Annular functional nucleic acid as well as preparation method and application thereof
By preparing circular functional nucleic acids and combining DNA template assembly with enzymatic coupling technology, the problems of targeting and stability of functional nucleic acids in tumor treatment are solved, precise targeting and long-term circulation of malignant tumors are achieved, and the treatment effect is improved.
Patent Information
- Application Number
- CN202410883579.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-07-03
- Publication Date
- 2025-09-23
AI Technical Summary
Existing functional nucleic acids face problems of targeting, stability and long-term circulation in tumor treatment, especially in the treatment of malignant tumors such as pancreatic cancer, where it is difficult to achieve precise targeting and long-term circulation.
A DNA template assembly combined with enzymatic coupling method is used to prepare circular functional nucleic acids. Functional drugs are coupled to the short chains outside the circular nucleic acids to form multivalent functional nucleic acids, and the o-FLARE platform is constructed to achieve improved targeting and stability.
It significantly improves the targeting and stability of nucleic acid drugs, enhances their affinity for tumor cells and drug enrichment ability, prolongs their circulation time in the blood, and promotes multi-target targeting and immune activation.
Smart Images

Figure CN120678942A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to a circular functional nucleic acid and a preparation method and application thereof. Background Art
[0002] Malignant tumors are characterized by high heterogeneity and dynamic changes. Many tumor treatments face therapeutic bottlenecks such as escape, drug resistance, metastasis, and recurrence. Pancreatic cancer, for example, exhibits typical "cold tumor" characteristics due to its high frequency of KRAS mutations, poor immunogenicity, high immunosuppression, and highly fibrotic tumor microenvironment, making precise targeting difficult.
[0003] Targeted therapy is the main means of treating malignant tumors, and nucleic acid drugs (also known as functional nucleic acids) have great potential in tumor targeted therapy. Among them, nucleic acid aptamers improve the targeted enrichment of chemotherapy drugs due to their high affinity and high specificity in recognizing specific target molecules. In addition to targeted recognition, most other functional nucleic acid drugs (ASO, CpG, etc.) can regulate mRNA stability and transcription, thereby regulating the expression of target genes. However, functional nucleic acids have always faced bottlenecks such as easy degradation, short blood circulation, and difficulty in extrahepatic targeting. Therefore, there is an urgent need to find a functional nucleic acid that can achieve stable performance, efficient delivery and precise targeting to solve the problems of targeting, stability and long-term circulation of functional nucleic acids.
[0004] Circular nucleic acids, a class of closed-end circular nucleic acid molecules, are abundant in nature and possess a stable structure and excellent resistance to enzymatic cleavage. Modifying nucleic acid drugs based on circular nucleic acid structures may offer solutions to challenges faced in their application. However, limited synthetic methods and application demands in the field of circular nucleic acids mean that current research on their applications remains in its infancy, posing significant challenges to this area.
[0005] CN116790608A provides a circular aptamer, which is prepared by cyclizing a conventional linear aptamer. It is believed that circular aptamers can improve stability and have important significance for cancer treatment. However, directly cyclizing a linear aptamer changes its spatial structure, which is bound to have a certain adverse effect on the functionality of the aptamer.
[0006] Based on the application research needs in the field of functional nucleic acids and the current research status in the field of circular nucleic acids, it is urgent to find a more reasonable and efficient solution. It is hoped that the characteristics of functional nucleic acids can be combined with those of circular nucleic acids to achieve low-cost and efficient synthesis, solve the targeting, stability and long-term circulation problems of functional nucleic acids, and improve the therapeutic effect. Summary of the Invention
[0007] To solve the above problems, the present invention provides a circular functional nucleic acid and its preparation method and application. Functional nucleic acid is combined with circular nucleic acid, and a DNA template assembly method is used in combination with enzymatic coupling. Single-stranded circular nucleic acid is first prepared, and the corresponding outer short chain is synthesized. Functional nucleic acid drugs are coupled to the outer short chain. The screening reaction conditions are optimized to obtain a circular functional nucleic acid with adjustable size and adjustable valence (multivalent or multiple), strong stability, and the ability to chemically couple drugs or drug chimeras. This creates a new circular multivalent functional nucleic acid technology that can significantly improve the targeting and stability of nucleic acid drugs, and constructs o-FLARE, a nucleic acid drug development platform with efficient targeting, immune stimulation, and protein degradation functions.
[0008] This invention has developed a novel circular functional nucleic acid and circular functional nucleic acid-coupled drug technology, o-FLARE. This technology precisely assembles and couples multiple functional nucleic acids, enabling simultaneous coupling with small molecule drugs, antibodies, nanobodies, single-chain antibodies, peptides, and other functional groups. This technology creates a targeted nucleic acid drug with stable structure, codable components, and long-term blood circulation, addressing the issues of targeting, stability, and long-term circulation of nucleic acid drugs. The innovative o-FLARE technology disclosed in this invention will promote the development of targeted functional nucleic acid drugs and the deep integration of mRNA, gene editing, and tumor treatment.
[0009] In one aspect, the present invention provides a circular functional nucleic acid, comprising a circular nucleic acid and a functional conjugate, wherein the functional conjugate is connected to the circular nucleic acid, and the functional conjugate comprises one or more of a nucleic acid, a drug, and a nucleic acid-drug complex.
[0010] Furthermore, the nucleic acid in the circular nucleic acid includes any one or more of DNA, RNA, microRNA, siRNA, shRNA, mRNA, microRNA, siRNA, shRNA, and lncRNA.
[0011] Furthermore, the circular nucleic acid is a double-stranded circular nucleic acid, comprising an inner circular single strand and an outer complementary short strand; the sequence and number of the outer complementary short strand are designed to match the sequence and length of the inner circular single strand.
[0012] It can be understood that the inner side of the circular nucleic acid is a complete single-stranded closed loop, while the outer side is composed of multiple short chains that are complementary to the single-stranded closed loop. The length of the outer complementary short chains can be designed according to product needs, but the key is that each outer complementary short chain is combined together to be able to fully complement the inner circular single chain, thereby completely forming a double-stranded circular nucleic acid.
[0013] Furthermore, the functional conjugate is connected to the outer complementary short chain of the double-stranded circular nucleic acid; and the number of the functional conjugate is 1 or more.
[0014] In some methods, the functional conjugate is connected to the outer complementary short chain, which is equivalent to replacing certain bases on the original outer complementary short chain with the functional conjugate, so that when the outer complementary short chain is combined with the inner circular single chain, the functional conjugate is also combined to form a circular functional nucleic acid.
[0015] Furthermore, when the functional conjugate is a nucleic acid aptamer, the number of the functional conjugate is preferably 3-6, and they are evenly distributed on the outer complementary short strands of the double-stranded circular nucleic acid.
[0016] In some embodiments, the number of functional conjugates corresponds to the valency, and the number of functional conjugates of 3 or 6 corresponds to a trivalent circular functional nucleic acid or a hexavalent circular functional nucleic acid.
[0017] The functional regions of circular functional nucleic acids need to be free and independently functional when they are working. This means that the individual efficacy of each functional conjugate must be guaranteed, and the appropriate valence can help each functional conjugate function freely. Studies have shown that trivalent and hexavalent circular multivalent nucleic acid aptamers exhibit better targeting and absorption capabilities. This may be because each nucleic acid aptamer in the trivalent and hexavalent circular multivalent nucleic acid aptamers can more effectively function freely, while also collaborating with each other to promote enhanced effects.
[0018] Furthermore, when the functional conjugate is an ASO-aptamer complex, the number of the functional conjugates is preferably 4 (equivalent to a bivalent ASO, a bivalent aptamer), which are evenly distributed on the outer complementary short strands of the double-stranded circular nucleic acid.
[0019] For different functional conjugates, the spatial structure of the constructed circular functional nucleic acid is different, and the impact on the functional conjugate is also different. When targeting the ASO-nucleic acid aptamer complex, the tetravalent circular ASO (equivalent to the divalent ASO, divalent nucleic acid aptamer) is more conducive to improving the targeting ability and absorption capacity.
[0020] Furthermore, the nucleic acid of the inner circular single chain, the outer complementary short chain or the functional conjugate may be modified, and the modification includes one or more of phosphate backbone modification, base modification, nucleotide modification, enzyme modification, methylation modification and phosphorylation modification.
[0021] In the functional nucleic acid prepared by the present invention, a functional conjugate is connected to a circular nucleic acid, and multiple functional conjugates can be connected to the outer chain of the circular nucleic acid, thereby producing a circular multivalent functional nucleic acid. The circular multivalent functional nucleic acid can produce different circular multivalent functional nucleic acids depending on the different functional conjugates thereof. Circular nucleic acids include circular RNA, single-stranded circular DNA, double-stranded circular DNA, etc. Circular nucleic acids can be connected to functional conjugates to produce various circular multivalent functional nucleic acids.
[0022] In some embodiments, the present invention provides a circular multivalent nucleic acid aptamer, comprising a circular nucleic acid and a nucleic acid aptamer, wherein the nucleic acid aptamer is linked to the circular nucleic acid.
[0023] In some embodiments, the present invention provides a circular multivalent aptamer-drug complex, comprising a circular nucleic acid and a aptamer-drug complex, wherein the aptamer-drug complex is linked to the circular nucleic acid.
[0024] In some embodiments, the present invention provides a circular multivalent aptamer-antibody complex, comprising a circular nucleic acid and an aptamer-drug complex, wherein the aptamer-drug complex is linked to the circular nucleic acid.
[0025] In some embodiments, the present invention provides a circular multivalent aptamer-polypeptide complex comprising a circular nucleic acid and an aptamer-drug complex, wherein the aptamer-drug complex is linked to the circular nucleic acid.
[0026] In some embodiments, the present invention provides a circular multivalent antisense functional nucleic acid, comprising a circular nucleic acid and an antisense functional nucleic acid, wherein the antisense functional nucleic acid is connected to the circular nucleic acid.
[0027] In some aspects, the present invention provides a circular multivalent CpG oligonucleotide comprising a circular nucleic acid and a CpG oligonucleotide, wherein the CpG oligonucleotide is linked to the circular nucleic acid.
[0028] In another aspect, the present invention provides a method for preparing a circular functional nucleic acid, the method comprising the following steps:
[0029] (1) Synthesis of inner circular single chain;
[0030] (2) synthesizing an outer complementary short chain, to which a functional conjugate is connected; the functional conjugate comprises one or more of a nucleic acid, a drug, or a complex of a nucleic acid and a drug.
[0031] (3) The inner circular single strand reacts with the outer complementary short strand to synthesize circular functional nucleic acid.
