Zearalenone degrading enzyme fusion protein with high thermal stability as well as preparation method and application of zearalenone degrading enzyme fusion protein

By fusing zearalenone-degrading enzyme with rubredoxin PfRub to form a highly thermostable fusion protein, the problem of reduced activity of zearalenone-hydrolase at high temperatures was solved, achieving efficient removal effects in industrial applications.

CN120682371APending Publication Date: 2025-09-23BEIJING UNIV OF CHEM TECH
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202410330941.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-03-22
Publication Date
2025-09-23

AI Technical Summary

Technical Problem

Existing zearalenone hydrolase has poor thermal stability and cannot maintain activity at temperatures above 70°C required for practical industrial applications, resulting in low removal efficiency and the risk of secondary pollution.

Method used

By fusing zearalenone-degrading enzyme with rubredoxin PfRub, highly thermostable fusion proteins, including PfRub-2M and PfRub-2M-PfRub, are formed, thereby enhancing their stability at high temperatures.

Benefits of technology

The thermal stability of zearalenone-degrading enzyme was significantly improved, so that it still retained high enzyme activity at 70℃, 75℃, 80℃ and 100℃, making it suitable for removal applications in industrial feed and food.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120682371A_ABST
    Figure CN120682371A_ABST
Patent Text Reader

Abstract

The invention relates to a zearalenone degrading enzyme fusion protein with high thermal stability as well as a preparation method and application of the zearalenone degrading enzyme fusion protein. The fusion protein is a zearalenone degrading enzyme and red redoxin fusion protein, the N end or two ends of the zearalenone degrading enzyme are connected with the red redoxin, and the red redoxin has an amino acid sequence as shown in SEQ ID NO: 2. The obtained fusion protein is subjected to enzyme activity and thermal stability analysis, it is found that the fusion protein with high thermal stability can be obtained by adding red redoxin to the N end or the two ends of the zearalenone degrading enzyme, and the method has important significance in the aspects of practical application and the like of the zearalenone degrading enzyme in the industry; and the requirements of social production are better met.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of bioengineering technology, and in particular to a high-thermostability zearalenone-degrading enzyme fusion protein, a preparation method and an application thereof. Background Art

[0002] Zearalenone (ZEN), also known as F-2 toxin, is a mycotoxin produced by Fusarium spp. and commonly found in cereals such as corn, wheat, and barley. ZEN exhibits hepatotoxic, immunotoxic, and genotoxic properties, affecting tumorigenesis. It also induces oxidative stress, leading to DNA fragmentation, micronucleus formation, chromosomal aberrations, and ultimately cell apoptosis or necrosis. The toxicity of ZEN poses a significant threat to the feed and food industries, and effective methods to degrade or remove ZEN are urgently needed.

[0003] Compared to physical and chemical removal methods, which are cost-effective and may cause secondary contamination, biological methods using zearalenone hydrolases are both cost-effective and highly efficient, without introducing secondary contamination. Several ZEN lactone hydrolases have been identified, including ZHD101 from Clonostachys Rosea, ZENC from Neurospora Crassa, CbZHD from Cladophialophora Bantiana, ZENG from Gliocladium Roseum, Zhd518 from Rhinoccladiella Mackenzie, and ZHD607 from Phialophora Americana. However, all of the ZEN lactone hydrolases identified so far exhibit poor thermostability, losing almost all activity after treatment at 55°C for 10 minutes. ZHD518 from Rhinoccladiella Mackenzie is the most thermostable lactone hydrolase reported to date, with residual enzyme activity of approximately 80% and 40% after treatment at 50°C and 55°C for 10 minutes and 6 minutes, respectively. Wang et al. further modified ZHD518 in patent 202111322894.2. The mutant 2M (ZHD518-V156H-V144G) increased the enzyme activity of ZHD518 by more than 3 times. However, the thermal stability is far from reaching the temperature of more than 70°C required for practical industrial applications. Therefore, there is an urgent need for a method that can significantly improve the thermal stability of corn zearalenone hydrolase.

