Mesenchymal stem cell modified by nucleic acid nanomaterial as well as preparation method and application of mesenchymal stem cell

Abstract

The invention relates to the technical field of nano medicine, in particular to mesenchymal stem cells modified by a nucleic acid nano material as well as a preparation method and application of the mesenchymal stem cells. According to the invention, a DNA structure containing an initiation chain of a hybridization chain reaction is modified on the mesenchymal stem cell through a nucleic acid nanotechnology, and a large number of adhesion promoting functional groups and angiogenesis promoting functional groups are modified on the mesenchymal stem cell through the hybridization chain reaction, so that the mesenchymal stem cell modified by a nucleic acid nanomaterial is obtained. According to the mesenchymal stem cell modified by the nucleic acid nanomaterial, on the cellular level, the anti-oxidative stress capacity of the mesenchymal stem cell can be improved, the cell activity can be obviously improved, the adhesion capacity of the mesenchymal stem cell to umbilical vein endothelial cells is promoted, and the repairing capacity and the cell activity of the umbilical vein endothelial cells are promoted. And on the living body level, the implantation rate of the mesenchymal stem cells in the wound part can be improved, the angiogenesis of the wound part is promoted, and the wound repair speed is accelerated.

Description

Technical Field

[0001] The present invention relates to the field of nanomedicine technology, and in particular to mesenchymal stem cells modified with nucleic acid nanomaterials, and a preparation method and application thereof. Background Art

[0002] Wound sites are often accompanied by inflammatory responses, hypoxic environments, and impaired angiogenesis. Wound repair is a complex process that requires the coordinated participation of multiple cells and the influence of the wound microenvironment to repair damaged tissues and re-establish a protective barrier.

[0003] Mesenchymal stem cells are a type of cell with self-renewal and multipotent differentiation abilities. Mesenchymal stem cell transplantation is an important cell therapy for treating inflammation and tissue damage. Studies have shown that transplanted mesenchymal stem cells can accelerate wound healing by secreting cytokines and growth factors, promoting epithelialization, granulation tissue formation, and neovascularization. However, transplanted mesenchymal stem cells have a short residence time in wound tissue and a low engraftment rate in the wound, which has become a major limiting factor for cell therapy based on mesenchymal stem cells.

[0004] The application of functional nanomaterials to modify mesenchymal stem cells can enhance their adhesion and resistance to wounds, thereby improving their engraftment and survival rates, enabling them to better perform their wound repair functions. Studies have shown that nucleic acid nanofunctional materials have the potential to resist inflammation and oxidative stress. Furthermore, nucleic acid nanomaterials possess inherent programmability, ease of functional group modification, and good biocompatibility. Modifying cells with nucleic acid functional nanomaterials can protect cells and enhance their function.

[0005] Most of the biomaterials currently used for wound repair have certain deficiencies, for example: Patent application CN115590811A (a hydrogel preparation loaded with stem cells and its application) discloses a hydrogel preparation for loading stem cells, wherein the hydrogel preparation uses fibrinogen and thrombin as gelling matrix materials, and adds antifibrinolytic agents to improve its stability, while adding stem cell protective fluid to maintain the survival of stem cells in the hydrogel. The hydrogel preparation provided by this invention simulates a three-dimensional extracellular matrix environment, can support stem cell growth, proliferation and differentiation, has good biocompatibility and the function of promoting wound healing, and has good effects on loading stem cells and treating diabetic wound ulcers. However, this method is cumbersome to operate, and the required raw material components are complex, which may affect the cell viability and cytokine secretion of stem cells.

[0006] For another example: Patent CN107961381A (Application of DNA tetrahedron in promoting anti-aging of cells) discloses DNA tetrahedron, which promotes the anti-inflammatory effect of cells by reducing the release of inflammatory cytokines and inhibiting the expression of iNOS gene and iNOS protein. The DNA tetrahedron promotes the antioxidant effect of cells by inhibiting the phosphorylation of proteins ERK1 / 2, P38, and JNK downstream of the MAPK / ERK signaling pathway and promoting the expression of induced heme oxygenase-1. The DNA tetrahedron has good bioavailability and biocompatibility, and has anti-inflammatory and antioxidant functions, thereby delaying the aging of cells. This patent mainly uses DNA tetrahedron to alleviate the antioxidant stress of macrophages in an inflammatory environment and inhibit the release of inflammatory factors by macrophages, thereby alleviating cell aging, and has not been applied to the treatment of disease models.