[0032] The present invention designs an ingenious preparation method for the preparation of circular functional nucleic acids, which utilizes DNA template assembly combined with enzymatic coupling to achieve a simple and efficient preparation method.
[0033] Furthermore, the method for synthesizing the inner circular single strand in step (1) comprises: separately synthesizing a linear single strand and a splint DNA, ligating the linear single strand and the splint DNA to form a closed loop structure, and cutting off the splint DNA on the closed loop structure to obtain the inner circular single strand; the sequence of the splint DNA is completely complementary to the 10 to 30 base sequences on both sides of the 5' and 3' ends of the linear single strand.
[0034] Furthermore, the linear single strand includes a nucleotide sequence as shown in any one or more of SEQ ID NOs. 1 to 4 in the sequence listing; and the splint DNA includes a nucleotide sequence as shown in SEQ ID NO. 5 in the sequence listing.
[0035] In some embodiments, the method for synthesizing the inner circular single chain in step (1) includes:
[0036] 1) React the linear single-stranded DNA with the splint DNA. Add the linear single-stranded DNA, splint DNA, and T4 ligase buffer to PBS and perform the reaction on a PCR instrument at 80°C-95°C for 0-1 hour. Then gradually decrease the temperature to 4°C-16°C within 1-3 hours.
[0037] 2) Add T4 nucleic acid ligase to the reaction solution of step 1) and react for 1-48 hours;
[0038] 3) Verify the formation of a closed-loop structure by urea denaturing gel, terminate the reaction, and then add exonuclease to the reaction solution and react at 37°C for about 1-4 hours to cut off the splint DNA;
[0039] 4) Extracting the reaction solution from step 3) with DNA extraction solution at a volume ratio of (1-3):1, removing the enzyme from the reaction solution, collecting the supernatant, adding ammonium acetate and anhydrous ethanol, cold precipitating, centrifuging, removing the supernatant, and re-dissolving the precipitate in PBS or water;
[0040] 5) Select an appropriate ultrafiltration tube according to the size of the circular DNA molecule for ultrafiltration purification to obtain the final circular single-stranded DNA.
[0041] In some embodiments, the linear single strand in step 1) is any one of ssl60 (SEQ ID NO.1), ssl80 (SEQ ID NO.2), ssl100 (SEQ ID NO.3), and ssl120 (SEQ ID NO.4); the molar ratio of the linear single strand to the splintDNA substance is 1:2; and the T4 ligase buffer consists of 366 mM Tris-HCl (pH 7.6), 6.6 mM MgCl2, 10 mM DTT, and 0.1 mM ATP.
[0042] In some embodiments, the amount of T4 nucleic acid ligase added in step 2) is 15-20 U / μL.
[0043] In some embodiments, the amount of exonuclease added in step 3) is 15-20 U / μL.
[0044] In some embodiments, the DNA extraction solution in step 4) comprises phenol:chloroform:isoamyl alcohol = 25:24:1; ammonium acetate pH = 5.2, and a concentration of 3 mM.
[0045] In some embodiments, the ultrafiltration tube in step 5) is 10 kDa or 30 kDa.
[0046] During the synthesis of the inner circular single strand, the 5' and 3' ends of the single-stranded circular nucleic acid are ligated using T4 nucleic acid ligase. In some embodiments, the T4 nucleic acid ligase includes one or more of T4 DNA ligase and T4 RNA ligase.
[0047] It is understandable that the sequences used to construct the inner circular single-stranded DNA and the outer complementary short-chain DNA are not fixed and can be selected as needed. The outer complementary short-chain DNA is equivalent to dividing the inner circular single-stranded DNA into multiple short sequences. A complementary short chain is designed for each short sequence. All the outer complementary short-chain DNAs are combined together to form a complete outer circular chain that can be complementary to the inner circular single-stranded DNA.
[0048] Furthermore, the outer complementary short chain described in step (2) includes any one or more of X-1, X-2, X-3, X-4, X-5, and X-6; X-1 = tctccgttccSagcacatcct, X-2 = ctctgaccagSgtccttcact, X-3 = cacgcgttttStgcagtcctc, X-4 = ggctccttggSgttgcgatct, X-5 = gttggtcagtScgattccggt, X-6 = cgtgttagctSgcagatggca; and S is a functional conjugate.
[0049] Furthermore, during the reaction of the inner circular single chain and the outer complementary short chain in step (3), when the linear single chain used to prepare the inner circular single chain has the nucleotide sequence shown in SEQ ID NO.1, the outer complementary short chain includes X-1, X-3 and X-4; when the linear single chain used to prepare the inner circular single chain has the nucleotide sequence shown in SEQ ID NO.2, the outer complementary short chain includes X-1, X-2, X-3 and X-4; when the linear single chain used to prepare the inner circular single chain has the nucleotide sequence shown in SEQ ID NO.3, the outer complementary short chain includes X-1, X-2, X-3, X-4 and X-5; when the linear single chain used to prepare the inner circular single chain has the nucleotide sequence shown in SEQ ID NO.4, the outer complementary short chain includes X-1, X-2, X-3, X-4, X-5 and X-6.
[0050] This is equivalent to the inner circular single-stranded DNA being any one of ssc60, ssc80, ssc100, and ssc120, ssc60 reacts with chains X-1, 3, and 4, ssc80 reacts with chains X-1, 2, 3, and 4, ssc100 reacts with chains X-1, 2, 3, 4, and 5, and ssc120 reacts with chains X-1, 2, 3, 4, 5, and 6.
[0051] The sequence design of the inner circular single strand and the outer complementary short strand is provided here as an example and is not intended to be limiting. During experimental research, we discovered that this nucleic acid sequence design facilitates the smooth construction of circular functional nucleic acids, preventing issues such as excessive base repetitions that could hinder the construction of circular functional nucleic acids. However, the sequence and length of the inner circular single strand and the outer complementary short strand can be adjusted according to actual needs.
[0052] In some embodiments, the S is a nucleic acid aptamer sequence, such as nucleic acid aptamer SL1, Sgc8c or PD4S, wherein SL1=ATCAGGCTGGATGGTAGCTCGGTCGGGGTGGGTGGGTTGGCAAGTCTGAT (SEQ ID NO.6), sgc8c=ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGA (SEQ ID NO.7), PD4S=CGCACTATGTTTTACGAGCCGTTTCCTCGGCAGATAGTAAGTGC (SEQ ID NO.8), which is used for the preparation of circular multivalent nucleic acid aptamers.
[0053] In some embodiments, the S is a DBCO-modified aptamer (DBCO-aptamer) sequence, such as SL1-DBCO=ATCAGGCTGGATGGT(DBCO)AGCTCGGTCGGGGTGGGTGGGTTGGCAAGTCTGAT, which can be used to prepare a circular multivalent aptamer-drug complex.
[0054] In some embodiments, the S is any one or more ASOs, such as ASO = (MOE-T)*(MOE-G)*(MOE-C)*(MOE-A)*(MOE-C)*(dT)*(dG)*(dT)*(dA)*(dC)*(dT)*(dC)*(dC)*(dT)*(dC)*(MOE-T)*
[0055] (MOE-T)*(MOE-G)*(MOE-A)*(MOE-C) (* represents base thiolation modification) is used for the preparation of cyclic multivalent ASO.
[0056] In some embodiments, the S is any one or more CpGs, such as ODN 1826 = tccatgacgttcctgacgtt (all bases are thio-modified), which is used for the preparation of circular multivalent CpGs.
[0057] In some embodiments, the method for synthesizing a circular functional nucleic acid in step (3) comprises:
[0058] 1) The inner circular single strand reacts with 3-6 DNA strands of the outer complementary short strands X-1, X-2, X-3, X-4, X-5, and X-6. The reaction strands are added to PBS with T4 ligase buffer and the reaction is carried out on a PCR instrument at 95°C for 5 min, followed by a gradient cooling to 4°C.
[0059] 2) Add T4 ligase to the reaction solution and react at 16°C for 3-4 hours;
[0060] 3) Add exonuclease to the reaction solution and react at 37°C for 2 hours;
[0061] 4) extraction and precipitation;
[0062] 5) Redissolve and ultrafilter to obtain the final circular double-stranded DNA.
[0063] Furthermore, when the functional conjugate is a nucleic acid-drug complex, its preparation process also includes the preparation of an outer complementary short chain X-R1-R3-R2-Y, wherein X is a nucleic acid with a complementary short chain, R1 is a modifying group of X, R3 is a connecting group between X and the drug, Y is the drug, and R2 is a modifying group of Y; the method for synthesizing X-R1-R3-R2-Y comprises: reacting with a molar ratio of X-R1 to Y-R2 of 1:(1-10), using PBS buffer, shaking at 500-2000 rpm, reacting overnight, and ultrafiltration to obtain the outer complementary short chain X-R1-R3-R2-Y.
[0064] In some embodiments, the method for synthesizing a circular functional nucleic acid in step (3) includes: reacting the inner circular single strand to the outer complementary short strand in a molar ratio of 1:(1-10), using PBS buffer, shaking on a shaker at 500-2000 rpm, reacting overnight, and ultrafiltration to obtain the final product, a circular functional nucleic acid.
[0065] In some embodiments, the R1 includes a terminal linker containing any one or more of an amino group, a hydroxyl group, a sulfhydryl group, an NHS ester, a carboxyl group, an azide, an alkynyl group, an alkene, a maleimide, a S-tetrazine, DBCO, TCO, and a BCN group; the R2 includes a terminal linker containing any one or more of an amino group, a hydroxyl group, an NHS ester, a carboxyl group, an azide, an alkynyl group, an alkene, a maleimide, a S-tetrazine, DBCO, TCO, and a BCN group; and the R3 includes any one or more coupling groups formed by coupling reactions between the terminal group of R1 and the terminal group of R2.
[0066] It is understandable that the outer complementary short chains used to construct the nucleic acid-drug complex with outer complementary short chains do not have to be consistent with the sequences of X-1 to X-6 described above. The sequences of the inner circular single chain and the outer complementary short chains can be designed according to the sequence of the circular functional nucleic acid-drug complex to be prepared, as long as the construction of the circular functional nucleic acid-drug complex can be completed.
[0067] Furthermore, when the functional conjugate is a nucleic acid-antibody complex or a nucleic acid-polypeptide complex, the preparation method of the circular functional nucleic acid is the same as that of the functional conjugate being a nucleic acid-drug complex, except that the drug therein is replaced with an antibody or polypeptide.