[0004] Gene fusion expression strategy is an important solution, that is, to improve the thermal stability of proteins through fusion expression strategy. Rubredoxin (PfRub) from the hyperthermophile Pyrococcus furiosus is a small molecule iron-sulfur protein composed of 53 amino acids. It is one of the most heat-resistant proteins known. The heat resistance of PfRub mainly depends on the special hydrogen bonds, a large number of alanine residues and β-folds in its structure. In view of this, the present invention provides a high-thermostable zearalenone-degrading enzyme fusion protein and its preparation method and application. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to provide a high-thermostable zearalenone-degrading enzyme fusion protein and its preparation method and application. The purpose is to improve the thermal stability of zearalenone-degrading enzyme by fusing zearalenone-degrading enzyme with rubredoxin.

[0006] The technical solution of the present invention to solve the above technical problems is as follows:

[0007] In a first aspect, a fusion protein is provided, wherein the fusion protein is a fusion protein of a zearalenone-degrading enzyme and a rubredoxin, wherein the N-terminus or both ends of the zearalenone-degrading enzyme are connected to the rubredoxin, and the rubredoxin has the amino acid sequence shown in SEQ ID NO: 2.

[0008] Among them, the fusion protein of the present invention also includes a protein obtained by connecting a tag to the N-terminus or / and C-terminus of the fusion protein, or a protein that has more than 80%, more than 85%, more than 90%, more than 95%, more than 98%, more than 99% identity with the fusion protein and has high thermal stability, or a protein that has one or more amino acid residues substituted, and / or deleted, and / or added to the fusion protein and has high thermal stability. The term "identity" used above refers to sequence similarity with a natural nucleic acid sequence. Identity can be evaluated with the naked eye or computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0009] The beneficial effect of the present invention is that the present invention performs enzyme activity and thermal stability analysis on the obtained fusion protein and finds that by adding rubredoxin (PfRub) to the N-terminus or both ends of the zearalenone-degrading enzyme, a fusion protein with high thermal stability can be obtained, which has important application value.

[0010] Furthermore, the zearalenone-degrading enzyme has an amino acid sequence shown in SEQ ID NO: 1.

[0011] Furthermore, the fusion protein is PfRub-2M or PfRub-2M-PfRub. After treatment at 70°C, 75°C, 80°C, and 100°C for 10 minutes, the fusion protein PfRub-2M has approximately 38%, 30%, 22%, and 20% remaining enzyme activity, respectively; and after treatment at 70°C, 75°C, 80°C, and 100°C for 10 minutes, the fusion protein PfRub-2M-PfRub has approximately 82%, 74%, 65%, and 45% remaining enzyme activity, respectively.

[0012] The PfRub-2M is a zearalenone-degrading enzyme (having the amino acid sequence shown in SEQ ID NO: 1) with rubredoxin (having the amino acid sequence shown in SEQ ID NO: 2) linked to the N-terminus. The PfRub-2M-PfRub is a zearalenone-degrading enzyme (having the amino acid sequence shown in SEQ ID NO: 1) with rubredoxin (having the amino acid sequence shown in SEQ ID NO: 2) linked to both the N-terminus and the C-terminus.

[0013] The second aspect provides a coding gene, wherein the coding gene encodes the fusion protein.

[0014] The coding gene may be DNA, such as cDNA, genomic DNA or recombinant DNA.

[0015] The third aspect provides a recombinant plasmid, which comprises the coding gene.

[0016] Furthermore, the vector of the recombinant plasmid is pET28a.

[0017] In a fourth aspect, a recombinant bacterium comprising the recombinant plasmid is preferably an Escherichia coli BL21 (DE3) strain.

[0018] A fifth aspect is a method for preparing a fusion protein, comprising the following steps:

[0019] (1) preparing a recombinant plasmid, and transforming the recombinant plasmid into a host to obtain a recombinant bacterium;

[0020] (2) inducing the recombinant bacteria with an inducer to obtain bacteria containing the recombinant plasmid expressed intracellularly, and disrupting the recombinant bacteria to obtain a crude enzyme solution;

[0021] (3) Separating and purifying the crude enzyme solution to obtain a fusion protein of zearalenone-degrading enzyme and rubredoxin.

[0022] Furthermore, the inducer in step (2) is IPTG (Isopropylβ-D-Thiogalactoside), and the specific dosage can be 0.05-1mM; in step (3), the crude enzyme solution is separated and purified by a nickel column and a desalting column in sequence.

