, F1 generation plants, and RIL populations were placed in 96-well PCR plates, and 70 μL of Buffer A solution (containing 50 mM glucose, 25 mM Tris-HCl, pH 8.0, 10 mM EDTA, pH 8.0) were added. The plates were then heated in a PCR instrument at 99 degrees Celsius for 2 minutes.
[0084] After cooling to room temperature, add an equal volume of Buffer B solution (containing 0.2M NaOH and 1% SDS), and centrifuge at 12000 rpm for 1 minute using a high-speed centrifuge to fully mix Buffer A and Buffer B solution to obtain AB mixture.
[0085] The AB mixture was diluted 20 times for KASP labeling detection.
[0086] This application utilizes the KASP marker CmPcu9.6 for PCR amplification in order to further screen and confirm the target gene.
[0087] Step 4: Genotyping of “PI390452”, “HDZ” and the RIL population containing 106 strains was performed using the KASP marker CmPcu9.6.
[0088] The KASP reaction was performed in a reaction plate, and the reaction system included: 10 μL of Kaspar 2×reactionmix, 0.02 μL each of 100 μM primers F1 and F2, 0.06 μL of primer R, and 1 μL of DNA. The Kaspar 2×reactionmix contained: Taq DNA polymerase, dNTPs, MgCl2, FAM and HEX / VIC fluorescent reporter-labeled probes, ROX reference dye, and stabilizer.
[0089] The PCR amplification program is as follows: pre-denaturation at 94℃ for 15 min;
[0090] Denaturation at 94℃ for 20 seconds;
[0091] Annealing at 65℃-57℃ for 45 seconds;
[0092] 10 cycles, with the annealing extension temperature decreasing by 0.8℃ in each cycle;
[0093] Denaturation at 94℃ for 20 seconds;
[0094] Annealing at 57℃ for 60 seconds, 30 cycles.
[0095] Through testing, such as Figure 5 As shown in (a), the KASP marker CmPcu9.6 distinguishes “PI390452”, “HDZ”, and F1 into three different genotypes, as follows: Figure 5 As shown in (b) of this application, three base types were successfully detected in the RIL population.
[0096] Specifically:
[0097] (1) When the genotype of the melon detected is consistent with the base type of the disease-resistant parent, which is AA, the target melon will be disease-resistant after being infected by downy mildew because it carries a homozygous recessive disease-resistant allele (A). It can be determined that the trait of the target melon is a homozygous disease-resistant type.
[0098] (2) When the base type detected in the melon is consistent with the base type of the susceptible parent, which is TT, the target melon will be susceptible to downy mildew after infection because it carries the homozygous dominant susceptibility allele (T), and the trait of the target melon can be determined to be homozygous susceptible.
[0099] (3) When the detected base type is TA, the target melon, after being infected by downy mildew pathogen, carries a disease-resistant allele recessive (A) and the disease-susceptible allele (T) is expressed dominantly in the heterozygote (TA), thus exhibiting a phenotype similar to that of the F1 plant and showing susceptibility. Therefore, the target melon can be determined to be a heterozygous susceptible type. NO CALL indicates that the sample has no fluorescent signal and is a blank control.
[0100] Analysis of individual plant phenotypic data from the RIL population and their genotypes revealed the following: Genotype TT (homozygous susceptible) showed that all plants with this genotype were susceptible to downy mildew after infection; genotype AA (homozygous resistant) showed resistance after infection; and genotype TA (heterozygous susceptible) showed susceptibility after infection. These findings indicate that the KASP marker CmPcu9.6 is linked to downy mildew resistance and can be further used to identify downy mildew resistance in melons.
[0101] Figure 5 In the diagram, the blue triangle represents sample "PI390452", the red triangle represents sample "HDZ", the blue dot represents a homozygous resistant plant, the red dot represents a homozygous susceptible plant, and the green dot represents a heterozygous susceptible plant. "NO CALL" indicates that the sample has no fluorescent signal and serves as a blank control.
[0102] Depend on Figure 4 It can be seen that the KASP marker CmPcu9.6 segregates in the RIL population, with the FAM channel corresponding to the "HDZ" genotype, which is TT; the HEX channel corresponding to the "PI390452" genotype, which is AA; and the intermediate channel corresponding to the heterozygous genotype, which is TA.
[0103] While specific embodiments of this application have been described in detail, this should not be construed as limiting the scope of protection of this application. Various modifications and variations that can be made by those skilled in the art without inventive effort within the scope described in the claims still fall within the scope of protection of this application.
Claims
1. The application of a primer pair for detecting KASP molecular markers in identifying downy mildew resistance in melons, characterized in that, The identification method includes the following steps: Genomic DNA was extracted from the target melon, and PCR amplification was performed using the genomic DNA as a template. Fluorescence detection was performed based on primer pairs with KASP molecular markers to obtain the gene type of the target melon. Based on the detected gene type, the traits of the target melon were determined. The primer pair for the KASP molecular marker was designed based on the polymorphic SNP site at chr09:22824300 in the reference genome Melon (DHL92) v4 Genome. The SNP site is located at the 51st base of the nucleotide sequence shown in SEQ ID NO.
1. The base of the SNP site is mutated from T to A. If the detected gene type is AA, it is a homozygous resistant type, and all individuals will be resistant to downy mildew after infection. If the detected gene type is AT, it is a heterozygous susceptible type, and all individuals will be susceptible to downy mildew after infection. If the detected gene type is TT, it is a homozygous susceptible type, and all individuals will be susceptible to downy mildew after infection. The melons mentioned are a generational genetic population obtained by crossing PI 390452, a material highly resistant to downy mildew, as the female parent, and Huang Danzi "HDZ", a material highly susceptible to downy mildew, as the male parent.
2. The application according to claim 1, characterized in that, The primer pairs for the KASP molecular markers include allele primer CmPcu9.6-F1 as shown in SEQ ID NO.2, allele primer CmPcu9.6-F2 as shown in SEQ ID NO.3, and universal primer CmPcu9.6-R as shown in SEQ ID NO.4.
Citation Information
Patent Citations
KASP marker related to downy mildew resistance character of muskmelon and development and application of KASP marker
CN116606949A
Downy mildew resistance in cucurbitaceae plants
US20220275393A1