[0068] In another aspect, the present invention provides a method for preparing a circular nucleic acid, comprising the following steps:
[0069] (a) Synthesis of inner circular single chain;
[0070] (b) synthesizing outer complementary short chains;
[0071] (c) The single-stranded circular nucleic acid reacts with the outer complementary short chain to synthesize the circular nucleic acid.
[0072] Furthermore, the method for synthesizing the inner circular single strand in step (a) comprises: separately synthesizing a linear single strand and a splint DNA, ligating the linear single strand and the splint DNA to form a closed loop structure, and cutting off the splint DNA on the closed loop structure to obtain the inner circular single strand; the sequence of the splint DNA is completely complementary to the 10-30 base sequences on both sides of the 5' and 3' ends of the linear single strand.
[0073] Furthermore, the linear single strand is any one of ssl60 (SEQ ID NO.1), ssl80 (SEQ ID NO.2), ssl100 (SEQ ID NO.3), and ssl120 (SEQ ID NO.4); and the splint DNA includes the nucleotide sequence shown in SEQ ID NO.5 of the sequence listing.
[0074] Furthermore, the outer complementary short chain described in step (b) includes any one or more of X-1, X-2, X-3, X-4, X-5, and X-6; wherein X-1=tctccgttccagcacatcct, X-2=ctctgaccaggtccttcact, X-3=cacgcgtttttgcagtcctc, X-4=ggctccttgggttgcgatct, X-5=gttggtcagtcgattccggt, and X-6=cgtgttagctgcagatggca.
[0075] Furthermore, during the reaction of the inner circular single chain with the outer complementary short chain in step (3), ssc60 reacts with chains X-1, 3, and 4, ssc80 reacts with chains X-1, 2, 3, and 4, ssc100 reacts with chains X-1, 2, 3, 4, and 5, and ssc120 reacts with chains X-1, 2, 3, 4, 5, and 6.
[0076] Furthermore, the method for preparing the circular nucleic acid comprises the following steps:
[0077] a) The inner circular single strand reacts with 3-6 DNA strands from X-1, 2, 3, 4, 5, and 6. The reaction strands are added to PBS using T4 ligase buffer and the reaction is performed using a PCR instrument at 95°C for 5 min, followed by a gradient cooling to 4°C.
[0078] b) Add T4 ligase to the reaction solution and react at 16°C for 3-4 hours;
[0079] c) Add exonuclease to the reaction solution and react at 37°C for 2 hours;
[0080] d) extraction and precipitation;
[0081] e) Redissolve and ultrafilter to obtain the final circular double-stranded DNA.
[0082] In another aspect, the present invention provides a method for preparing a circular multivalent nucleic acid aptamer, which adopts the method for preparing a circular functional nucleic acid as described above, wherein the S sequence in the outer complementary short chain is any one or more nucleic acid aptamer sequences.
[0083] In some embodiments, the present invention prepares circular multivalent nucleic acid aptamers of three nucleic acid aptamers, namely SL1 (SEQ ID NO.6), Sgc8c (SEQ ID NO.7), and PD4S (SEQID NO.8), including different valence states of the same nucleic acid aptamer and different valence states of different nucleic acid aptamers.
[0084] In some embodiments, when the outer complementary short chain is X-2, X-4, or X-6, S=sgc8c; when X-1, X-3, or X-5, S=SL1, that is, the hexavalent circular functional nucleic acid contains two nucleic acid aptamers.
[0085] In some embodiments, when the outer complementary short chain is X-2 or X-5, S=sgc8c; when X-1 or X-4, S=SL1; when X-3 or X-6, S=PD4S, that is, the hexavalent circular functional nucleic acid contains three nucleic acid aptamers ( Figure 6 -c)
[0086] On the other hand, the present invention provides a method for preparing a circular multivalent ASO, wherein the outer complementary short chain contains an ASO or a nucleic acid aptamer. The circular multivalent ASO prepared by the present invention includes different valence states of the same ASO, as well as different valence states of different types of ASO; a circular multivalent ASO+aptamer is also prepared, which assists the ASO in entering the cell through the targeting function of the nucleic acid aptamer. The steps are the same as those for preparing a circular double-stranded nucleic acid. When preparing a circular trivalent ASO, ssl120 (SEQ ID NO.4) is required, and the outer complementary short chain is X-1, 3, 5, and the S sequence is absent; the reaction chain is X-2, 4, 6, and S is one or more ASO sequences; when preparing a circular hexavalent ASO+aptamer, the reaction chain is X-1, 3, 5, the outer complementary short chain is SL1, X-2, 4, 6, and S is one or more ASO sequences.
[0087] On the other hand, the present invention provides a method for preparing a circular multivalent CpG, wherein the outer complementary short chain contains any one or more CpGs or nucleic acid aptamers. The circular multivalent CpG prepared by the present invention includes different valences of the same CpG, and different valences of different types of CpG; at the same time, a circular multivalent CpG+aptamer is prepared to assist CpG in entering cells through the targeting function of the nucleic acid aptamer. The steps are the same as those for preparing a circular double-stranded nucleic acid. When preparing a circular trivalent CpG, the reaction chain is X-1, 3, 5, and the S sequence does not exist; X-2, 4, 6, and S is one or more CpG sequences. When preparing a circular multivalent CpG+aptamer, the reaction chain is X-1, 3, 5, and the S sequence is CLN0020 (a nucleic acid aptamer targeting CD16); X-2, 4, 6, and S is one or more CpG sequences.
[0088] In another aspect, the present invention provides a method for preparing a circular multivalent nucleic acid-drug complex, using the aforementioned method for preparing a circular functional nucleic acid, wherein SL1-DBCO is a modified nucleic acid aptamer (where SL1 is a nucleic acid aptamer SL1 with an outer complementary short chain, and DBOC is a modifying group), and N3-Vc-MMAE / diABZI is a drug modified with N3-Vc. The present invention prepares two nucleic acid aptamer-drug complexes, SL1-MMAE and SL1-diABZI, with outer complementary short chains. The method for preparing the circular multivalent nucleic acid-drug complex comprises the following steps:
[0089] 1) Preparation of aptamer-drug complexes with complementary short chains: SL1-DBCO and Vc-MMAE / diABZI were reacted in a 1:2 molar ratio in PBS buffer on an 800 rpm shaker. The reaction was allowed to proceed overnight. After ultrafiltration, the final product, SL1-MMAE / diABZI (SL1 with the DBCO modification group and MMAE / diABZI with the N3-Vc modification group) was obtained.
[0090] 2) The inner circular single strand reacts with SL1-MMAE / diABZI using the same steps as for preparing circular double-stranded nucleic acids;
[0091] 3) Purify by ultrafiltration to obtain the final product.
[0092] In some embodiments, the preparation process of a circular multivalent nucleic acid-drug complex includes preparing an outer complementary short chain X-R1-R3-R2-Y, wherein X is a nucleic acid with a complementary short chain, R1 is a modifying group of X, R3 is a linking group between X and the drug, Y is the drug, and R2 is a modifying group of Y. The method for synthesizing X-R1-R3-R2-Y includes: 1) reacting the complex in a molar ratio of X-R1 to Y-R2 of 1:(1-10) in PBS buffer at 500-2000 rpm on an oscillator, reacting overnight, and ultrafiltration to obtain the outer complementary short chain X-R1-R3-R2-Y.
[0093] 2) The inner circular single strand reacts with X-R1-R3-R2-Y, and the reaction steps are the same as the preparation method of double-stranded circular nucleic acid;
[0094] 3) Purification by ultrafiltration to obtain the final product, a circular multivalent nucleic acid-drug complex.
[0095] The present invention prepares three circular multivalent aptamer-drug complexes, using circular single-stranded ssc120 DNA as the inner circular single strand to synthesize circular hexavalent aptamer-drug complexes, wherein the drugs are MMAE, diABZI, and MMAE+diABZI respectively.
[0096] The structures of the circular nucleic acid, circular functional nucleic acid, and circular functional nucleic acid-drug complex constructed by the present invention are as follows: Figure 1 shown.
[0097] In another aspect, the present invention provides a use of a circular functional nucleic acid for preparing a reagent for improving the affinity between a nucleic acid aptamer and a target, wherein the circular functional nucleic acid comprises an inner circular single strand and an outer complementary short strand, and the outer complementary short strand is connected to a nucleic acid aptamer.
[0098] In another aspect, the present invention provides a use of a circular functional nucleic acid for preparing a reagent for improving tumor targeting ability, wherein the circular functional nucleic acid comprises an inner circular single strand and an outer complementary short strand, wherein the outer complementary short strand is connected to a nucleic acid aptamer.
[0099] On the other hand, the present invention provides a use of a circular functional nucleic acid for preparing an agent for prolonging retention in a tumor, characterized in that the circular functional nucleic acid comprises an inner circular single chain and an outer complementary short chain, and the outer complementary short chain is connected to a nucleic acid aptamer.
[0100] The circular functional nucleic acid, preparation method, and application provided by the present invention have the following beneficial effects:
[0101] (1) Provides a new technology for preparing circular multivalent functional nucleic acids, combines functional nucleic acids with circular nucleic acids, significantly improves the targeting and stability of nucleic acid drugs, and constructs the nucleic acid drug development platform o-FLARE;
[0102] (2) The synthesis of circular multivalent functional nucleic acids is simple and efficient, without the need for complex reactions, and the final product synthesis yield can reach approximately 80%;
[0103] (3) A circular multivalent aptamer-drug complex was also constructed. The synthesis steps are simple, the type and ratio of the coupled drugs can be easily controlled, the purification method is simple, and the final product synthesis yield can reach about 80%;
[0104] (4) The cyclic multivalent functional nucleic acid is a completely closed-loop structure with greatly improved stability. Compared with the aptamer / aptamer-drug conjugate monomer, the cyclic multivalent aptamer / cyclic multivalent aptamer-drug conjugate has better serum stability and longer-lasting blood circulation.
[0105] (5) The circular multivalent functional nucleic acid has the characteristic of adjustable size. The different lengths of the inner loop provide different sizes of the circular multivalent functional nucleic acid. The size of the entire structure is about 5nm-20nm.