[0007] There are also related studies on mesenchymal stem cells for wound repair. For example, patent application CN116726048A (Application of DNA Tetrahedrons in Promoting Cell Anti-Aging) discloses a DNA micron flower-shaped structure. The DNA micron flower-shaped structure is loaded with a variety of molecular payloads including peptides and aptamers. When mixed with mesenchymal stem cells, it can improve the cell viability of stem cells, maintain and enhance their adhesion to wounds, repair vascular endothelial cell damage, and promote angiogenesis and wound healing. The DNA micron flower-shaped structure disclosed in this patent application is obtained by rolling circle amplification. The preparation conditions are complex and the preparation process is long. It requires expensive reaction enzymes Phi29 DNA polymerase and T4 ligase, which greatly limits its application.

[0008] Therefore, the development of a simple and low-cost nanomaterial that can increase the anti-oxidative stress ability of mesenchymal stem cells and promote the adhesion and angiogenesis abilities of mesenchymal stem cells, thereby improving the implantation rate and survival rate of mesenchymal stem cells in wound sites, and enhancing the anti-inflammatory and wound repair abilities of mesenchymal stem cells is a research focus in this field. Summary of the Invention

[0009] To address the aforementioned technical problems in the prior art, the present invention provides a nucleic acid nanomaterial-modified mesenchymal stem cell, and its preparation method and application. This is achieved through the following technical solutions:

[0010] A method for preparing mesenchymal stem cells modified with nucleic acid nanomaterials comprises the following steps:

[0011] (1) Through hydrophobic interactions, a cholesterol-modified DNA structure is assembled onto the cell membrane of mesenchymal stem cells to obtain DNA-modified mesenchymal stem cells;

[0012] (2) Assembling the H1 DNA chain modified with the adhesion-promoting functional group and the H2 DNA chain modified with the angiogenesis-promoting functional group into the DNA structure-modified mesenchymal stem cells obtained in step (1) through a hybridization chain reaction, thereby obtaining nucleic acid nanomaterial-modified mesenchymal stem cells. The hybridization chain reaction is to self-assemble the H1 DNA chain modified with the adhesion-promoting functional group and the H2 DNA chain modified with the angiogenesis-promoting functional group into the Y-shaped cholesterol-modified DNA structure based on the principle of base complementary pairing.

[0013] Furthermore, the step (1) is specifically to take mesenchymal stem cells in a culture medium to obtain a cell suspension of mesenchymal stem cells, add the DNA structure modified with cholesterol to the above-mentioned mesenchymal stem cell suspension, mix evenly, and incubate; then, take the culture medium and add it to the cell suspension, centrifuge, aspirate the supernatant, repeat twice to complete the washing, and obtain mesenchymal stem cells modified with the DNA structure of cholesterol. The concentration of the DNA structure modified with cholesterol is (0.1-10) μM, preferably 0.5 μM; the cell concentration of the mesenchymal stem cells is (10 5 -10 7 cells / mL), preferably 10 6 / mL; the assembly conditions were 37°C, 200r incubation for 10 minutes, and washing twice to complete the assembly.

[0014] Furthermore, the step (2) specifically comprises diluting the H1 chain (i.e., FITC-RGD-CTACAAAAAGAGAACCTGGGTACGATGCCCAGGTTC) and the H2 chain modified with Apt02 (i.e., CCCAGGTTCTCTTTTTGAACCTGGGCATCGTA CTACGCTGATAGGATGGGTTGTAGGTCTAGGGGGGGGCC) with culture medium, incubating, annealing, and then adding them to the mesenchymal stem cells modified with the cholesterol DNA structure in step (2). After incubating the above cell suspension on a shaker, the culture medium is added to the cell suspension, centrifuged, the supernatant is aspirated, and the washing is repeated twice to obtain mesenchymal stem cells modified with nucleic acid nanomaterials modified with pro-adhesion functional groups and pro-angiogenesis functional groups. The molar ratio of the DNA structure, the H1 DNA chain modified with the adhesion-promoting functional group, and the H2 DNA chain modified with the angiogenesis-promoting functional group is 1:(5-20):(5-20), preferably 1:10:10; the assembly conditions are 37°C, 200r, incubation for 2-6h, and washing twice to complete the assembly.

[0015] Furthermore, the cholesterol-modified DNA structure is any one or more of a Y-shaped cholesterol-modified DNA structure, a tetrahedral cholesterol-modified DNA structure, or a hexahedral cholesterol-modified DNA structure, preferably a Y-shaped cholesterol-modified DNA structure. The Y-shaped cholesterol-modified DNA structure is approximately 10 nm in size and is a nanostructure self-assembled by hybridization based on the principle of complementary base pairing of a YaDNA chain containing a hybridization chain reaction initiator chain, a cholesterol-modified YbDNA chain, and a cholesterol-modified YcDNA chain, preferably a Y-shaped nanostructure.

[0016] Furthermore, the adhesion promoting functional group is RGD tripeptide or c(RGDfK) five-membered cyclic peptide.

