Application of nutritional composition in preparation of products for protecting or repairing gastric mucosa

Abstract

The invention discloses application of a nutritional composition in preparation of products for protecting or repairing gastric mucos.The nutritional composition comprises 5%-10% of bitter gourd seed basic protein, 5%-10% of fish elastin peptide powder and 80%-90% of yeast glucan, the nutritional composition can synergistically inhibit expression of IL-1beta, IL-6 and TNF-alpha inflammatory factors, the structural safety of the stomach wall is protected, and the effect of protecting or repairing the gastric mucosa is achieved. The composition can repair gastric mucosal injury, and especially has a remarkable effect on preventing the gastric mucosal injury.

Description

Technical Field

[0001] The present invention relates to the field of health-care foods, and in particular to an application of a nutritional composition in preparing a product for protecting or repairing gastric mucosa. Background Art

[0002] The gastric mucosa is a very thin and fragile mucosal tissue present in the inner wall of the stomach. Under normal circumstances, the gastric mucosa is rarely damaged. This is mainly due to the fact that the gastric and duodenal mucosa have a relatively complete set of self-defense mechanisms. In addition to the mucus-bicarbonate barrier and the gastric mucosal barrier, it also has a very important cell protection function. Studies have found that the gastric and duodenal mucosa and muscle layer contain high concentrations of prostaglandins (PGE2 and PGI2), epidermal growth factor (EGF), and somatostatin. It can inhibit the secretion of gastric acid and pepsinogen, stimulate mucus and HCO3 - Secretion, improve gastric mucosal blood circulation, help repair the gastric mucosa and maintain its integrity, promote gastric mucosal cell proliferation, etc., thereby effectively resisting the damage of gastric acid and other damaging factors to the digestive tract mucosa.

[0003] However, due to chemical factors (smoking, drinking, strong tea, coffee and drugs that irritate the gastric mucosa such as aspirin, indomethacin, etc.), physical factors (too cold, too hot, too rough food or overeating, etc.), bacteria or their toxin stimulation and other factors, gastric mucosal damage can be caused. At present, ranitidine drugs are commonly used in clinical practice. By inhibiting gastric acid secretion, it can effectively reduce the irritation and damage of gastric acid to the gastric mucosa, thereby playing a role in protecting the gastric mucosa. However, the above-mentioned drugs are usually symptomatic treatments after gastric mucosal damage has occurred, and do not play a protective role, and the side effects are large, and are not suitable for long-term use. For example, Chinese patent CN202210031233.2 discloses a composition for protecting gastric mucosa, a functional beverage and a preparation method thereof, comprising a plant-derived component and a composite bacterial agent, wherein the plant-derived component comprises 1-3 parts of prickly pear cactus extract, 2-5 parts of galangal, and 0.5-2.5 parts of snow lotus culture. Although the functional beverage of the composition can effectively relieve and repair the damage to the gastric mucosa, it has a good flavor. However, the composition requires a complex bacterial agent, has high storage requirements, and is expensive. Therefore, it is necessary to study the application of a nutritional composition in the preparation of a product for protecting or repairing gastric mucosa. Summary of the Invention

[0004] In view of this, the present invention provides a use of a nutritional composition in the preparation of a product for protecting or repairing gastric mucosa, which has a significant effect of repairing or preventing gastric mucosal damage.

[0005] The invention adopts the application of a nutritional composition in preparing a product for protecting or repairing gastric mucosa. The nutritional composition comprises bitter melon seed basic protein, fish elastin peptide powder and yeast glucan.

[0006] Preferably, the content of alkaline protein in the bitter melon seeds in the nutritional composition is 5-10%.

[0007] Preferably, the fish elastin peptide powder accounts for 5-10% by weight in the nutritional composition.

[0008] Preferably, the weight proportion of yeast glucan in the nutritional composition is 80-90%.

[0009] Preferably, the mass proportion of the bitter melon seed alkaline protein in the nutritional composition is 10%, and the mass proportion of the fish elastin peptide powder is 10%.

[0010] Preferably, the fish elastin peptide has a molecular weight of 600-800 Daltons.

[0011] Preferably, the molecular weight of the bitter melon seed basic protein is 26-30KD.

[0012] Preferably, the nutritional composition synergistically inhibits the expression of inflammatory factors IL-1β, IL-6, and TNF-α.