[0106] (6) The circular structure of the circular multivalent functional nucleic acid can precisely regulate the nucleic acid type and different valence states of the outer ring side chain by changing the different side chains of the outer ring, and efficiently synthesize circular functional nucleic acids with adjustable valence states, including different valence states of the same functional nucleic acid and different valence states of different functional nucleic acids; at the same time, precisely regulate drug combinations and drug ratios, promote synergistic effects between drugs, and increase cancer treatment effects;
[0107] (7) The affinity of circular multivalent functional nucleic acid aptamers is greatly improved compared with monovalent nucleic acid aptamers. The multivalent structure of the same nucleic acid aptamer better targets tumor cells and has better affinity for tumor cells, further increasing the enrichment of drug molecules in tumor cells;
[0108] (8) By linking different nucleic acid aptamers to the circular multivalent nucleic acid, multi-target targeting can be achieved, which is beneficial to increase the interaction between tumor cells and immune cells. BRIEF DESCRIPTION OF THE DRAWINGS
[0109] Figure 1 The diagrams are structural diagrams of circular nucleic acids, circular functional nucleic acids, and circular functional nucleic acid-drug complexes;
[0110] Figure 2 Flow chart of the preparation of inner circular single-stranded DNA (sscDNA) in Example 1;
[0111] Figure 3 Flow chart of the preparation of circular double-stranded DNA (dscDNA) in Example 1;
[0112] Figure 4Flow chart of the synthetic route of the circular multivalent nucleic acid aptamer in Example 2;
[0113] Figure 5 When synthesizing the inner circular single strand and the circular multivalent nucleic acid aptamer in Example 3, the ratio of the nucleic acid strands used is optimized;
[0114] Figure 6 Figures 2 and 3 show gel electrophoresis characterization results of the inner circular single-stranded, circular double-stranded nucleic acids, and circular multivalent nucleic acid aptamers in Example 4, including (a) preparation of circular single-stranded DNA and circular double-stranded DNA; (b) preparation of circular multivalent nucleic acid aptamers; and (c) preparation of circular multivalent nucleic acid aptamers of the same and different types of nucleic acid aptamers.
[0115] Figure 7 The results of the MALDI circular characterization of molecular weights in Example 5 are shown, including (a) the molecular weight of a circular single-stranded ssc; (b) the molecular weight of a circular double-stranded dsc; (c) the molecular weight of a circular multivalent nucleic acid aptamer; and (d) the molecular weight of a circular multivalent nucleic acid aptamer-drug complex.
[0116] Figure 8 This is the result of characterizing the size by DLS in Example 6;
[0117] Figure 9 This is the result of circular dichroism characterization of the circular multivalent nucleic acid aptamer DNA structure in Example 7;
[0118] Figure 10 The gel electrophoresis results of Example 8 are as follows: enzymatic stability and serum stability of circular multivalent aptamers, wherein (a) shows the enzymatic stability of linear single-stranded, inner circular single-stranded, circular double-stranded nucleic acids, and circular multivalent aptamers; (b) shows the serum stability of aptamers, circular trivalent aptamers, circular tetravalent aptamers, circular pentavalent aptamers, and circular hexavalent aptamers;
[0119] Figure 11 Figure 9 shows the flow cytometric analysis of the targeting and uptake capacity of the circular multivalent aptamer on the target cell AsPC1 in Example 9; (a) cellular targeting effect of the circular multivalent aptamer; (b) cellular endocytosis effect of the circular multivalent aptamer; HPNE is a low-expressing cMET-negative cell, and AsPC1 is a high-expressing cMET-positive cell;
[0120] Figure 12 This is a graph showing the results of the confocal analysis of the targeting and absorption capabilities of the circular multivalent nucleic acid aptamer to the target cell AsPC1 in Example 10;
[0121] Figure 13 This is a graph showing the results of the animal imaging study of the tumor targeting ability of the circular multivalent nucleic acid aptamer in vivo in Example 11;
[0122] Figure 14 Figure 1 is a graph showing the gel electrophoresis characterization results of the circular multivalent aptamer-drug complex in Example 12, wherein (a) preparation of a monovalent aptamer-drug complex; (b) preparation of a circular multivalent aptamer-drug complex;
[0123] Figure 15 Schematic diagram of toxicity analysis of the circular multivalent aptamer-drug complex in Example 13;
[0124] Figure 16 This is a schematic diagram of the analysis results of the immune activation of BMDC cells by the cyclic hexavalent aptamer-drug conjugate and free drug molecules in Example 14;
[0125] Figure 17 The results of the tumor inhibition effect of the circular multivalent nucleic acid aptamer-drug complex in Example 15 are shown in FIG. 15 , wherein (a) shows the change in tumor volume of mice, and (b) shows the change in weight of mice. DETAILED DESCRIPTION
[0126] The present invention will be described in further detail below with reference to the accompanying drawings and examples. It should be noted that the following examples are intended to facilitate understanding of the present invention and do not limit it in any way. The experimental reagents, consumables, and experimental instruments used in the following examples are all commercially available products unless their sources are stated.
[0127] Example 1: Preparation of circular nucleic acid
[0128] The preparation process of the circular nucleic acid provided in this embodiment is as follows:
[0129] (1) Preparation of inner circular single chain
[0130] The synthesis route of the inner circular single-stranded DNA is as follows Figure 2 As shown, the following five inner circular single-stranded DNAs were synthesized:
[0131] a. Synthesis of 60nt inner circular single-stranded DNA (ssc60):
[0132] The ssl60 sequence is AGATCGCAACCCAAGGAGCCGAGGACTGCAAAAACGCGTGAGGATGTGCTGGAACGGAGA (SEQ ID NO. 1), and the splintDNA sequence is CTTGGGTTGCGATCTTCT CCGTTCCAGCAC (SEQ ID NO. 5).
[0133] 1) Prepare the following reaction system in DPBS buffer: 1.62 nmol of 5'-phosphorylated 60 nt linear single-stranded (ssl60) DNA, 3.24 nmol of complementary short-stranded splint DNA, and 1.5 mL of T4 ligase buffer (366 mM Tris-HCl, pH 7.6, 6.6 mM MgCl2, 10 mM DTT, and 0.1 mM ATP).
[0134] 2) The reaction system was placed at 95°C for 5 minutes, 85°C-65°C for 30 minutes, 59°C-35°C for 30 minutes, and 26°C for 5 minutes. Finally, the temperature was lowered to 16°C. T4 ligase was then added at a concentration of 15-20 U / μL. The reaction was continued at 16°C for 3-4 hours.
[0135] 3) Verify the formation of a closed-loop structure using urea denaturing gel. Add exonucleases 1 and 3 (0.5% (v / v) Exonuclease III and 2.5% (v / v) Exonuclease I) to the reaction mixture and incubate at 37°C for approximately 2 hours to remove the splint DNA. Extract the reaction mixture with DNA extraction buffer at a 1:1 volume ratio to remove the enzymes. Remove the supernatant, add ammonium acetate and anhydrous ethanol, and precipitate at -40°C for 4-5 hours. Centrifuge at 12,000 rpm, discard the supernatant, and reconstitute the precipitate in PBS. Purify by ultrafiltration through a 50 kDa or 100 kDa ultrafiltration tube to obtain the final single-stranded circular DNA. Store the resulting solution at -20°C until ready for use.
[0136] b. Synthesis of 80nt inner circular single-stranded DNA (ssc80):
[0137] The sequence of ssl80 is AGATCGCAACCCAAGGAGCCGAGGACTGCAAAAACGCGTGAGTGA AGGACCTGGTCAGAGAGGATGTGCTGGAACGGAGA (SEQ ID NO. 2), and the preparation method is the same as that of ssc60, except that ssl60 is replaced by ssl80.
[0138] c. Synthesis of 100nt circular single-stranded DNA (ssc100):
[0139] The sequence of ssl100 is AGATCGCAACCCAAG GAGCCGAGGACTGCAAAAACGCGTGAGTG AAGGACCTGGTCAGAGACCGGAATCGACTGACCAACAGGATGTGCTGGAACGGAGA (SEQ ID NO. 3), in which only ssl60 is replaced by ssl100.
[0140] d. Synthesis of 120nt circular single-stranded DNA (ssc120):
[0141] The sequence of ssl120 is AGATCGCAACCCAAGGAGCCGAGGACTGCAAAAACGCGTGAGTG AAGGACCTGGTCAGAGACCGGAATCGACTGACCAACTGCCATCTGCAGCTAACACG AGGATGTGCTGGAACGGAGA (SEQ IDNO.4), only replace ssl60 with ssl120.
[0142] (2) Synthesis of outer complementary short chains
[0143] There are six types of synthesized outer complementary short chains:
[0144] X-1=TCTCCGTTCCAGCACATCCT, X-2=CTCTGACCAGGTCCTTCACT,
[0145] X-3=CACGCGTTTTTGCAGTCCTC, X-4=GGCTCCTTGGGTTGCGATCT,
[0146] X-5=GTTGGTCAGTCGATTCCGGT, X-6=CGTGTTAGCTGCAGATGGCA.
[0147] (3) Combination of inner circular single chain and outer complementary short chain
[0148] The synthetic route of circular double-stranded nucleic acid is as follows: Figure 3 As shown, five circular nucleic acids were synthesized:
[0149] a. 60nt circular double-stranded nucleic acid (dsc60)
[0150] 1) Prepare the following reaction system in DPBS buffer: 1.62 nmol of 60 nt circular single-stranded (ssc60) DNA, 1.62 nmol each of three complementary short strands X-1, X-3, and X-4, and T4 ligase buffer in a total volume of 1.5 mL.
[0151] 2) Incubate the reaction system at 95°C for 5 minutes, then gradually cool to 4°C. Add 15-20 U / μL of T4 ligase and incubate at 16°C for 3-4 hours.
[0152] 3) Add exonuclease 1 and 3 (0.5% (v / v) Exonuclease III, and 2.5% (v / v) Exonuclease I) to the reaction solution and react at 37°C for about 2 hours.
[0153] 4) The product is extracted to remove enzymes and purified by ultrafiltration to obtain dsc60.
[0154] b. 80nt circular double-stranded nucleic acid (dsc80)
[0155] The preparation method is the same as that of dsc60, except that ssc60 is replaced by ssc80, and the outer complementary short chains are replaced by four types of X-1, X-2, X-3, and X-4, each with 1.62 nmol.
[0156] c. 100nt circular double-stranded nucleic acid (dsc100)
[0157] The preparation method is the same as that of dsc60, except that ssc60 is replaced by ssc100, and the outer complementary short chains are replaced by 1.62 nmol each of X-1, X-2, X-3, X-4, and X-5.
[0158] d. 120nt circular double-stranded nucleic acid (dsc120)
[0159] The preparation method is the same as that of dsc60, except that ssc60 is replaced by ssc120, and the outer complementary short chains are replaced by 1.62 nmol each of X-1, X-2, X-3, X-4, X-5, and X-6.