[0017] Furthermore, the angiogenesis-promoting functional group is the VEGFR nucleic acid aptamer Apt01 or Apt02, preferably Apt02.

[0018] Furthermore, the mesenchymal stem cells are any one of adipose-derived mesenchymal stem cells, bone marrow-derived mesenchymal stem cells, and umbilical cord-derived mesenchymal stem cells, preferably adipose-derived mesenchymal stem cells.

[0019] Furthermore, the cholesterol-modified DNA structure is prepared by the following method: mixing a Ya DNA chain containing a hybridization chain reaction initiator chain, a Yb DNA chain modified with cholesterol, and a Yc DNA chain modified with cholesterol in a buffer solution, and annealing to obtain the DNA structure. The molar ratio of the Ya DNA chain containing a hybridization chain reaction initiator chain, the Yb DNA chain modified with cholesterol, and the Yc DNA chain modified with cholesterol is 1:1:1; the annealing conditions are: annealing from 95°C to 65°C, with a gradient of 4-6°C, and a dwell time of 4-6 minutes for each gradient; annealing from 65°C to 25°C, with a gradient of 0.5-2°C, and a dwell time of 9-11 minutes for each gradient, for a total annealing time of approximately 7-9 hours. Further, the Ya chain containing the priming sequence (TGGACCGATAACAAATGTACATAACAATAGTACCTGAGCTA CTACGATGCCCAGGTTC), the Yb chain modified with cholesterol at the 3' end (CTCA GGTACTATTGTTATGATCTTCTATTGTACAGCCTCTAC-Chol), and the Yc chain modified with cholesterol at the 3' end (AGGCTGTACAATAGAAGATTA CATTTGTTATCGGTCCA CTAC-Chol). Specifically, before assembly, the Ya chain containing the priming sequence (TGGACCGATAACAAATGTACATAACAATAGT ACCTGAGCTACTACGATGCCCAGGTTC), the Yb chain modified with cholesterol at the 3' end (CTCAGGTACTATTGTTATGATCTTCTATTGTACAGCCTCTAC-Ch ol), and the Yc chain modified with cholesterol at the 3' end (AGGCTGTACAATAGAAGATT ACATTTGTTATCGGTCCA CTAC-Chol) were dissolved in water, and the concentration of each DNA chain was adjusted to 100 μM. Taking the assembly of 5 μM, 100 μL Y-shaped DNA structure as an example: in a 200 μL PCR tube, the Ya chain, Yb chain and Yc chain were mixed in a ratio of 1:1:1, and 10×TAE / MgCl2 was added to the mixture. 2+ and deionized water to make the final concentration of each DNA chain 5μM, the final volume 100μL, and the system in 1×TAE / Mg 2+ buffer; in a PCR instrument, the mixed solution is slowly annealed and cooled from 95°C to 20°C in a gradient, and the entire cooling process is controlled to be more than 8 hours, thereby obtaining a Y-shaped DNA structure.

[0020] Furthermore, the H1 DNA is prepared by the following method: a click reaction of azide-modified DNA with an alkyne-modified adhesion-promoting functional group to obtain the H1 DNA modified with the adhesion-promoting functional group. The molar ratio of the azide-modified DNA to the alkyne-modified adhesion-promoting functional group is 1:(3-10); the click reaction is carried out in the dark at a temperature of 20-30°C for 10-20 hours; and the click reaction is catalyzed by ascorbic acid and a divalent copper catalyst, wherein the divalent copper catalyst is a Cu(II)-TBTA complex. The specific steps are as follows: the azide-modified DNA (N3-CTACAAAAAGAG AACCTGGGTACGATGCCCAGGTTC) and the alkynyl-modified RGD polypeptide (FITC-RGD-propargylglycine) are respectively dissolved in PBS buffer to prepare 200 μM DNA stock solution and 400 μM FITC-RGD polypeptide stock solution; ascorbic acid is dissolved in water to prepare a 10 mM stock solution; 200 μL of DNA stock solution, 400 μL of RGD stock solution, 200 μL of DMSO, 200 μL of Cu(II)-TBTA complex (10 mM) and 200 μL of ascorbic acid are mixed in a 1.5 mL centrifuge tube, incubated in the dark at room temperature for 12 hours, separated and purified by denaturing polyacrylamide gel electrophoresis to obtain the H1 chain modified with FITC-RGD, and finally quantified using a UV spectrophotometer.

[0021] The mesenchymal stem cells modified with nucleic acid nanomaterials prepared by the above method are used for wound repair, which can enhance the anti-oxidative stress ability of mesenchymal stem cells, improve the adhesion ability and angiogenesis-promoting ability of mesenchymal stem cells, better improve the inflammatory response at the wound site, promote wound repair, and can be used to prepare / serve as wound repair drugs.

