Saccharomyces cerevisiae and application thereof in blueberry fruit wine
By screening the brewer's yeast SAU-M4 with a slow ethanol production rate to ferment blueberry wine, the problem of weak fermentation ability of non-brewer yeast was solved, and the flavor of the wine was enriched and the sensory quality was improved.
Patent Information
- Application Number
- CN202510751596.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-06
- Publication Date
- 2025-09-23
AI Technical Summary
In the existing technology, non-brewing yeast has weak fermentation ability and insufficient alcohol resistance during the fruit wine fermentation process, resulting in a short fermentation time and inability to fully utilize sugar. In addition, commercial brewing yeast is not suitable for mixed fermentation and cannot form a rich fruit wine flavor.
Screening and providing a brewer's yeast SAU-M4 with a slow ethanol production rate, by fermenting blueberry wine, improving fermentation capacity and the production of aroma substances, thereby enhancing the overall aroma complexity of the wine.
The fermentation time was extended, the alcohol content of the wine was reduced, the content of glycerol and flavor substances was increased, and the overall aroma complexity and sensory quality of the blueberry wine were improved.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] The present invention relates to the field of microbial technology, and specifically to the screening of a low-ethanol-producing brewer's yeast, the fermentation characteristics of the strain, and the fermentation application of the yeast in blueberry wine. Background Art
[0002] In recent years, non-Saccharomyces yeasts have gained increasing attention in fruit winemaking. Co-fermentation of non-Saccharomyces yeasts with Saccharomyces yeasts can impart unique flavor, aroma, and complexity to fruit wines. However, non-Saccharomyces yeasts have weak fermentation capacity and poor alcohol tolerance, primarily acting in the early stages of fermentation. As fermentation progresses, ethanol concentrations in the environment increase, inhibiting or even killing the non-Saccharomyces yeasts. Therefore, delaying alcohol production during fermentation provides ample time for non-Saccharomyces yeasts to carry out their metabolic activities. Commercial Saccharomyces yeasts have a fast fermentation rate and strong stress tolerance, rapidly consuming nutrients to produce ethanol and inhibiting other microorganisms, but are not suitable for mixed fermentations. Selecting Saccharomyces yeasts with slow ethanol production rates facilitates the gradual release of aroma compounds as alcohol is produced, resulting in a more harmonious and complex flavor profile. Studies have shown that selecting low-ethanol-producing Saccharomyces yeasts for fermentation of fruit wines not only reduces the alcohol content but also increases the glycerol and aroma compounds content, thereby enhancing the overall aroma complexity and sensory quality of the wine. The brewer's yeast SAU-M4 provided by the present invention has a slow ethanol production rate and can fully utilize the sugar in the environment for fermentation. In addition, the fermentation of blueberry wine using the yeast can also increase the overall flavor substance content and variety of the blueberry wine. Summary of the Invention
[0003] The present invention aims to screen and provide a brewer's yeast SAU-M4 with a slow ethanol production rate and sufficient fermentation capacity, and use the yeast to ferment blueberry wine, thereby providing a suitable strain resource for blueberry wine brewing.
[0004] The strain provided by the present invention is Saccharomyces cerevisiae SAU-M4, which is deposited in the General Microbiology Center (CGMCC) of the China Culture Collection Administration, address: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, with a deposit number of CGMCC No. 34303 and a deposit date of April 22, 2025.
[0005] The Saccharomyces cerevisiae SAU-M4 was isolated from fresh blueberries and, after purification, primary screening, and secondary screening, was identified as having a slow ethanol production rate and sufficient fermentation capacity. Its storage conditions were as follows: a single colony was picked from a well-growing plate and transferred to YPD medium. Cultured at 28°C for 48 hours, 600 μL of the culture was transferred to a storage tube containing 600 μL of 60% glycerol and stored in a -20°C freezer.
[0006] The YPD medium formula is 1 g yeast extract, 2 g peptone, 2 g glucose, 100 mL distilled water, natural pH, and if a solid medium is required, 2% agar is added.