[0160] Example 2: Preparation of circular multivalent nucleic acid aptamers
[0161] The synthetic route of the circular multivalent nucleic acid aptamer (mv-apt) provided in this embodiment is as follows Figure 4 As shown, the nucleic acid aptamer S sequence is:
[0162] SL1(ATCAGGCTGGATGGTAGCTCGGTCGGGGTGGGTGGGTTGGCAAGTCTGAT)(SEQ ID NO.6),
[0163] Sgc8c(TCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGA)(SEQ ID NO.7),
[0164] PD-4S (CGCACTATGTTTTACGAGCCGTTTCCTCGGCAGATAGTAAGTGC) (SEQ ID NO. 8).
[0165] The nucleic acid aptamer in the circular multivalent nucleic acid aptamer can be one or more of SL1, Sgc8c, and PD-4S.
[0166] 1. Construction of circular multivalent aptamers using the same aptamer
[0167] In this example, SL1 was used to synthesize the outer complementary short chains X-1, X-2, X-3, X-4, X-5 and X-6, respectively, to construct a circular trivalent nucleic acid aptamer, a circular tetravalent nucleic acid aptamer, a circular pentavalent nucleic acid aptamer and a circular hexavalent nucleic acid aptamer, respectively.
[0168] a. Circular trivalent nucleic acid aptamer (dsc60-3Apt)
[0169] 1) Prepare the following reaction system in DPBS buffer: 1.62 nmol of 60 nt circular single-stranded (ssc60) DNA, 3.24 nmol of each of three complementary short strands X-1, X-3, and X-4 (where X-1 = tctccgttccS (SEQ ID NO. 6) agcacatcct, X-3 = cacgcgttttS (SEQ ID NO. 6) tgcagtcctc, and X-4 = ggctccttggS (SEQ ID NO. 6) gttgcgatct), and T4 ligase buffer in a total volume of 1.5 mL. 2) Incubate the reaction system at 95°C for 5 minutes, then gradually cool to 4°C. Then, add 15-20 U / μL of T4 ligase and incubate at 16°C for 3-4 hours. 3) Add exonucleases 1 and 3 (0.5% (v / v) Exonuclease III and 2.5% (v / v) Exonuclease I) to the reaction solution and react at 37°C for approximately 2 hours. 4) The product is extracted to remove enzymes and purified by ultrafiltration to obtain a circular trivalent nucleic acid aptamer.
[0170] b. Circular tetravalent nucleic acid aptamer (dsc80-4Apt)
[0171] The preparation method is the same as that of the circular trivalent nucleic acid aptamer, except that ssc60 is replaced with ssc80, and the outer complementary short chains are replaced with four types of X-1, X-2, X-3, and X-4 (wherein X-1 = tctccgttccS (SEQ ID NO. 6) agcacatcct, X-2 = ctctgaccagS (SEQ ID NO. 6) gtccttcact, X-3 = cacgcgttttS (SEQ ID NO. 6) tgcagtcctc, and X-4 = ggctccttggS (SEQ ID NO. 6) gttgcgatct), each 3.24 nmol (each equal amount), to obtain a circular tetravalent nucleic acid aptamer.
[0172] c. Circular pentavalent nucleic acid aptamer (dsc100-5Apt)
[0173] The preparation method is the same as that of the circular trivalent nucleic acid aptamer, except that ssc60 is replaced with ssc100, and the outer complementary short chains are replaced with five types, X-1, X-2, X-3, X-4, and X-5 (wherein X-1 = tctccgttccS (SEQ ID NO. 6) agcacatcct, X-2 = ctctgaccagS (SEQ ID NO. 6) gtccttcact, X-3 = cacgcgttttS (SEQ ID NO. 6) tgcagtcctc, X-4 = ggctccttggS (SEQ ID NO. 6) gttgcgatct, and X-5 = gttggtcagtS (SEQ ID NO. 6) cgattccggt), 3.24 nmol each (each in equal amounts), to obtain a circular pentavalent nucleic acid aptamer.
[0174] d. Circular hexavalent nucleic acid aptamer (dsc120-6Apt)
[0175] The preparation method is the same as that of the circular trivalent nucleic acid aptamer, except that ssc60 is replaced with ssc120, and the outer complementary short chains are replaced with six types, X-1, X-2, X-3, X-4, X-5, and X-6 (wherein X-1 = tctccgttccS (SEQ ID NO. 6) agcacatcct, X-2 = ctctgaccagS (SEQ ID NO. 6) gtccttcact, X-3 = cacgcgttttS (SEQ ID NO. 6) tgcagtcctc, X-4 = ggctccttggS (SEQ ID NO. 6) gttgcgatct, X-5 = gttggtcagtS (SEQ ID NO. 6) cgattccggt, and X-6 = cgtgttagctS (SEQ ID NO. 6) gcagatggca), 3.24 nmol each (each in equal amounts), to obtain a circular hexavalent nucleic acid aptamer.
[0176] 2. Construction of circular multivalent aptamers using different types of aptamers
[0177] a. Construction of circular multivalent nucleic acid aptamers using two nucleic acid aptamers (SL1 and Sgc8c)
[0178] 1) Construction of monovalent SL1, bivalent Sgc8c, and trivalent circular nucleic acid aptamers
[0179] The preparation method is the same as that of the circular trivalent nucleic acid aptamer, except that the outer complementary short chains are replaced with three types: X-1, X-3, and X-4 (wherein X-1 = tctccgttccS (SEQ ID NO. 6) agcacatcct, X-3 = cacgcgttttS (SEQ ID NO. 7) tgcagtcctc, and X-4 = ggctccttggS (SEQ ID NO. 7) gttgcgatct) to obtain a monovalent SL1 bivalent Sgc8c circular trivalent nucleic acid aptamer.
[0180] 2) Construction of bivalent SL1, monovalent Sgc8c circular trivalent nucleic acid aptamers
[0181] The preparation method is the same as that of the circular trivalent nucleic acid aptamer, except that the outer complementary short chains are replaced with three types: X-1, X-3, and X-4 (wherein X-1 = tctccgttccS (SEQ ID NO. 6) agcacatcct, X-3 = cacgcgttttS (SEQ ID NO. 6) tgcagtcctc, and X-4 = ggctccttggS (SEQ ID NO. 7) gttgcgatct) to obtain a bivalent SL1 monovalent Sgc8c circular trivalent nucleic acid aptamer.
[0182] 3) Construction of trivalent SL1 trivalent Sgc8c circular hexavalent nucleic acid aptamer
[0183] The preparation method is the same as that of the circular trivalent nucleic acid aptamer, except that ssc60 is replaced with ssc120, and the outer complementary short chains are replaced with six types: X-1, X-2, X-3, X-4, X-5, and X-6 (wherein X-1 = tctccgttccS (SEQ ID NO. 6) agcacatcct, X-2 = ctctgaccagS (SEQ ID NO. 6) gtccttcact, X-3 = cacgcgttttS (SEQ ID NO. 6) tgcagtcctc, X-4 = ggctccttggS (SEQ ID NO. 7) gttgcgatct, X-5 = gttggtcagtS (SEQ ID NO. 7) cgattccggt, and X-6 = cgtgttagctS (SEQ ID NO. 7) gcagatggca) to obtain the trivalent SL1 trivalent Sgc8c circular hexavalent nucleic acid aptamer.
[0184] 4) Construction of trivalent SL1 trivalent Sgc8c circular hexavalent nucleic acid aptamer
[0185] The preparation method is the same as that of the circular trivalent nucleic acid aptamer, except that ssc60 is replaced with ssc120, and the outer complementary short chains are replaced with six types: X-1, X-2, X-3, X-4, X-5, and X-6 (wherein X-1 = tctccgttccS (SEQ ID NO. 6) agcacatcct, X-2 = ctctgaccagS (SEQ ID NO. 7) gtccttcact, X-3 = cacgcgttttS (SEQ ID NO. 6) tgcagtcctc, X-4 = ggctccttggS (SEQ ID NO. 7) gttgcgatct, X-5 = gttggtcagtS (SEQ ID NO. 6) cgattccggt, and X-6 = cgtgttagctS (SEQ ID NO. 7) gcagatggca) to obtain the trivalent SL1 trivalent Sgc8c circular hexavalent nucleic acid aptamer.
[0186] b. Construction of circular multivalent nucleic acid aptamers using three nucleic acid aptamers (SL1, Sgc8c, PD-4S)
[0187] 1) Construction of bivalent SL1 bivalent Sgc8c bivalent PD-4S circular hexavalent nucleic acid aptamer
[0188] The preparation method is the same as that of the circular trivalent nucleic acid aptamer, except that ssc60 is replaced with ssc120, and the outer complementary short chains are replaced with six types: X-1, X-2, X-3, X-4, X-5, and X-6 (wherein X-1 = tctccgttccS (SEQ ID NO. 6) agcacatcct, X-2 = ctctgaccagS (SEQ ID NO. 7) gtccttcact, X-3 = cacgcgttttS (SEQ ID NO. 8) tgcagtcctc, X-4 = ggctccttggS (SEQ ID NO. 6) gttgcgatct, X-5 = gttggtcagtS (SEQ ID NO. 7) cgattccggt, and X-6 = cgtgttagctS (SEQ ID NO. 8) gcagatggca) to obtain a bivalent SL1 bivalent Sgc8c bivalent PD-4S circular hexavalent nucleic acid aptamer.
[0189] Example 3: Optimization of the preparation process of circular multivalent nucleic acid aptamers
[0190] 1. Optimization of the synthesis of inner circular single chain
[0191] In this example, the inner circular single strand was synthesized according to the method provided in Example 1, wherein 1.62 nmol of 5' phosphorylated linear single strand (such as ssl120) DNA was added, and the amounts of complementary short-chain splint DNA added were 1.62 nmol, 3.24 nmol, 4.86 nmol, and 6.48 nmol, respectively, to synthesize the inner circular single strand. The results showed that when the ratio of linear single strand to splint DNA was 1:2 or 1:3, the inner circular single strand could be efficiently synthesized. However, when the ratio was lower than 1:2 or higher than 1:3, the yield decreased significantly, especially when the ratio was 1:1. Therefore, a ratio of linear single strand to splint DNA of 1:2 was selected. Among them, the gel electrophoresis characterization of the linear single strand to splint DNA at a ratio of 1:2 and 1:3 is shown in FIG. Figure 5 .