[0022] Compared with the prior art, the technical effects created by the present invention are embodied in:

[0023] (1) The present invention uses nucleic acid nanotechnology to modify a DNA structure containing a hybridization chain reaction initiator chain on mesenchymal stem cells, and through the hybridization chain reaction, a large number of adhesion-promoting functional groups and angiogenesis-promoting functional groups are modified onto the mesenchymal stem cells to obtain nucleic acid nanomaterial-modified mesenchymal stem cells. Modification with nucleic acid nanomaterials can improve the anti-oxidative stress ability of mesenchymal stem cells; the adhesion-promoting functional groups can improve the adhesion ability of mesenchymal stem cells; and the angiogenesis-promoting groups can promote angiogenesis at the wound site, making mesenchymal stem cells better suitable for wound repair.

[0024] (2) The nucleic acid nanomaterial-modified mesenchymal stem cells described in the present invention can enhance the cellular level of mesenchymal stem cells' ability to resist oxidative stress, significantly improve cell viability, and promote the adhesion of mesenchymal stem cells to umbilical vein endothelial cells, thereby enhancing the repair capacity and cell viability of umbilical vein endothelial cells. At the in vivo level, the invention can increase the engraftment rate of mesenchymal stem cells in wounds, promote angiogenesis in wounds, and accelerate wound repair.

[0025] (3) The nucleic acid material used in this application is different from the current nucleic acid material. The current nucleic acid material preparation method is relatively complicated and the required raw materials are expensive; the nucleic acid material preparation method used in this application is simple, low-cost, short in operation time, and has good results. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 Schematic diagram of mesenchymal stem cells modified with the nucleic acid nanomaterials of the present invention.

[0027] Figure 2 This is a confocal microscopy characterization image of mesenchymal stem cells modified with the nucleic acid nanomaterial of the present invention in Example 1.

[0028] Figure 3 This is a characterization diagram of the Y-shaped DNA structure of the present invention and the Y-shaped DNA structure modified with multiple functional groups based on hybridization chain reaction using agarose gel electrophoresis in Experiment 1.

[0029] Figure 4 This is a diagram analyzing the anti-oxidative stress effects of the mesenchymal stem cells modified with the nucleic acid nanomaterials of the present invention and their control group using the CCK8 colorimetric assay in Experiment 2.

[0030] Figure 5 This is a graph analyzing the adhesion effect of the nucleic acid nanomaterial-modified mesenchymal stem cells and their control group on human umbilical vein endothelial cells in Experiment 3 using a fluorescence microscope.

[0031] Figure 6 This is a picture of the scratch repair of umbilical vein cells by the nucleic acid nanomaterial of the present invention and its control group using a fluorescence microscope in Experiment 4.

[0032] Figure 7 This is a diagram analyzing the growth-promoting effects of the nucleic acid nanomaterials of the present invention and their control group on umbilical vein cells using the CCK8 colorimetric assay in Experiment 5. DETAILED DESCRIPTION

[0033] The technical solution of the present invention is further defined below in conjunction with specific implementation methods, but the scope of protection required is not limited to the description.

[0034] Unless otherwise defined, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which this application pertains. The terms used herein in the specification of this application are intended solely for the purpose of describing specific embodiments and are not intended to limit this application. The reagents and instruments used herein are commercially available, and the characterization methods involved can be found in the relevant descriptions in the prior art and will not be further elaborated herein.

[0035] The experimental raw materials used in the examples are as follows:

[0036] Table 1 Experimental raw materials used in the examples

[0037]

[0038]

[0039] The buffer solution in the above raw materials was homemade, and the specific components were purchased from Sigma-Aldrich Company in the United States.

[0040] The experimental instruments used in the examples are as follows:

[0041] Table 2 Experimental instruments used in the examples

[0042]

[0043] The following examples are merely exemplary methods for preparing mesenchymal stem cells modified with nucleic acid nanomaterials, wherein the DNA sequences comprising the hybridization chain reaction initiator chain Ya chain, cholesterol-modified Yb chain, cholesterol-modified Yc chain, azide-modified DNA, H1 chain, and H2 chain include, but are not limited to, the sequences given in Example 1, and may also be other DNA sequences that satisfy the principle of complementary base pairing.