[0023] In a sixth aspect, a fusion protein is used for the degradation of zearalenone. Preferably, the fusion protein of the zearalenone-degrading enzyme and rubredoxin is used to remove zearalenone from industrial feed or food. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 This is the electrophoresis diagram of the purification of the zearalenone-degrading enzyme and rubredoxin fusion protein of the present invention; wherein 1 to 4 are 2M, 2M-PfRub, PfRub-2M, and PfRub-2M-PfRub, respectively;

[0025] Figure 2 Determination of the relative enzyme activity of the zearalenone-degrading enzyme and the rubredoxin fusion protein of the present invention;

[0026] Figure 3 The invention relates to a thermal stability test of the zearalenone-degrading enzyme and rubredoxin fusion protein. DETAILED DESCRIPTION

[0027] The principles and features of the present invention are described below. The examples are only used to explain the present invention and are not intended to limit the scope of the present invention. Where specific techniques or conditions are not specified in the examples, the techniques or conditions described in the literature in this field or the product instructions are used. Where the manufacturers of the reagents or instruments used are not specified, they are all conventional products that can be purchased through regular channels.

[0028] Example 1: Construction and expression purification of zearalenone-degrading enzyme and rubredoxin fusion protein vector

[0029] 1. Construction of recombinant expression vector

[0030] 1.1 Construction of pET28a-2M vector

[0031] The 2M fragment was constructed in the pET28a vector (purchased from Qingke Biotechnology) using pET28a-ZHD518 as a template and reverse amplification PCR. The primer sequences used are as follows:

[0032] 2M-F:5'GTTGCACATTCACGAAGGTGACCCAGCCACTATCTCTCAAGAAATG3'(SEQ ID NO:3)

[0033] 2M-R:5'GCTCTGGAGTGTGCAGCCATTTCTTGAGAGATAGTGGCTG3'(SEQ ID NO:4)

[0034] Table 1 Reverse amplification PCR system

[0035]

[0036]

[0037] The PCR reaction system is shown in Table 1; PCR reaction conditions: 25 cycles of pre-denaturation at 98°C for 30 seconds, denaturation at 98°C for 30 seconds, annealing at 55°C for 5 seconds, and extension at 72°C for 35 seconds, followed by a final extension at 72°C for 10 minutes. The PCR product was tested for yield and specificity by 0.8% agarose gel electrophoresis and purified using a DNA purification kit (purchased from Nanjing Novozymes Biotechnology Co., Ltd.). After digestion with Dpn I (purchased from NEB), the product was transformed into Escherichia coli DH5α cloning competent cells (purchased from Qingke Biotechnology). Three transformants were selected for sequencing to obtain the correct recombinant vector, designated pET28a-2M, which carries the nucleotide sequence expressed in SEQ ID NO. 1.

[0038] 1.2 Construction of recombinant expression vector pET28a-2M-PfRub

[0039] Using the recombinant plasmid pET28a-2M nucleotide sequence as a template, wherein the amino acid sequence of 2M is shown in SEQ ID NO: 1, the PfRub sequence was connected to the C-terminus of pET28a-2M by multi-segment extension PCR to obtain the fusion protein plasmid pET28a-2M-PfRub.

[0040] SEQ ID NO: 1

[0041]

[0042] PCR reaction conditions included 25 cycles of pre-denaturation at 98°C for 30 seconds, denaturation at 98°C for 30 seconds, annealing at 55°C for 5 seconds, and extension at 72°C for 35 seconds, followed by a final extension at 72°C for 10 minutes. The PCR product was tested for yield and specificity using 0.8% agarose gel electrophoresis and purified using a DNA purification kit. The purified PCR product was ligated using a homologous recombination kit (purchased from Nanjing Novozymes Biotechnology Co., Ltd.) and transformed into Escherichia coli DH5α cloning competent cells (purchased from Qingke Biotechnology). Three transformants were selected for sequencing to confirm the correct recombinant vector.

[0043] 1.3 Construction of recombinant expression vector pET28a-PfRub-2M

[0044] Using the nucleotide sequence of the recombinant plasmid pET28a-2M as a template, the PfRub sequence was ligated to the N-terminus of pET28a-2M via multi-stage extension PCR to generate the fusion protein plasmid pET28a-PfRub-2M. The specific reaction conditions were the same as in 1.1. The primers for the multi-stage extension PCR are shown in Table 2. The amino acid sequence of PfRub is shown in SEQ ID NO: 2:

[0045]

[0046] 1.4 Construction of the recombinant expression vector pET28a-PfRub-2M-PfRub

[0047] Using the nucleotide sequence of the recombinant plasmid pET28a-2M-PfRub as a template, the PfRub sequence was ligated to the N-terminus of pET28a-2M-PfRub via multi-stage extension PCR to generate the fusion protein plasmid pET28a-PfRub-2M-PfRub. The reaction conditions were the same as in 1.1. The primers for the multi-stage extension PCR are listed in Table 2.