[0192] 2. Optimization of Synthetic Circular Multivalent Aptamers
[0193] According to the method provided in Example 2, a circular multivalent nucleic acid aptamer was synthesized. It was found that the ratio of the inner circular single chain to the outer complementary short chain was also critical. Taking the circular hexavalent nucleic acid aptamer provided in Example 2-1-d as an example, 1.62 nmol of ssc120 was used, and the outer complementary short chains X-1, X-2, X-3, X-4, X-5, and X-6 were used. 1.62 nmol, 3.24 nmol, 4.86 nmol, 6.48 nmol, and 8.1 nmol of each outer complementary short chain were taken, respectively (each outer complementary short chain was equal), to synthesize the circular hexavalent nucleic acid aptamer. The results showed that when the ratio of the inner circular single chain to the outer complementary short chain was 1:2, 1:3, and 1:4, the inner circular single chain could be efficiently synthesized. When the ratio was lower than 1:2 or higher than 1:4, the yield would decrease significantly, especially when the ratio was 1:1, the yield was low. Therefore, a ratio of 1:2 was selected for the inner circular single chain to the outer complementary short chain. Among them, the gel electrophoresis characterization when the ratio of linear single chain to outer complementary short chain is 1:2, 1:3, 1:4 is shown in Figure 5 .
[0194] Example 4: Characterization of DNA structure by gel electrophoresis
[0195] The DNA structures of the inner circular single strand, circular nucleic acid, and circular multivalent nucleic acid aptamer prepared in Example 1 and Example 2 were characterized by gel electrophoresis. Figure 6As shown, (a) is the characterization of the inner circular single-stranded DNA and circular nucleic acid DNA, (b) is the characterization of the circular multivalent nucleic acid aptamer, and (c) is the characterization of the circular multivalent nucleic acid aptamer of the same nucleic acid aptamer and different nucleic acid aptamers; the inner circular single strand is cy5 red fluorescence, and the outer complementary strand is FAM green fluorescence. When a circular double-stranded DNA or a circular multivalent nucleic acid aptamer is synthesized, it is yellow fluorescence in gel imaging. Taking 60nt as an example, when DNA is synthesized from a single strand into a single circle, the electrophoresis speed in the denaturing gel is slower than that of single-stranded DNA and the position is higher; the red fluorescence and the green fluorescence completely overlap, proving that the final formation is a completely closed circular double-stranded DNA. Based on ssc60~ssc120, this example synthesized circular multivalent nucleic acid aptamers of the same nucleic acid aptamer and circular multivalent nucleic acid aptamer structures of different nucleic acid aptamers.
[0196] according to Figure 6 -(a) It can be seen that both linear single-stranded DNA and inner circular single-stranded DNA emit red fluorescence, and circular nucleic acid DNA emits yellow fluorescence. The positions of linear single-stranded DNA, inner circular single-stranded DNA, and circular nucleic acid DNA are different in gel electrophoresis and can be completely separated and characterized, indicating that linear single-stranded DNA, inner circular single-stranded DNA, and circular nucleic acid were successfully prepared.
[0197] according to Figure 6 -(b) It can be seen that the inner circular single-stranded DNA is red fluorescence, the circular multivalent nucleic acid aptamer is yellow fluorescence, and green fluorescence can also be seen when characterizing the quadrivalent, pentavalent, and hexavalent circular nucleic acid aptamers (the green fluorescence is the redundant outer complementary chain), indicating that the circular trivalent nucleic acid aptamer, circular tetravalent nucleic acid aptamer, circular pentavalent nucleic acid aptamer, and circular hexavalent nucleic acid aptamer were successfully prepared.
[0198] according to Figure 6 -(c) It can be seen that the positions of the circular trivalent nucleic acid aptamers or circular hexavalent nucleic acid aptamers prepared from the same type of nucleic acid aptamer and the circular multivalent nucleic acid aptamers of different types of nucleic acid aptamers are also different and can be completely distinguished.
[0199] Example 5: MALDI ring characterization of molecular weight
[0200] In this example, the molecular weight of the inner circular single chain prepared in Example 1 was characterized by MALDI ring characterization. The purified final product (inner circular single chain) was mixed with a matrix in a ratio of 1:1. The matrix was a saturated 3-HPA solution of 10 mg / ml diammonium hydrogen citrate prepared in a ratio of 1:1 between water and acetonitrile. The MALDI ring characterization was then performed. The results are shown in FIG. Figure 7 As shown, a is the molecular weight of the inner circular single-stranded nucleic acid, b is the circular double-stranded nucleic acid, c is the circular multivalent nucleic acid aptamer, and d is the circular multivalent nucleic acid-drug complex.
[0201] according to Figure 7It can be seen that the molecular weight of ssc60 is about 1.8×10 4 The molecular weight of ssc80 is about 2.5×10 4 The molecular weight of ssc100 is about 3.2×10 4 The molecular weight of ssc120 is about 3.7×10 4 The molecular weights of circular double-stranded nucleic acid, circular multivalent nucleic acid aptamer, and circular multivalent nucleic acid-drug complex increase in sequence.
[0202] Example 6: DLS characterization of size
[0203] In this example, the sizes of the inner circular single strand and circular nucleic acid prepared in Example 1 were characterized by DLS. Figure 8 As shown, the purified final product was diluted in DPBS and measured using a nanoparticle size potentiometer. The size of the inner circular single chain was about 6nm-13nm, and the size of the circular multivalent nucleic acid aptamer was about 11nm-20nm.
[0204] Example 7: Circular Dichroism Characterization of Circular Multivalent Aptamer DNA Structure
[0205] This example uses circular dichroism to characterize the circular multivalent aptamer DNA structure. Figure 9 As shown, the purified final product was diluted in DPBS, and the structures of single-stranded, single-circular, double-stranded DNA and circular multivalent nucleic acid aptamer were characterized by circular dichroism spectrometry. It can be seen that the DNA structure changed significantly in different structures.
[0206] Example 8: Gel electrophoresis characterization of enzyme cleavage stability and serum stability
[0207] This example characterizes the enzymatic stability and serum stability of circular multivalent nucleic acid aptamers by gel electrophoresis. The linear single-stranded, inner circular single-stranded, circular double-stranded nucleic acids, and circular multivalent nucleic acid aptamers prepared in Examples 1 and 2 were incubated in exonuclease I and exonuclease III at 37°C with a final DNA concentration of 2 uM. The same volume of sample was loaded for gel electrophoresis. The results are shown in Table 1. Figure 10 (a), it can be seen that the linear single-stranded nucleic acid is almost degraded after enzyme cleavage, while the inner circular single-stranded, circular double-stranded nucleic acid, and circular multivalent nucleic acid aptamer are stable in structure and have good enzyme cleavage stability. The nucleic acid aptamer prepared in Example 2, the circular trivalent nucleic acid aptamer, the circular tetravalent nucleic acid aptamer, the circular pentavalent nucleic acid aptamer, and the circular hexavalent nucleic acid aptamer were incubated at 37°C in a medium containing 10% serum with a final DNA concentration of 2uM. The same volume was loaded for gel electrophoresis. The results are shown in Figure 2. Figure 10 (b) It can be seen that the nucleic acid aptamer has been completely degraded at 24 hours and is very unstable, while the circular multivalent nucleic acid aptamer is still stable after 24 hours of serum incubation.
[0208] Example 9: Flow cytometry study of the targeting and absorption capacity of circular multivalent nucleic acid aptamers to target cells AsPC1
[0209] This example studies the targeting and absorption capacity of the circular multivalent nucleic acid aptamer (prepared in Example 2) on the target cell AsPC1 by flow cytometry. The cells were digested with enzyme-free digestion solution, and the cells were counted after centrifugation. 300,000 cells were used for each sample. The circular multivalent nucleic acid aptamer with different valences (the final concentration of the nucleic acid aptamer was 200nM) was incubated at 4°C or 37°C for 1 hour. After the incubation, the supernatant was removed, and the unbound nucleic acid aptamer was washed with PBS. Finally, the cells were resuspended in PBS and analyzed by flow cytometry. The results are shown in Figure 2. Figure 11 As shown, (a) the targeting effect of circular multivalent nucleic acid aptamer at the cellular level; (b) the endocytosis effect of circular multivalent nucleic acid aptamer at the cellular level; HPNE is a low-expression cMET-negative cell, and AsPC1 is a high-expression cMET-positive cell.
[0210] according to Figure 11 (a) The left side shows negative cells, which mainly illustrate the specificity of targeting. The right side shows positive cells, which highly express the target cMET. This part shows that the first four have a larger displacement than the fifth, indicating that the targeting effect of the circular nucleic acid aptamer is better than that of the monovalent one.
[0211] At the same time, the final concentrations of the nucleic acid aptamers in this embodiment are all kept consistent. Taking the hexavalent nucleic acid aptamer as an example, the nucleic acid aptamer used for comparison has a final monovalent nucleic acid aptamer nucleic acid quantification that is 6 times the nucleic acid quantification of the hexavalent nucleic acid aptamer structure, so as to ensure the consistency of the final nucleic acid aptamer concentration (the final concentration of the nucleic acid aptamer is 200 nM, and the final concentrations of free and multivalent are consistent).
[0212] according to Figure 11 (b) When the target cMET is highly expressed, the trivalent and hexavalent circular multivalent nucleic acid aptamers have larger displacements than other valence states, showing better absorption capacity.
[0213] Example 10: Confocal microscopy study of the targeting and absorption capabilities of circular multivalent aptamers on target cells
[0214] This example used confocal microscopy to investigate the targeting and uptake of circular multivalent aptamers (prepared in Example 2) by target cells, AsPC1. Cells were centrifuged and counted, then plated onto confocal microplates. After dilution with culture medium, the aptamers were incubated at 4°C or 37°C for 1 hour at a final concentration of 200 nM. The supernatant was removed, unbound aptamers were washed with PBS, and confocal microplates were added to the microplates for analysis.
[0215] Meanwhile, the final concentration of the nucleic acid aptamers in this example is kept consistent, that is, the final concentration of the nucleic acid aptamer is 200 nM, and the final concentrations of the free and multivalent aptamers are consistent.
[0216] The results are as follows Figure 12 As shown, trivalent and hexavalent cyclic multivalent aptamers exhibited better targeting and absorption capabilities. All aptamers were modified with Cy5 fluorescence, and the amount of red fluorescence represented the amount of aptamer that had entered. When cells were incubated with trivalent and hexavalent cyclic multivalent aptamers, tumor cells showed more red fluorescence, demonstrating that trivalent and hexavalent cyclic multivalent aptamers can better target and enter tumor cells with high cMET expression.