[0044] Example 1

[0045] This embodiment provides a nucleic acid nanomaterial-modified mesenchymal stem cell, wherein the nucleic acid nanomaterial-modified mesenchymal stem cell is prepared by the following preparation method:

[0046] (1) Preparation of DNA-RGD (H1 chain):

[0047] The DNA-RGD (H1 chain) was obtained through a click reaction, wherein the 5' end of the DNA was modified with an azide, i.e., N3-CTACAAAAAGAGAACCTGGGTACGATGCCCAGGTT C; the end of the FITC-RGD polypeptide was modified with an alkynyl group, i.e., FITC-RGD-propargylglycine, and the two reacted under the catalysis of ascorbic acid and a divalent copper catalyst Cu(II)-TBTA complex;

[0048] The specific steps are as follows: azide-modified DNA (N3-CTACAAAAAGAGAACCTGGGTACGATGCCCAGGTTC) and alkynyl-modified RGD peptide (FITC-RGD-propargylglycine) are dissolved in PBS buffer to prepare 200 μM DNA stock solution and 400 μM FITC-RGD peptide stock solution; ascorbic acid is dissolved in water to prepare 10 mM stock solution; 200 μL of DNA stock solution, 400 μL of RGD stock solution, 200 μL of DMSO, 200 μL of Cu(II)-TBTA complex (10 mM) and 200 μL of ascorbic acid are mixed in a 1.5 mL centrifuge tube, incubated in the dark at room temperature for 12 h, separated and purified by denaturing polyacrylamide gel electrophoresis to obtain H1 chain modified with FITC-RGD, and finally quantified using a UV spectrophotometer;

[0049] (2) Self-assembly of Y-shaped DNA structure (5 μM, 100 μL Y-shaped DNA structure was assembled):

[0050] Before assembly, the Ya chain containing the priming sequence (TGGACCGATAACAAATGTACATAACAATAGTACCTGAGCTACT ACGATGCCCAGGTTC), the Yb chain modified with cholesterol at the 3' end (CTCAGGTACT ATTGTTATGATCTTCTATTGTACAGCCTCTAC-Chol), and the Yc chain modified with cholesterol at the 3' end (AGGCTGTACAATAGAAGATTACATTTGTTATC GGTCCA CTAC-Chol) were dissolved in water, and the concentration of each DNA chain was adjusted to 100 μM. This example takes the assembly of 5 μM, 100 μL Y-shaped DNA structure as an example: in a 200 μL PCR tube, the Ya chain, Yb chain, and Yc chain were mixed in a ratio of 1:1:1, and 10×TAE / MgCl2 was added to the mixture. 2+ and deionized water to make the final concentration of each DNA chain 5μM, the final volume 100μL, and the system in 1×TAE / Mg 2+ In a PCR instrument, the mixed solution is slowly annealed and cooled from 95°C to 20°C, and the entire cooling process is controlled to be more than 8 hours, thereby obtaining a Y-shaped DNA structure;

[0051] (3) Verification of hybridization chain reaction:

[0052] To the Y-shaped DNA structure obtained in step (2), a 10-fold molar excess of H1 chain (i.e., FITC-RGD-CTACAAAAAGAGAACCTGGGTACGATGCC CAGGTTC) and H2 chain modified with Apt02 (i.e., CCCAGGTTCTCTTTTTGA ACCTGGGCATCGTACTACGCTGATAGGATGGGTTGTAGGTCTAG GGGGGGGCC) were added, and then the mixture was stirred for 2 h by adding water and 10×TAE / MgCl2. 2+ The final volume was adjusted to 100 μL, and the mixture was incubated at a constant temperature of 30°C for 6 h to complete the hybridization chain reaction and obtain a Y-shaped DNA structure modified with multiple functional groups;

[0053] (4) Modification of Y-shaped DNA structure on mesenchymal stem cells:

[0054] Take 10 6 Adipose-derived mesenchymal stem cells were cultured in 100 μL of DMEM / F12 medium (supplemented with 5 mM Mg 2+ ) to obtain a cell suspension of mesenchymal stem cells, add 10 μL of the Y-shaped DNA structure obtained in step (2) to the above-mentioned mesenchymal stem cell suspension, mix well, place on a shaker at 200r, 37°C, and incubate for 10 minutes. Then, take 900 μL of DMEM / F12 culture medium (supplemented with 5mM Mg 2+ ) was added to the cell suspension, centrifuged at 1000 r for 3 min, the supernatant was aspirated, and the washing was repeated twice to obtain mesenchymal stem cells modified with the Y-shaped DNA structure;

[0055] (5) Chain hybridization reaction on mesenchymal stem cells:

[0056] The H1 chain (i.e., FITC-RGD-CTACAAAAAGAGAACCTGGGTACGA TGCCCAGGTTC) and the H2 chain modified with Apt02 (i.e., CCCAGGTTCTC TTTTTGAACCTGGGCATCGTACTACGCTGATAGGATGGGTTGTAGGTCTAGGGGGGGGCC) were cultured in DMEM / F12 medium (supplemented with 5 mM Mg 2+ ) was diluted to 10 μM, incubated at 95°C for 5 min, and after annealing, added to the mesenchymal stem cells modified with the Y-shaped DNA structure in step (2) at a ratio of 1:1, so that the final concentration of the H1 chain and the H2 chain was 5 μM. The above cell suspension was incubated at 200r and 37°C on a shaker for 2.5h. After that, 900 μL of DMEM / F12 medium (supplemented with 5mM Mg 2+) were added to the cell suspension, centrifuged at 1000 r for 3 min, the supernatant was aspirated, and the washing was repeated twice to obtain mesenchymal stem cells modified with nucleic acid nanomaterials with a large amount of RGD and Apt02.