[0013] The present invention provides a nutritional composition for use in the preparation of a product for protecting or repairing gastric mucosa. This nutritional composition, comprising bitter melon seed basic protein, fish elastin peptide powder, and yeast beta-glucan as its main ingredients, synergistically inhibits the expression of inflammatory factors such as IL-1β, IL-6, and TNF-α, thereby reducing inflammatory responses, protecting the structural safety of the stomach wall, and significantly reducing gastric mucosal damage. The composition demonstrates excellent preventive efficacy in protecting the gastric mucosa.

[0014] Furthermore, the nutritional composition comprises 5-10% bitter melon seed basic protein, 5-10% fish elastin peptide powder and 80-90% yeast beta-glucan. The components of the nutritional composition of the present invention are all extracted from natural plants or animals, and oral intake is convenient, safe and has no side effects. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 The results of macroscopic observation of the stomach of rats in each experimental group in Example 4 are shown below;

[0016] Figure 2 The results of the gastric slice observation of rats in each experimental group in Example 4 are shown in FIG.

[0017] Figure 3 The figure shows the results of Western Blot analysis of the expression levels of inflammatory factors in rats in each experimental group in Example 4;

[0018] Figure 4 This is a graph showing the results of using PCR to determine the expression levels of inflammatory factors in rats in each experimental group in Example 4. DETAILED DESCRIPTION

[0019] The principles and features of the present invention are described below with reference to the accompanying drawings. The examples given are only used to explain the present invention and are not used to limit the scope of the present invention.

[0020] The fish elastin peptides involved in the following examples were purchased from Hainan Huayan Collagen Technology Co., Ltd., with a molecular weight of 600-800 Daltons. Fish elastin peptides were extracted from tilapia. Momordica charantia seed basic protein, with a molecular weight of 26-30 kD, was extracted by the following method: 25 g of peeled momordica charantia seeds were placed in an insulated box and frozen with an appropriate amount of liquid nitrogen for 5 minutes. The seeds were then ground into a powder in a high-speed tissue grinder and poured into a 100 mL conical flask. 75 mL of petroleum ether was added and soaked. The mixture was then placed in a 4°C refrigerator for defatting. After 7 days, the flask was removed and the upper layer of petroleum ether was discarded. The filter cake was spread out and placed in a well-ventilated area to allow the remaining petroleum ether to evaporate naturally. This yielded defatted momordica charantia seed powder. 2 g of defatted momordica charantia seed powder was placed in an ice-water bath, 12 mL of 1.3 mol / L NaCl solution was added, and ultrasonic extraction was performed for 30 minutes. The filtrate was then filtered through gauze to obtain the crude protein extract. The crude extract was then magnetically stirred in an ice-water bath for 4 hours and the pH was adjusted to 4 with 3.7 mL of 0.1 mol / L phosphoric acid. The pH-adjusted crude extract was centrifuged at 10,000 rpm for 15 minutes at 4°C. The supernatant was centrifuged at 10,000 rpm for 20 minutes. The supernatant was desalted using a protein purifier, and the first peak fraction was collected and freeze-dried.

[0021] Example 1: A nutritional composition is prepared by uniformly mixing 7 parts of bitter melon seed basic protein, 8 parts of fish elastin peptide and 85 parts of yeast glucan in a weight ratio.

[0022] Example 2: A nutritional composition is prepared by uniformly mixing 10 parts of bitter melon seed basic protein, 10 parts of fish elastin peptide and 80 parts of yeast glucan in a weight ratio.

[0023] Example 3: A nutritional composition is prepared by uniformly mixing 5 parts of bitter melon seed basic protein, 5 parts of fish elastin peptide powder and 90 parts of yeast beta-glucan according to weight ratio.

[0024] Example 4: Use of the nutritional composition of Example 1 in preparing a product for protecting or repairing gastric mucosa

[0025] (1) Experimental design: First, 30 rats were prepared and divided into 5 groups, with 6 rats (200 g) in each group. The rats were divided into five groups and fed according to the following method:

[0026] Normal group: distilled water (7.5 mL / kg), once a day.

[0027] Alcohol model group: 75% alcohol (7.5 mL / kg) was administered once a day.

[0028] Ranitidine group: 75% alcohol was administered once a day (7.5 mL / kg), and half an hour later, ranitidine (5.4 mg / mouse) was administered once a day.