[0217] Example 11: Studying the Tumor Targeting Ability of Circular Multivalent Aptamers in Vivo by Animal Imaging
[0218] In this example, the tumor targeting ability of cyclic multivalent nucleic acid aptamers in vivo was studied by animal imaging. The experiment was conducted using the small molecule Cy5-labeled SL1, and the sample was dissolved in PBS to prepare a solution. In a tumor model constructed with pancreatic cancer AsPC1 cells, 100 μL of Cy5-labeled SL1 and Cy5-labeled cyclic multivalent nucleic acid aptamer were injected into the tail vein, with the amount of SL1 being 2.5 nmol. The in vivo distribution at different time points was observed using a small animal imaging instrument. Compared with the cyclic multivalent nucleic acid aptamer, the Cy5-labeled SL1 has a short in vivo circulation time and is quickly metabolized by the body. The cyclic multivalent nucleic acid aptamer has greater enrichment and longer retention in the tumor area, and still has obvious fluorescence 12 hours after injection. This shows that the cyclic multivalent nucleic acid aptamer can specifically enrich and retain in the tumor area. Among them, the trivalent and hexavalent cyclic multivalent nucleic acid aptamers have stronger targeting ability and longer tumor retention time. The most preferred is the hexavalent cyclic multivalent nucleic acid aptamer, which has the best targeting ability and the longest tumor retention time. Theoretically, the circular multivalent nucleic acid aptamer of the present invention can be constructed from 3 to 12 valencies. However, starting from 7 valencies, the sequence and length of the circular single strand and the outer complementary single strand need to be adjusted, which is more complicated and has no advantage in spatial structure. 3-6 valencies are more preferred.
[0219] Aptamers bind to target proteins through their functional regions. When constructing multivalent functional nucleic acids, the spatial structure has a great influence on the functional regions. If the functional regions are affected, the affinity of multivalent aptamers may not be better than that of monovalent aptamers. The results of this example ( Figure 13 ) showed that trivalent and hexavalent vaccines were more effective, which may be related to the spatial structure.
[0220] Meanwhile, the final concentration of the nucleic acid aptamers in this example is kept consistent, that is, the final concentration of the nucleic acid aptamer is 200 nM, and the final concentrations of the free and multivalent aptamers are consistent.
[0221] Example 12: Construction of a Circular Multivalent Aptamer-Drug Complex
[0222] The circular multivalent nucleic acid aptamer-drug complex provided in this embodiment, wherein the nucleic acid aptamer-drug complex with an outer complementary short chain is SL1 (ATCAGGCTGGATGGT (DBCO) AGCTCGGTCGGGGTGGGTGGGTTGGCAAGTCTGAT), which reacts with a small molecule drug (MMAE or diABZI) with N3. The preparation process is as follows: the molar ratio of SL1-DBCO to N3-drug is 1:2, the buffer solution is PBS, the shaker is 800 rpm, the reaction is carried out overnight, and the final product SL1-drug (SL1 is connected to the modification group DBCO, and the drug is connected to the modification group N3) is obtained after ultrafiltration; the nucleic acid aptamer-drug complex with an outer complementary short chain is obtained and reacts with the inner circular single-stranded nucleic acid. The preparation method is consistent with the circular double-stranded nucleic acid aptamer DNA preparation method described in Example 2, and the prepared circular double-stranded nucleic acid aptamer without the drug is used as a control. The gel electrophoresis characterization results are shown in FIG. Figure 14 , it can be seen that in different structures, the DNA structure has changed significantly, so the position of gel electrophoresis has also changed.
[0223] Example 13: Toxicity Analysis of Circular Multivalent Aptamer-Drug Complex
[0224] In this example, the prepared cyclic hexavalent nucleic acid aptamer-drug complex is combined with the free nucleic acid aptamer-drug complex to perform cytotoxicity analysis on the target cells AsPC1 and negative cells HPNE. The operation steps are as follows: digest the cells with a density of about 80%, count them after digestion, and seed them in a 96-well plate at a density of 100ul and 5000 cells per well. After 24 hours of cell attachment, the cells are incubated with different concentration gradients of cyclic multivalent nucleic acid aptamer-drug complexes and drug molecules, the drugs are diluted in culture medium, and 100ul per well is incubated in an incubator for 72 hours. 3) After 72 hours, the cell culture medium is removed, and a culture medium containing 10% CCK8 is added to each well of the 96-well plate. After incubation in the incubator for 2-4 hours, the reading is read at 460nm on an enzyme reader to test the cell proliferation rate. The nucleic acid quantification of the final monovalent nucleic acid aptamer-drug complex is 6 times that of the nucleic acid-drug complex with a hexavalent nucleic acid aptamer-drug complex structure. The results are as follows: Figure 15 As shown in the figure: free drug molecules are highly toxic to both target cells and negative cells. In contrast, the cyclic multivalent nucleic acid aptamer-drug conjugate has an inhibitory effect on cells only in target cells, but has little inhibitory effect on negative cells. This proves that the cyclic multivalent nucleic acid aptamer-drug complex has a significantly reduced cytotoxicity due to its higher targeting.
[0225] Example 14: Analysis of Immune Activation of Circular Multivalent Aptamer-Drug Complexes
[0226] In this embodiment, the prepared cyclic hexavalent nucleic acid aptamer-drug complex and free drug molecules were used to analyze the immune activation of BMDC cells. BMDC cells were collected and counted, with 500ul per well and 800,000 cells. The cells were incubated with the same concentration of cyclic multivalent nucleic acid aptamer-drug complex and drug molecules and incubated in an incubator for 12 hours. The cells were collected, the proteins were extracted, and protein immunoblotting analysis was performed. The final nucleic acid or drug quantification of the monovalent nucleic acid aptamer, drug molecule, nucleic acid aptamer-drug complex was 6 times that of the nucleic acid-drug complex of the hexavalent nucleic acid aptamer-drug complex structure. The results are as follows Figure 16 As shown, it can be seen that the nucleic acid aptamer-drug complex and drug molecules have a certain activation effect on the pathway.
[0227] Example 15: Tumor Inhibitory Effect of Circular Multivalent Aptamer-Drug Complex
[0228] This example studies the tumor inhibition effect of cyclic hexavalent aptamer-drug complexes through in vivo tumor inhibition experiments. In a pancreatic cancer model constructed with AsPC1 cells, mice were treated with PBS, free SL1-MMAE, free SL1-diABZI, cyclic hexavalent Apt-MMAE, and cyclic hexavalent Apt-diABZI samples, respectively. The final nucleic acid or drug quantification of the monovalent aptamer-drug complex was 6 times that of the nucleic acid-drug complex of the hexavalent aptamer-drug complex structure. The tumor growth and weight changes of the mice were observed, and the results were as follows: Figure 17 As shown, (a) is the change of mouse tumor volume, and (b) is the change of mouse body weight.
[0229] according to Figure 17 -(a) It can be seen that the cyclic hexavalent aptamer-drug complex group has a significant tumor inhibition effect compared with other groups, while the tumor inhibition effect of the monovalent aptamer-drug complex is poor at the same dose, indicating that the cyclic multivalent aptamer can significantly improve the in vivo tumor inhibition effect of the aptamer-drug complex.
[0230] according to Figure 17 -(b) It can be seen that the cyclic hexavalent nucleic acid aptamer-drug complex group has the lowest toxicity to mice compared with other groups and has no adverse effect on mouse growth.
[0231] Example 16: Construction of a circular multivalent nucleic acid-antibody complex
[0232] The circular multivalent nucleic acid-antibody complex constructed in this example has an outer complementary sequence, X-R1, consisting of one or more chemically modified nucleic acids. This complex reacts with a sequence containing Y-R2, where Y represents one or more antibodies, to produce a nucleic acid-antibody complex, which then reacts with an inner circular single-stranded nucleic acid. The preparation method is consistent with the method for preparing the circular multivalent nucleic acid-drug complex provided in Example 12.
[0233] Example 17: Construction of a circular multivalent nucleic acid-polypeptide complex
[0234] The circular multivalent nucleic acid-polypeptide complex constructed in this example has an outer complementary sequence, X-R1, consisting of one or more chemically modified nucleic acids. This complex reacts with a sequence containing Y-R2, where Y is one or more polypeptides, to produce a nucleic acid-polypeptide complex, which then reacts with an inner circular single-stranded nucleic acid. The preparation method is consistent with the method for preparing the circular multivalent nucleic acid-drug complex provided in Example 12.
[0235] Example 18: Construction of cyclic multivalent ASO and cyclic multivalent ASO+aptamer complex
[0236] This example uses the method provided in Example 2 to construct a circular multivalent ASO, wherein the outer complementary short chain contains ASO, ASO = (MOE-T)*(MOE-G)*(MOE-C)*(MOE-A)*(MOE-C)*(dT)*(dG)*(dT)*(dA)*(dC)*
[0237] (dT)*(dC)*(dC)*(dT)*(dC)*(MOE-T)*(MOE-T)*(MOE-G)*(MOE-A)*(MOE-C).
[0238] The structure of the circular multivalent ASO was characterized by gel electrophoresis, proving that the circular multivalent ASO was successfully constructed.
[0239] This example also synthesized a cyclic multivalent ASO with multiple ASOs of different sequences in the same valence state, as well as a cyclic multivalent ASO-aptamer with ssc80 and ssc120 as the inner rings.
[0240] When preparing a circular hexavalent ASO+aptamer, ssl120 (SEQ ID NO. 4) is used, the reaction chains are X-1, 3, 5, the outer complementary short chains are SL1, X-2, 4, 6, and S is one or more ASO sequences (equivalent to trivalent ASO, trivalent aptamer).
[0241] When preparing a circular tetravalent ASO+aptamer, ssl180 (SEQ ID NO. 2) is used, the reaction chain is X-1, 3, the outer complementary short chain is SL1, X-2, 4, and S is one or more ASO sequences (equivalent to a bivalent ASO, a bivalent aptamer).
[0242] Flow cytometry was used to analyze the cellular targeting and uptake of the circular multivalent ASO-aptamer. Unlike the circular multivalent nucleic acid aptamer, the cyclic tetravalent ASO-aptamer with the inner ring, ssc80, was found to have stronger cellular targeting and uptake. This structure was selected for KRAS degradation in positive AsPC1 cells because the tetravalent spatial structure is more conducive to the therapeutic effect of the circular tetravalent ASO-aptamer.
[0243] Western blot analysis of the KRAS protein degradation ability of the cyclic multivalent ASO-aptamer revealed that the cyclic multivalent ASO-aptamer with the inner loop of ssc80 had stronger cellular targeting and uptake, and this structure was selected for KRAS degradation in positive cells AsPC1.
[0244] Cells were incubated with ASO, cyclic multivalent aptamer, cyclic multivalent ASO, and cyclic multivalent ASO-aptamer at the same concentration for 48 hours in an incubator. Cells were harvested, proteins were extracted, and Western blotting analysis was performed. The results showed that at the same concentration, cyclic multivalent ASO-aptamer could better enter cells and effectively degrade KRAS protein in AsPC1 cells compared with ASO, cyclic multivalent aptamer, and cyclic multivalent ASO.