[0057] in, Figure 1 Schematic diagram of the structure of mesenchymal stem cells modified with nucleic acid nanomaterials according to the present invention, Figure 1 , which shows a schematic diagram of the mesenchymal stem cells modified with the nucleic acid nanomaterial, wherein the mesenchymal stem cells modified with the nucleic acid nanomaterial are modified with a large number of adhesion-promoting functional groups RGD and angiogenesis-promoting functional groups Apt02.

[0058] in, Figure 2 The confocal microscopy characterization of the mesenchymal stem cells modified with nucleic acid nanomaterials prepared in Example 1 was performed as follows: the mesenchymal stem cells modified with nucleic acid nanomaterials were incubated with orange cell membrane tracking dye for 10 min, 900 μL of DMEM / F12 medium (supplemented with 5 mM Mg 2+ ), centrifuged at 1000 r for 3 min, aspirated the supernatant, repeated twice to complete the washing, and resuspended the cells in 2 mL of DMEM / F12 medium (supplemented with 5 mM Mg 2+ ), dropped into confocal dish, and cells were characterized by confocal fluorescence microscopy. Figure 2 As shown, the surface of the mesenchymal stem cell membrane has green fluorescence, indicating that the green fluorescent-labeled FITC-RGD and the orange membrane dye are well co-localized.

[0059] Example 2

[0060] This embodiment provides mesenchymal stem cells modified with nucleic acid nanomaterials. The only difference from Example 1 is that adipose-derived mesenchymal stem cells are replaced with bone marrow-derived mesenchymal stem cells. The other components, preparation methods, and reaction conditions are the same as those in Example 1, thereby producing mesenchymal stem cells modified with nucleic acid nanomaterials.

[0061] Example 3

[0062] This embodiment provides mesenchymal stem cells modified with nucleic acid nanomaterials. The only difference from Example 1 is that adipose-derived mesenchymal stem cells are replaced with umbilical cord blood-derived mesenchymal stem cells. The other components, preparation methods, and reaction conditions are the same as those in Example 1, thereby producing mesenchymal stem cells modified with nucleic acid nanomaterials.

[0063] Example 4

[0064] This embodiment provides mesenchymal stem cells modified with nucleic acid nanomaterials. The only difference from Example 1 is that the RGD polypeptide is replaced with the cRGD five-membered cyclic peptide. Other than that, the other raw materials, preparation method, and reaction conditions are the same as those in Example 1, thereby producing mesenchymal stem cells modified with nucleic acid nanomaterials.

[0065] Example 5

[0066] This embodiment provides mesenchymal stem cells modified with nucleic acid nanomaterials. The only difference from Example 1 is that the Apt02 nucleic acid aptamer is replaced with the Apt01 nucleic acid aptamer. The other components, preparation methods, and reaction conditions are the same as those in Example 1, thereby producing mesenchymal stem cells modified with nucleic acid nanomaterials.

[0067] Experiment 1

[0068] Verification of the hybridization chain reaction of Y-shaped DNA structure

[0069] Test samples: the Y-shaped DNA structure provided in Example 1 and the Y-shaped DNA structure modified with multiple functional groups;

[0070] Test method: Prepare 2% agarose gel (gel containing 5mM Mg 2+ ), place the gel in 1×TBE (containing 5 mM Mg 2 + ) buffer, and different lanes were loaded with 1 μM, 10 μL: 1: 1000bp DNA marker, 2: Ya chain, 3: Yb chain, 4: Yc chain, 5: Y-shaped DNA structure, 6: H1 chain, 7: H2 chain, 8: mixture of H1 chain and H2 chain, 9: Y-shaped DNA structure modified with multiple functional groups. Electrophoresis was performed at 90 V for 50 min and imaging was performed on a gel imager.

[0071] The results are as follows Figure 3 As shown, the band of the Y-shaped DNA structure lags behind the Ya chain, Yb chain and Yc chain significantly, and there are no mixed bands. The Y-shaped DNA structure modified with multiple functional groups has a typical tailing band due to the hybridization chain reaction. The mixed lane of the H1 chain and the H2 chain has no tailing band, which proves the successful assembly of the Y-shaped DNA structure and the successful chain hybridization reaction.