[0029] The composition repair group was given 75% alcohol once a day (7.5 mL / kg), and half an hour later, the nutritional composition of Example 1 was given once a day (1 g / kg).

[0030] Composition protection group: first administered the nutritional composition of Example 1 (1 g / kg), and half an hour later, administered 75% alcohol (7.5 mL / kg) once a day.

[0031] (2) After 7 days of feeding, the five groups of experimental rats were treated separately and their stomachs were removed for naked eye observation. The experimental results are as follows: Figure 1 :

[0032] Normal group: In the normal control group, no treatment was given, e.g. Figure 1 As shown in A, the gastric mucosa appears normal, with no obvious erythema, edema or hemorrhage. This group serves as a control and shows normal gastric tissue without any gastric mucosal damage.

[0033] Alcohol model group: In the alcohol model group, rats were treated with 75% alcohol by gavage. Figure 1 As shown in Figure B, the gastric mucosa is clearly damaged by the naked eye. This is manifested by multiple blood spots, erythema, and edema. These injuries indicate the strong irritation and damage caused by alcohol on the gastric mucosa.

[0034] Ranitidine group: In the ranitidine group, animals were given ranitidine after receiving alcohol orally. Figure 1 As shown in Figure C, gastric mucosal damage was alleviated compared with the pure alcohol model group, showing fewer blood spots and erythema, indicating that ranitidine has a certain protective effect.

[0035] Combination repair group: In this group, animals received drug treatment after alcohol gavage. Figure 1 As shown in Figure E, the extent of gastric mucosal damage observed was similar to that in the ranitidine group, and significantly less damage than in the model group, manifested as fewer blood spots and erythema. This indicates its effectiveness in treating alcohol-induced gastric mucosal damage.

[0036] Combination protection group: In the protection group, animals were given drug treatment before receiving alcohol gavage. Figure 1 As shown in Figure F, the gastric mucosa appears relatively healthy and intact. Compared to the alcohol-treated model group, this group showed no obvious signs of damage on the stomach surface, such as blood spots or severe erythema. Preemptive medication significantly prevented alcohol-induced gastric mucosal damage, with a protective effect superior to a repair effect.

[0037] Therefore, the above description shows that the nutritional composition of Example 1 can not only repair gastric mucosal damage caused by alcohol, but also effectively prevent alcohol from damaging the gastric mucosa, thereby protecting the gastric mucosa.

[0038] (3) The stomachs of five groups of experimental rats were sliced ​​and observed. The experimental results are as follows: Figure 2 :

[0039] Normal group: In the normal control group, e.g. Figure 1 As shown in Figure A, the pathological section shows that the gastric mucosa is structurally intact, with regular cell arrangement and no obvious inflammatory cell infiltration or tissue structural damage. The various layers of the gastric wall are clearly visible, with no congestion, edema, or hemorrhage, indicating healthy gastric tissue.

[0040] Alcohol model group: In the slices of the alcohol model group, e.g. Figure 2 As shown in Figure B, the gastric mucosa shows significant damage. Histological observations show severe epithelial cell desquamation, marked congestion and edema, and infiltration of numerous inflammatory cells. These findings indicate that alcohol's direct toxic effects on the gastric mucosa lead to significant tissue damage.

[0041] Ranitidine group: Compared with the alcohol model group, the gastric mucosal damage in the ranitidine group was alleviated. Figure 2 As shown in C, although some epithelial cell shedding and inflammatory cell infiltration can still be seen, the overall structure is relatively intact, indicating that ranitidine has the effect of repairing the gastric mucosa.

[0042] Composition repair group: such as Figure 2 As shown in Figure E, gastric mucosal sections from the treatment group demonstrated a significant tissue protective effect. Despite alcohol stimulation, compared with the alcohol model group, gastric mucosal epithelial cell integrity was improved, cell arrangement was more regular, and inflammatory response was reduced, with no significant difference compared with the ranitidine group. Tissue congestion and edema were reduced, and inflammatory cell infiltration was relatively minimal, demonstrating a positive effect on repairing and protecting the damaged gastric mucosa.