[0048] The primers used in the above experiments are shown in Table 2.

[0049] Table 2 Primer sequences

[0050]

[0051]

[0052] 2. Preparation of engineered bacteria

[0053] 2.1 Preparation of engineered bacteria BL21 / pET28a-2M-PfRub

[0054] pET28a-2M-PfRub was transformed into the BL21 (DE3) expression strain, and then spread on an LB plate containing 50 μg / mL kanamycin and cultured overnight at 37°C to obtain recombinant bacteria containing the plasmid pET28a-2M-PfRub, which was recorded as BL21 / pET28a-2M-PfRub.

[0055] 2.2 Preparation of engineered bacteria BL21 / pET28a-PfRub-2M

[0056] Transform pET28a-PfRub-2M into the BL21(DE3) expression strain to obtain the engineered strain BL21 / pET28a-PfRub-2M. The steps are the same as in 2.1.

[0057] 2.3 Preparation of engineered bacteria BL21 / pET28a-PfRub-2M-PfRub

[0058] Transform pET28a-PfRub-2M-PfRub into the BL21(DE3) expression strain to obtain BL21 / pET28a-PfRub-2M-PfRub. Follow the same steps as in 2.1.

[0059] Transform BL21(DE3) with pET28a-2M as in step 2.1 to obtain recombinant bacteria containing pET28a-2M as a control. Positive recombinant bacteria transformed into BL21(DE3) are designated as BL21 / pET28a-2M.

[0060] 3. Expression and purification of target protein

[0061] 3.1 Expression and purification of fusion protein 2M-PfRub

[0062] His60 Ni Superflow resin purification column was purchased from TaKaRa, with the product catalog number being 635660. GE HiTrap Desalting purification column was purchased from GE Healthcare, with the product catalog number being 17-1408-01.

[0063] The positive recombinant bacteria BL21 / pET28a-PfRub-2M-PfRub prepared in step 2 above were inoculated into 2 mL of LB medium containing 50 μg / mL kanamycin (1 g of peptone, 0.5 g of yeast powder, and 1 g of NaCl were used per 100 mL of LB; peptone and yeast powder were purchased from Thermo Fisher Scientific, and NaCl was purchased from Sinopharm Chemical Reagent Co., Ltd.), and cultured at 37°C for 12 h to obtain seed solution. A 1% inoculum was added to 100 mL of LB medium containing 50 μg / mL kanamycin and cultured at 37°C until 0 D 600 =0.6-0.8, and at the same time, 0.1 mM IPTG (purchased from Beijing Biotoda Technology Co., Ltd.) was added, and the culture was continued at 18°C ​​for 16-18h.

[0064] Cells were harvested by centrifugation at 4000 rpm for 10 min, resuspended in pre-chilled 50 mM Tris-HCl, pH 8.0, and disrupted using an ultrasonic disruptor (42% power, 2s on / 2s off, for 10 min). The supernatant was centrifuged at 12000 rpm for 10 min. The supernatant was purified using a nickel column and desalted using a desalting column. Purification was performed using buffer A (20 mM imidazole, 50 mM Tris, 500 mM NaCl, pH 8.0), buffer B (35 mM imidazole, 50 mM Tris, 500 mM NaCl, pH 8.0), and buffer C (500 mM imidazole, 50 mM Tris, 500 mM NaCl, pH 8.0). Desalting buffer was 50 mM Tris-HCl, pH 8.0.

[0065] SDS-PAGE electrophoresis showed that the molecular weight of the purified 2M-PfRub fusion protein was 36 kDa, which was consistent with the expected protein size. Figure 1 .

[0066] 3.2 Expression and purification of fusion protein PfRub-2M

[0067] The purification method was the same as that in 3.1 above. SDS-PAGE electrophoresis showed that the purified PfRub-2M fusion protein had a molecular weight of 36 kDa, which was consistent with the expected protein size. Figure 1 .

[0068] 3.3 Expression and purification of the fusion protein PfRub-2M-PfRub

[0069] The purification method was the same as that in 3.1 above. SDS-PAGE electrophoresis showed that the purified PfRub-2M-PfRub fusion protein had a molecular weight of 42 kDa, which was consistent with the expected protein size. Figure 1 .