[0072] Experiment 2

[0073] Test sample: Mesenchymal stem cells modified with the Y-shaped DNA structure and nucleic acid nanomaterials provided in Example 1

[0074] Mesenchymal stem cells, mesenchymal stem cells modified with Y-shaped DNA structures, and mesenchymal stem cells modified with nucleic acid nanomaterials were seeded at 5,000 cells / well in 96-well plates and cultured for 2 hours to allow adherence. Hydrogen peroxide was added to a final concentration of 400 μM and incubated for 4 hours. Cell viability was assessed using a CCK-8 cell proliferation and activity assay.

[0075] The specific test results are shown in Table 3 below:

[0076] Table 3

[0077]

[0078] As shown in Table 3, after hydrogen peroxide stimulation, the cell activity of mesenchymal stem cells and mesenchymal stem cells modified with nucleic acid nanomaterials was 149.6%, which was 49.6% higher than the cell activity of mesenchymal stem cells (100.0%). Figure 4 As shown, the cell viability of the mesenchymal stem cells modified with the nucleic acid nanomaterial obtained by the chain hybridization reaction of the present invention is significantly increased after stimulation with hydrogen peroxide, indicating that the anti-oxidative stress ability of the mesenchymal stem cells modified with the nucleic acid nanomaterial of the present invention is increased.

[0079] Experiment 3

[0080] Nucleic acid nanomaterials modified mesenchymal stem cells have increased adhesion ability

[0081] Test samples: mesenchymal stem cells modified with the Y-shaped DNA structure and mesenchymal stem cells modified with nucleic acid nanomaterials provided in Example 1;

[0082] Test method: Human umbilical vein endothelial cells were cultured in endothelial cell culture medium at 37°C and 5% CO2. When the cell growth density reached 90%, the cells were digested with trypsin and seeded in 12-well plates at 10,000 cells / well for 24 hours. 5 The cell suspensions of mesenchymal stem cells, mesenchymal stem cells modified with Y-shaped DNA structures, and mesenchymal stem cells modified with nucleic acid nanomaterials were stained with CFDA SE cell proliferation tracer fluorescent probe, and then 900 μL of DMEM / F12 medium (supplemented with 5 mM Mg 2+ ), centrifuged at 1000 r for 3 min, aspirated the supernatant, repeated twice to complete the washing, and resuspended in endothelial cell culture medium (containing 5 mM Mg 2+) and added to the 12-well plate with human umbilical vein endothelial cells mentioned above, and allowed to stand in a cell culture incubator for 1.5 hours. The plates were washed three times with PBS and imaged under an inverted fluorescence microscope to compare the adsorption abilities of mesenchymal stem cells, mesenchymal stem cells modified with Y-shaped DNA structures, and mesenchymal stem cells modified with nucleic acid nanomaterials on the surface of human umbilical vein endothelial cells.

[0083] The results are as follows Figure 5 As shown in the results of fluorescence microscopy imaging, the number of mesenchymal stem cells modified with nucleic acid nanomaterials adhering to human umbilical vein endothelial cells was significantly greater than the number of mesenchymal stem cells modified with Y-shaped DNA structure and mesenchymal stem cells adhering to human umbilical vein endothelial cells, indicating that the mesenchymal stem cells modified with nucleic acid nanomaterials of the present invention have stronger cell adhesion ability.

[0084] Experiment 4

[0085] Nucleic acid nanomaterials can accelerate the repair of human umbilical vein endothelial cells

[0086] Test samples: the Y-shaped DNA structure provided in Example 1 and the Y-shaped DNA structure modified with multiple functional groups;

[0087] Test method: Human umbilical vein endothelial cells were cultured in culture medium at 37°C and 5% CO2. When the cell growth density reached 90%, the cells were digested with trypsin and seeded into 12-well plates at 100,000 cells / well. The plates were cultured until the growth density exceeded 90%. The plate was scratched in the middle with a yellow pipette tip, and the plate was gently rinsed three times with endothelial cell culture medium. Endothelial cell culture medium (containing 5mM Mg) was added. 2+ ), 100nM Y-shaped DNA structure and 100nM Y-shaped DNA structure modified with multiple functional groups were imaged at 0h and 24h to compare the scratch repair speed;

[0088] The results are as follows Figure 6 As shown, by comparing the scratch repair rates of umbilical vein endothelial cells in different groups, it can be concluded that the Y-shaped DNA structure modified with multiple functional groups according to the present invention can accelerate the repair rate of umbilical vein endothelial cells, indicating that the Y-shaped DNA structure modified with multiple functional groups according to the present invention can promote endothelial cell repair at the cellular level.