[0043] Composition protection group: Figure 2 As shown in Figure F, the gastric mucosal tissue in the protected group was closer to that of the normal group, showing minimal signs of damage. The gastric mucosal epithelial cells were arranged tightly and regularly, with no obvious infiltration of inflammatory cells, and no obvious congestion or edema was observed. This shows that the nutritional composition of Example 2 not only reduces the typical inflammatory response in protecting the stomach from alcohol-induced gastric damage, but also protects the structural safety of the stomach wall, demonstrating its potential mechanism in gastric mucosal protection. Its protective application can significantly prevent gastric mucosal damage caused by alcohol.

[0044] Therefore, the nutritional composition of Example 1 showed good effects in both protecting and treating gastric mucosal damage caused by alcohol, and in particular, the effect of gastric mucosal protection was better than that of the repair group.

[0045] (4) Furthermore, Western Blot was used to determine the expression of inflammatory factors: Specifically, RIPA kit (Biyuntian) was used to extract the total protein (anti-IL-1β, anti-IL-6, anti-TNF-α) of each experimental group, and the total protein concentration was determined using a BCA protein quantification kit. 30 μg of protein was loaded per lane, and after SDS-polyacrylamide gel electrophoresis (SDS-PAGE), the membrane was electrotransferred to a PVDF membrane, blocked with 5% skim milk at room temperature for 1 hour, washed three times with TBST, each time for 5 minutes, and then anti-IL-1β (1:500), anti-IL-6 (1:1000), anti-TNF-α (1:10000), and anti-actin (1:10000) were added respectively, and incubated at 4°C overnight. The cells were washed with TBST three times, 5 min each time, and the corresponding secondary antibody (1:1000) was added. The cells were incubated at room temperature for 2 h, and washed again with TBST three times, 5 min each time. The ECL chemiluminescence kit was used for color development. The protein bands were collected using an ultrasensitive multifunctional imager and analyzed using Quantity One software. Figure 3 The expressions of inflammatory factors IL-1β, IL-6, and TNF-α in the alcohol model group were significantly increased. The expressions of the above inflammatory factors in the ranitidine group, the combination protection group, and the combination repair group were decreased compared with the model group, and the decrease in the combination protection group was the most obvious.

[0046] (5) Furthermore, fluorescence quantitative PCR was used to detect the expression of inflammatory factors: RNA was extracted from cells of each treatment group using an RNA rapid extraction kit (Thermo), and RNA was reversed into cDNA using a reverse transcription PCR kit (Thermo). The expression levels of IL-1β, TNF-α, and IL-6 were detected, and the expression levels of these inflammation-related genes were detected using a fluorescence quantitative kit (Vazyme) according to the primers in Table 1. The specific operation of RT-PCR was referred to the instruction manual. The reaction conditions were: 42°C, 60 min; 70°C, 15 min, and stored at 4°C. The qPCR system was referred to the instruction manual. The reaction procedure was as follows: 94°C, 3 min; 94°C, 15 s, 58°C, 30 s, 72°C, 30 s, 40 cycles; 72°C, 10 min. The fluorescence signal was collected during the annealing step, and each template was amplified in parallel three times.

[0047] Table 1 Primer sequences

[0048] Primer name sequence

[0049] IL-1β-For GCCCTAAACAGATGAAGTGCTC

[0050] IL-1β-RevGAACCAGCATCTCTCCTCAG

[0051] IL-6-For TGACCCAACCACAAATGC

[0052] IL-6-Rev TGACCCAACCACAAATGC

[0053] TNF-α-For GCCTGTTCCTGTGATGTGGAG

[0054] TNF-α-RevTGCCCACAGACATTCATACAGTTTC

[0055] like Figure 4 The results showed that PCR and WB results were consistent, indicating that the expression of inflammatory factors IL-1β, IL-6, and TNF-α was significantly increased in the alcohol model group. Compared with the model group, the expression of these inflammatory factors in the ranitidine group, the combination protection group, and the combination repair group decreased, with the decrease being most significant in the preventive drug group. This indicates that the combination protection group has a better protective effect on the gastric mucosa than the ranitidine group and the combination repair group.

[0056] Comparative Example 1: A feeding experiment was conducted using a single bitter melon seed alkaline protein.

[0057] Comparative Example 2: A feeding experiment was conducted using a single fish elastin peptide.

[0058] Comparative Example 3: A feeding experiment was conducted using a single yeast beta-glucan.