[0245] Example 19: Construction of circular multivalent CpG and circular multivalent CpG+aptamer complexes
[0246] This example uses the method provided in Example 2 to construct a circular multivalent CpG, wherein the outer complementary short chain contains CpG, and the CpG is ODN 1826=tccatgacgttcctgacgtt.
[0247] The structure of the circular multivalent CpG was characterized by gel electrophoresis, demonstrating that the circular multivalent CpG was successfully constructed.
[0248] This embodiment also synthesizes a circular multivalent CpG with multiple CpGs of different sequences in the same valence state, as well as a circular multivalent CpG-aptamer with ssc80 and ssc120 as the inner ring. The cell targeting and absorption capacity of the circular multivalent CpG-aptamer were analyzed by flow cytometry. It was found that the circular tetravalent CpG-aptamer with ssc80 as the inner ring of CpG-aptamer had stronger cell targeting and absorption capacity. This structure was selected for the TLR9 pathway in the positive cell RAW264.7. The reason is that the tetravalent spatial structure is more conducive to the circular tetravalent CpG-aptamer (equivalent to divalent CpG, divalent sptamer) to exert the effect of treating tumors.
[0249] Western blotting was used to analyze the TLR9 pathway activation ability of cyclic multivalent CpG-aptamers. RAW264.7 cells were incubated with CpG, cyclic multivalent CpG, and cyclic multivalent CpG-aptamers at the same concentration for 24 hours. Cells were harvested, proteins were extracted, and Western blotting was performed. At the same concentration, cyclic multivalent CpG-aptamers showed greater pNFκB activation.
[0250] Flow cytometry was used to analyze the expression of CD80 and CD86 on the surface of RAW264.7 cells. RAW264.7 cells were incubated with CpG, cyclic multivalent CpG, and cyclic multivalent CpG-aptamer at the same concentration for 24 hours in an incubator. The cells were harvested, blocked, and then incubated with CD80 and CD86 antibodies. The results showed that at the same concentration, cyclic multivalent CpG-aptamer had a more pronounced effect on CD80 and CD86 activation.
[0251] ELISA was used to analyze IL6 and TNFα secretion by RAW264.7 cells. RAW264.7 cells were incubated with CpG, cyclic multivalent CpG, and cyclic multivalent CpG-aptamer at the same concentration for 24 hours. Cell supernatants were collected and IL6 and TNFα levels were measured. The results demonstrated that, at the same concentration, cyclic multivalent CpG-aptamer stimulated cells to secrete higher levels of IL6 and TNFα.
[0252] Example 20: Double-stranded circular nucleic acid for protein / polypeptide expression
[0253] The nucleic acid sequence for expressing proteins or peptides is designed to be complementary to the outer portion of a double-stranded circular nucleic acid, which is then reacted with a single-stranded circular nucleic acid. The preparation method is the same as that for circular double-stranded DNA. The circular nucleic acid construct is transfected into 293T cells using a transfection reagent, and protein expression is verified. The results demonstrate that the double-stranded circular nucleic acid exhibits enhanced protein expression.
[0254] Although the present invention is disclosed as above, the present invention is not limited thereto. Any person skilled in the art can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the scope defined by the claims.
Claims
1. A circular functional nucleic acid, characterized in that: The invention comprises a circular nucleic acid and a functional conjugate, wherein the functional conjugate is connected to the circular nucleic acid, and the functional conjugate comprises one or more of nucleic acid, drug, and nucleic acid-drug complex.
2. The circular functional nucleic acid according to claim 1, wherein The nucleic acid in the circular nucleic acid includes any one or more of DNA, RNA, microRNA, siRNA, shRNA, and lncRNA.
3. The circular functional nucleic acid according to claim 2, wherein The nucleic acid in the functional conjugate includes one or more of nucleic acid aptamers, ASOs, CpGs, DNA enzymes, and RNAs; the drug includes one or more of cytotoxic drugs, small molecule targeted drugs, immune checkpoint inhibitors, hormone drugs, immune agonists, or small molecule diagnostic agents; the nucleic acid-drug complex includes one or more of nucleic acid-antibody conjugates, nucleic acid-nanoantibody conjugates, nucleic acid-single-chain antibody conjugates, and nucleic acid-polypeptide conjugates.
4. The circular functional nucleic acid according to claim 3, wherein The circular nucleic acid is a double-stranded circular nucleic acid or a single-stranded circular nucleic acid.
5. The circular functional nucleic acid according to claim 4, wherein The circular nucleic acid is a double-stranded circular nucleic acid, comprising an inner circular single strand and an outer complementary short strand; the sequence and number of the outer complementary short strand are designed to match the sequence and length of the inner circular single strand.
6. The circular functional nucleic acid according to claim 5, wherein The functional conjugate is connected to the outer complementary short chain of the double-stranded circular nucleic acid; and the number of the functional conjugate is 1 or more.
7. The circular functional nucleic acid according to claim 6, wherein The number of the functional conjugates is 3-6, and they are evenly distributed on the outer complementary short chains of the double-stranded circular nucleic acid.
8. The circular functional nucleic acid according to claim 5, wherein The nucleic acid of the inner circular single chain, the outer complementary short chain or the functional conjugate may be modified, and the modification includes one or more of phosphate backbone modification, base modification, nucleotide modification, enzyme modification, methylation modification and phosphorylation modification.
9. A method for preparing a circular functional nucleic acid, characterized in that: The following steps are involved: (1) Synthesis of inner circular single chain; (2) synthesizing an outer complementary short chain, to which a functional conjugate is connected; the functional conjugate comprises one or more of a nucleic acid, a drug, or a complex of a nucleic acid and a drug. (3) The inner circular single strand reacts with the outer complementary short strand to synthesize circular functional nucleic acid.
10. The preparation method according to claim 9, characterized in that The method for synthesizing the inner circular single strand in step (1) comprises: separately synthesizing a linear single strand and a splint DNA, ligating the linear single strand and the splint DNA to form a closed loop structure, and cutting off the splint DNA on the closed loop structure to obtain the inner circular single strand; the sequence of the splint DNA is completely complementary to the 10 to 30 base sequences on both sides of the 5' and 3' ends of the linear single strand.
11. The preparation method according to claim 9, wherein The ligation reaction system contains T4 nucleic acid ligase, and the T4 nucleic acid ligase includes one or more of T4 DNA ligase and T4 RNA ligase.
12. The preparation method according to claim 10, wherein The linear single strand includes a nucleotide sequence as shown in any one or more of SEQ ID NOs. 1 to 4 in the sequence listing; the splint DNA includes a nucleotide sequence as shown in SEQ ID NO. 5 in the sequence listing.
13. The preparation method according to claim 9, wherein The outer complementary short chain in step (2) includes any one or more of X-1, X-2, X-3, X-4, X-5, and X-6; wherein X-1=tctccgttccSagcacatcct, X-2=ctctgaccagSgtccttcact, X-3=cacgcgttttStgcagtcctc, X-4=ggctccttggSgttgcgatct, X-5=gttggtcagtScgattccggt, X-6=cgtgttagctSgcagatggca; the S is a functional conjugate.
14. The preparation method according to claim 9, wherein During the reaction of the inner circular single chain and the outer complementary short chain in step (3), when the linear single chain used to prepare the inner circular single chain has the nucleotide sequence shown in SEQ ID NO.1, the outer complementary short chain includes X-1, X-3 and X-4; when the linear single chain used to prepare the inner circular single chain has the nucleotide sequence shown in SEQ ID NO.2, the outer complementary short chain includes X-1, X-2, X-3 and X-4; when the linear single chain used to prepare the inner circular single chain has the nucleotide sequence shown in SEQ ID NO.3, the outer complementary short chain includes X-1, X-2, X-3, X-4 and X-5; when the linear single chain used to prepare the inner circular single chain has the nucleotide sequence shown in SEQ ID NO.4, the outer complementary short chain includes X-1, X-2, X-3, X-4, X-5 and X-6.
15. The preparation method according to claim 9, wherein When the functional conjugate is an ASO, the outer complementary short chain is X-1, 3, 5, and the S sequence does not exist; the outer complementary short chain is X-2, 4, 6, and S is one or more ASO sequences; when the functional conjugate is an ASO and a nucleic acid aptamer, the outer complementary short chain is X-1, 3, 5, and the S sequence is a nucleic acid aptamer, and the outer complementary short chain is X-2, 4, 6, and S is one or more ASO sequences; when the functional conjugate is CpG, the outer complementary short chain is X-1, 3, 5, and the S sequence does not exist; X-2, 4, 6, and S is one or more CpG sequences; when the functional conjugate is CpG and a nucleic acid aptamer, the outer complementary short chain is X-1, 3, 5, and the S sequence is a nucleic acid aptamer, and X-2, 4, 6, and S is one or more CpG sequences.
16. The preparation method according to claim 9, wherein When the functional conjugate is a nucleic acid-drug complex, its preparation process also includes preparing an outer complementary short chain X-R1-R3-R2-Y, wherein X is a nucleic acid with a complementary short chain, R1 is a modifying group of X, R3 is a connecting group between X and the drug, Y is the drug, and R2 is a modifying group of Y. The method for synthesizing X-R1-R3-R2-Y includes: reacting the outer complementary short chain X-R1-R3-R2-Y in a molar ratio of X-R1 to Y-R2 at 1:(1-10), using a PBS buffer, shaking at 500-2000 rpm, reacting overnight, and ultrafiltration to obtain the outer complementary short chain X-R1-R3-R2-Y.
17. A method for preparing a circular nucleic acid, characterized in that: The following steps are involved: (a) Synthesis of inner circular single chain; (b) synthesizing outer complementary short chains; (c) The single-stranded circular nucleic acid reacts with the outer complementary short chain to synthesize the circular nucleic acid.
18. Use of a circular functional nucleic acid for preparing a reagent for improving the affinity between a nucleic acid aptamer and a target, characterized in that: The circular functional nucleic acid comprises an inner circular single chain and an outer complementary short chain, and the outer complementary short chain is connected to a nucleic acid aptamer.
19. Use of a circular functional nucleic acid for preparing a reagent for improving tumor targeting ability, characterized in that: The circular functional nucleic acid comprises an inner circular single chain and an outer complementary short chain, and the outer complementary short chain is connected to a nucleic acid aptamer.
20. Use of a circular functional nucleic acid for preparing an agent for prolonging retention in a tumor, characterized in that: The circular functional nucleic acid comprises an inner circular single chain and an outer complementary short chain, and the outer complementary short chain is connected to a nucleic acid aptamer.