[0070] The purified 2M protein was used as a control, and the protein molecular weight was 29.8 kDa. Figure 1 .

[0071] Example 3: Determination of enzyme activity and thermal stability of zearalenone-degrading enzyme and rubredoxin fusion protein

[0072] 1. Enzyme activity determination

[0073] Definition: The enzyme activity unit is defined as the amount of enzyme required to degrade 1 μg of substrate zearalenone within 1 min as one enzyme activity unit U.

[0074] The pure PfRub-2M-PfRub enzyme solution of Example 2 was diluted with 50 mM Tris-HCl buffer at pH 8.0, and the enzyme activity was measured using the diluted enzyme solution, which was recorded as the diluted enzyme solution.

[0075] Solution A consists of 50 mM Tris-HCl buffer (pH 8.0) and zearalenone solution; the final concentration of the substrate zearalenone in 0.5 mL of the reaction system is 20.0 μg / ml.

[0076] Experimental group: The activity assay reaction system consisted of 0.5 mL of solution A, 0.48 mL of solution A, 0.01 mL of diluted enzyme solution, and 0.01 mL of substrate; the pH of the reaction system was 8.0. After incubation at 40°C for 10 min, the reaction was terminated with 0.5 mL of chromatography-grade methanol. After cooling, the amount of substrate degradation was determined using high-performance liquid chromatography (HPLC).

[0077] 2. Protein concentration determination method

[0078] According to the instructions of BIO-RAD Quick StartTM Bradford Protein Assay Kit (purchased from BIO-RAD, catalog number: 5000201), pure BSA bovine serum albumin (purchased from Shanghai Biyuntian Biotechnology Co., Ltd.) was prepared into a 0.5 mg / mL protein solution according to its purity with 50mM Tris-HCl buffer at pH 8.0. 0, 1μL, 2μL, 4μL, 8μL, 12μL, 16μL and 20μL of the standard protein solution were aspirated and the volume was adjusted to 20μL with 50mM Tris-HCl buffer at pH 8.0; the sample protein was mixed with 50mM Tris-HCl buffer at pH 8.0 in a certain proportion, and the total volume was 20μL. 5μL of protein solution was reacted with 200μL 1x dye reagent for 5min, the absorbance OD value was measured at 595nm, and the protein concentration and OD value were plotted. 595 The standard curve of

[0079] 3. Comparison of enzyme activity

[0080] 3.1 Comparison of 2M-PfRub enzyme activity

[0081] The specific enzyme activity was obtained by dividing the enzyme activity by the protein concentration. The experimental results are as follows: Figure 2 show, Figure 2The results showed that the zearalenone-degrading enzyme and rubredoxin fusion protein had zearalenone-degrading activity. At pH 8.0 and 40°C, the relative activity was calculated as the ratio of the zearalenone degradation by the fusion protein to the wild-type protein, with the degradation of zearalenone as 100% at 2 M zearalenone in the enzyme reaction system. Figure 2 The results showed that under the conditions of pH 8.0 and 40°C, the enzyme activity of the fusion protein 2M-PfRub towards the substrate zearalenone was 97% of that of the control group 2M.

[0082] The experiment was repeated three times and the results were consistent.

[0083] 3.2 Comparison of PfRub-2M enzyme activity

[0084] The method for determining the specific enzyme activity is the same as that in 4.1. Figure 2 The results showed that under the conditions of pH 8.0 and 40°C, the enzyme activity of the fusion protein 2M-PfRub towards the substrate zearalenone was 90% of that of the control group 2M.

[0085] The experiment was repeated three times and the results were consistent.

[0086] 3.3 Comparison of PfRub-2M-PfRub enzyme activity

[0087] The method for determining the specific enzyme activity is the same as that in 4.1. Figure 2 The results showed that at pH 8.0 and 40°C, the enzyme activity of the fusion protein 2M-PfRub towards the substrate zearalenone was 73% of that of the control group 2M.

[0088] The experiment was repeated three times and the results were consistent.