[0089] Experiment 5

[0090] Nucleic acid nanomaterials can enhance the cell viability of human umbilical vein endothelial cells

[0091] Test sample: the Y-shaped DNA structure modified with multiple functional groups provided in Example 1.

[0092] Test method: Human umbilical vein endothelial cells were cultured in endothelial cell culture medium at 37°C and 5% CO2. When the cell growth density reached 90%, the cells were digested with trypsin and seeded in 96-well plates at 3000 cells / well. After culture for 24 hours, endothelial cell culture medium (containing 5mM Mg 2+ ) as a blank control group, 25 nM, 50 nM, 100 nM and 200 nM of a Y-shaped DNA structure modified with multiple functional groups were cultured for 24 h, and cell viability was detected using a CCK-8 cell proliferation and activity assay kit;

[0093] The specific test results are shown in Table 4 below:

[0094] Table 4

[0095]

[0096] As shown in Table 4, after 24 hours, as the concentration of the added Y-shaped DNA structure modified with multiple functional groups increased, the cell viability increased, indicating that the Y-shaped DNA structure modified with multiple functional groups according to the present invention can improve the cell viability of human umbilical vein endothelial cells.

[0097] Finally, it should be noted that the above embodiments are merely representative examples of the present invention. Obviously, the technical solutions of the present invention are not limited to the above embodiments and are subject to numerous variations. All variations that can be directly derived or conceived by a person of ordinary skill in the art from the disclosure of the present invention should be considered within the scope of protection of the present invention.

Claims

1. A method for preparing mesenchymal stem cells modified with nucleic acid nanomaterials, characterized in that: The specific steps include: (1) Through hydrophobic interactions, a cholesterol-modified DNA structure is assembled onto the cell membrane of mesenchymal stem cells to obtain DNA-modified mesenchymal stem cells; (2) Through a hybridization chain reaction, the H1 DNA chain modified with the adhesion-promoting functional group and the H2 DNA chain modified with the angiogenesis-promoting functional group are assembled into the mesenchymal stem cells modified with the DNA structure obtained in step (1), thereby obtaining nucleic acid nanomaterial-modified mesenchymal stem cells.

2. The preparation method according to claim 1, characterized in that The step (1) specifically comprises taking mesenchymal stem cells in a culture medium to obtain a cell suspension of mesenchymal stem cells, adding the cholesterol-modified DNA structure to the above-mentioned mesenchymal stem cell suspension, mixing evenly, and incubating; then, taking the culture medium and adding it to the cell suspension, centrifuging, aspirating the supernatant, and repeating the washing twice to obtain mesenchymal stem cells modified with the cholesterol-modified DNA structure.

3. The preparation method according to claim 1, characterized in that Specifically, the step (2) comprises diluting the H1 chain with a culture medium, incubating, annealing, and then adding the H1 chain to the mesenchymal stem cells modified with a cholesterol-containing DNA structure in step (2). After incubating the cell suspension on a shaker, the culture medium is added to the cell suspension, centrifuging, aspirating the supernatant, and repeating the washing twice to obtain mesenchymal stem cells modified with nucleic acid nanomaterials containing adhesion-promoting functional groups and angiogenesis-promoting functional groups.

4. The preparation method according to claim 1, characterized in that The cholesterol-modified DNA structure is any one or more of a Y-shaped cholesterol-modified DNA structure, a tetrahedral cholesterol-modified DNA structure, and a hexahedral cholesterol-modified DNA structure.

5. The preparation method according to claim 1, characterized in that The adhesion promoting functional group is RGD tripeptide or c(RGDfK) five-membered cyclic peptide.

6. The preparation method according to claim 1, characterized in that The angiogenesis-promoting functional group is VEGFR nucleic acid aptamer Apt01 or Apt02.

7. The preparation method according to claim 1, characterized in that The cholesterol-modified DNA structure is prepared by the following method: mixing a Ya DNA chain containing a hybridization chain reaction initiator chain, a cholesterol-modified Yb DNA chain, and a cholesterol-modified Yc DNA chain in a buffer solution, and annealing to obtain the DNA structure.

8. The preparation method according to claim 1, characterized in that The H1 DNA is prepared by the following method: azide-modified DNA and an alkyne-modified adhesion-promoting functional group are subjected to a click reaction to obtain the H1 DNA modified with the adhesion-promoting functional group.

9. Mesenchymal stem cells modified with nucleic acid nanomaterials prepared by the preparation method according to claim 1.

10. Use of mesenchymal stem cells modified with nucleic acid nanomaterials prepared by the preparation method of claim 1 in the preparation of / as wound repair drugs.

Images