[0059] (1) The nutritional compositions prepared in Examples 1 to 4 and Comparative Examples 1 to 3 were tested for their application in protecting gastric mucosa. 48 rats were prepared and divided into 8 groups, with 6 rats (200 g) in each group. The experimental rats were first given nutrients (1 g / kg) for half an hour, and then given 75% alcohol once a day (7.5 mL / kg). After 7 days, the length and width of the bleeding points or bleeding bands were measured with a vernier caliper under the naked eye. In view of the fact that the width can better reflect the severity of the injury, a weight twice the width was given during calculation for integration. The scoring criteria can be found in the "Health Food Function Test and Evaluation Method". Damage inhibition rate (%) = (AB) / A' 100% (A and B are the model group and the experimental group, respectively). As shown in Table 1, the nutritional compositions prepared in Examples 1 to 3 not only protect the structural safety of the stomach wall, but also significantly reduce gastric mucosal damage.

[0060] Table 1 Gastric mucosal injury scoring results

[0061] project Total points Damage inhibition rate (%) Normal group 0 No damage Model Group 192 0 Example 1 16 91.6％ Example 2 10 94.8％ Example 3 21 89.0％ Comparative Example 1 112 41.6％ Comparative Example 2 95 50.5％ Comparative Example 3 153 20.3％

[0062] (2) The nutritional compositions prepared in Examples 1 to 4 and Comparative Examples 1 to 3 were tested for their application in protecting gastric mucosa. The experimental rats were first given the nutritional compositions (1 g / kg), and half an hour later, 75% alcohol was administered once a day (7.5 mL / kg). After 7 days, the inflammatory factor ratios of each group relative to the normal group are shown in Table 2. Compared with Comparative Examples 1 to 3, the bitter melon seed basic protein, fish elastin peptide powder, and glutathione of Examples 1 to 3 synergistically inhibited the expression of IL-1β, IL-6, and TNF-α inflammatory factors, thereby reducing gastric mucosal damage.

[0063] Table 2 Expression levels of IL-1β, TNF-α and IL-6 in different experimental groups

[0064]

[0065]

[0066] In summary, the nutritional composition provided by the present invention is used in the preparation of a product for protecting or repairing gastric mucosa. The nutritional composition contains bitter melon seed basic protein and fish elastin peptide powder as main active ingredients. The nutritional composition of the present invention can synergistically inhibit the expression of inflammatory factors IL-1β, IL-6, and TNF-α, which not only reduces the typical inflammatory response, but also protects the structural safety of the gastric wall, and can significantly reduce gastric mucosal damage caused by alcohol.

[0067] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. Use of a nutritional composition in preparing a product for protecting or repairing gastric mucosa, characterized in that: The nutritional composition comprises bitter melon seed basic protein, fish elastin peptide powder and yeast beta-glucan.

2. Use of a nutritional composition according to claim 1 in preparing a product for protecting or repairing gastric mucosa, characterized in that: The content of the alkaline protein in the bitter melon seeds accounts for 5-10% of the nutritional composition.

3. Use of a nutritional composition according to claim 2 in preparing a product for protecting or repairing gastric mucosa, characterized in that: The fish elastin peptide powder accounts for 5-10% by weight in the nutritional composition.

4. Use of a nutritional composition according to claim 3 in preparing a product for protecting or repairing gastric mucosa, characterized in that: The weight percentage of yeast glucan in the nutritional composition is 80-90%.

5. Use of a nutritional composition according to claim 4 in preparing a product for protecting or repairing gastric mucosa, characterized in that: In the nutritional composition, the mass of bitter melon seed alkaline protein accounts for 10%, and the mass of fish elastin peptide powder accounts for 10%.

6. Use of a nutritional composition according to claim 1 in preparing a product for protecting or repairing gastric mucosa, characterized in that: The molecular weight of the fish elastin peptide is 600-800 Daltons.

7. Use of the nutritional composition according to claim 1 in preparing a product for protecting or repairing gastric mucosa, characterized in that: The molecular weight of the bitter melon seed basic protein is 26-30KD.

8. Use of the nutritional composition according to claim 1 in preparing a product for protecting or repairing gastric mucosa, characterized in that: The nutritional composition synergistically inhibits the expression of inflammatory factors such as IL-1β, IL-6 and TNF-α.

Images