[0089] 4. Comparison of thermal stability

[0090] 4.1 Comparison of thermal stability of 2M-PfRub

[0091] The thermal stability of the enzyme at different temperatures was obtained by dividing the residual enzyme activity after treatment at different temperatures (65°C, 70°C, 75°C, 80°C, 100°C) for 10 min by the initial enzyme activity without treatment. Figure 3 The results showed that the zearalenone-degrading enzyme and rubredoxin fusion protein 2M-PfRub and the control 2M protein lost almost all enzyme activity after treatment at 65℃ for 10min, and the thermal stability was not improved.

[0092] The experiment was repeated three times and the results were consistent.

[0093] 4.2 Comparison of PfRub-2M Thermal Stability

[0094] The thermal stability determination method is the same as 4.1. Figure 3 The results showed that the fusion protein PfRub-2M retained approximately 54% of its enzymatic activity after treatment at 65°C for 10 minutes, while the control 2M protein lost almost all of its enzymatic activity after treatment at 65°C for 10 minutes, significantly improving its thermal stability. Further increasing the heat treatment temperature, the fusion protein PfRub-2M retained approximately 38%, 30%, 22%, and 20% of its enzymatic activity after treatment at 70°C, 75°C, 80°C, and 100°C for 10 minutes, respectively.

[0095] The experiment was repeated three times and the results were consistent.

[0096] 4.3 Comparison of thermal stability of PfRub-2M-PfRub

[0097] The thermal stability determination method is the same as 4.1. Figure 3 The results showed that the fusion protein PfRub-2M-PfRub retained approximately 90% of its enzymatic activity after treatment at 65°C for 10 minutes, while the control 2M protein lost almost all of its enzymatic activity after treatment at 65°C for 10 minutes, significantly improving its thermal stability. Further increasing the heat treatment temperature, the fusion protein PfRub-2M-PfRub retained approximately 82%, 74%, 65%, and 45% of its enzymatic activity after treatment at 70°C, 75°C, 80°C, and 100°C for 10 minutes, respectively.

[0098] The experiment was repeated three times, and the results were consistent. In summary, the present invention constructs the fusion proteins PfRub-2M and PfRub-2M-PfRub of zearalenone-degrading enzyme (2M) and rubredoxin PfRub, and the provided fusion proteins have greatly improved thermal stability, which is of great significance for industrial applications in feed and food, and is more conducive to meeting the needs of social production.

[0099] Although the embodiments of the present invention have been shown and described above, it will be understood that the above embodiments are illustrative and are not to be construed as limitations on the present invention. A person skilled in the art may change, modify, replace and modify the above embodiments within the scope of the present invention.

Claims

1. A fusion protein, characterized in that The fusion protein is a fusion protein of zearalenone degrading enzyme and rubredoxin. The N-terminus or both ends of the zearalenone degrading enzyme are connected to the rubredoxin, and the rubredoxin has the amino acid sequence shown in SEQ ID NO:

2.

2. A fusion protein according to claim 1, characterized in that The zearalenone-degrading enzyme has an amino acid sequence shown in SEQ ID NO:

1.

3. A fusion protein according to claim 1, characterized in that The fusion protein is PfRub-2M or PfRub-2M-PfRub.

4. A coding gene, characterized in that The coding gene encodes the fusion protein according to any one of claims 1 to 3.

5. A recombinant plasmid, characterized in that: The recombinant plasmid comprises the coding gene according to claim 4.

6. A recombinant plasmid according to claim 5, characterized in that, The carrier of the recombinant plasmid is pET28a.

7. A recombinant bacterium, characterized in that Comprising the recombinant plasmid according to claim 5 or 6.

8. A method for preparing a fusion protein according to any one of claims 1 to 3, characterized in that: The steps include: (1) preparing a recombinant plasmid, and transforming the recombinant plasmid into a host to obtain a recombinant bacterium; (2) inducing the recombinant bacteria with an inducer to obtain bacteria containing the recombinant plasmid expressed intracellularly, and disrupting the recombinant bacteria to obtain a crude enzyme solution; (3) Separating and purifying the crude enzyme solution to obtain a fusion protein of zearalenone-degrading enzyme and rubredoxin.

9. The method for preparing a fusion protein according to claim 8, characterized in that: The inducer in step (2) is IPTG; in step (3), the crude enzyme solution is separated and purified by passing through a nickel column and a desalting column in sequence.

10. An application of a fusion protein, characterized in that: The fusion protein according to any one of claims 1 to 3 is used for the degradation of zearalenone.

Citation Information

Patent Citations

  • A mutant of neutral zearalenone-degrading enzyme with enhanced enzyme activity

    CN114045276B