[0007] Triple M simulated grape juice (1 L): ergo stock (50 mL): 12.5 mL Tween 80, 37.5 mL 95% ethanol, and 0.125 g ergosterol. Stock solution I: 100 g glucose, 100 g fructose, and 4 mL ergo stock, diluted to 500 mL with distilled water; Stock solution II: 6 g tartaric acid, 3 g malic acid, and 0.5 g citric acid, diluted to 250 mL with distilled water; Stock solution III: 1.7 g Yeast basal nitrogen base (YNB), 2 g hydrolyzed casein, 6 mg inositol, 0.2 g anhydrous calcium chloride, 0.8 g L-arginine, 1 g L-proline, 0.1 g tryptophan, and 1 g ammonium phosphate, diluted to 250 mL with distilled water. Stock solutions I, II, and III were mixed, adjusted to pH 3.25 with KOH (4 mol / L), and sterilized at 110°C for 15 min.
[0008] The WL solid culture medium formula is 5 g yeast extract powder, 5 g acid hydrolyzed casein, 50 g glucose, 0.55 g potassium dihydrogen phosphate, 0.425 g potassium chloride, 0.125 g calcium chloride, 0.125 g magnesium sulfate, 0.0025 g ferric chloride, 0.0025 g manganese sulfate, 0.022 g bromocresol green, 17 g agar, 1000 mL distilled water, and sterilized at 121°C for 20 min.
[0009] The culture characteristics of the Saccharomyces cerevisiae SAU-M4 are as follows: Cultivated on YPD solid medium at 28°C for 48 hours, the colonies are round with regular edges, a smooth and moist surface, a soft and sticky texture that is easily lifted, and a glossy, opaque white color. The Saccharomyces cerevisiae SAU-M4 requires facultative anaerobiosis and, under an oil immersion lens (100×10), appears oval with unilateral budding. BRIEF DESCRIPTION OF THE DRAWINGS
[0010] Figure 1 A is the cell morphology of SAU-M4 under a 100×10 microscope, and B is the single colony morphology of SAU-M4.
[0011] Figure 2 This is a graph showing the growth of SAU-M4 strain under different SO2 concentrations.
[0012] Figure 3 This is a graph showing the growth of SAU-M4 strain at different pH levels.
[0013] Figure 4This is a graph showing the growth of SAU-M4 strain under different alcohol concentrations.
[0014] Figure 5 This is a graph showing the growth of SAU-M4 strain under different sugar contents. DETAILED DESCRIPTION
[0015] Unless otherwise specified, the experimental methods described in the following examples are all conventional methods; the reagents and biological materials described are all commercially available unless otherwise specified.
[0016] In the following examples, the percentages are by mass unless otherwise specified.
[0017] The following examples further illustrate the specific implementation of the present invention, but are not limited to these examples.
[0018] Case Study 1: Screening and Identification of Saccharomyces cerevisiae with Slow Ethanol Production
[0019] (1) Yeast enrichment, separation and purification: 15 g of fruit was weighed in a clean bench, crushed and placed in a 250 mL conical flask containing 100 mL of sterilized YPD medium, cultured at 30 °C for 24 h, and then diluted and plated. The dilution gradient was 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 Spread 100 μL of the dilution onto a WL solid plate, with triplicate dilutions for each dilution gradient. Culture the plate in a 30°C incubator for 2-3 days. Once colonies have grown on the WL solid medium, select individual colonies with distinct colors and typical yeast characteristics. Purify the colonies by streaking three to five times onto YPD plates. Once confirmed as pure strains by microscopy, inoculate the plates onto YPD slants and store them in a refrigerator at 4°C until further use. Streak the purified strain onto WL solid medium and culture it in a 30°C incubator for 2-4 days. Identify the colonies by morphology, color, and microscopic observation. Exclude any duplicated colonies, and proceed to the next step of screening.
[0020] (2) Preliminary screening of brewer's yeast with slow ethanol production rate: The activated SAU-M4 bacterial liquid was inoculated with 2% inoculum into a 250 mL fermentation bottle containing 150 mL simulated grape juice for fermentation. The fermentation bottle was sealed with a breathable sealing film and fermented at 25°C. Three parallel groups were set up for each strain. During the fermentation process, the CO2 weight loss was measured every 24 hours, and the alcohol content of the fermentation liquid was measured every 3 days. The fermentation was considered to be complete when the CO2 weight loss did not change for 72 consecutive hours. The results showed that the commercial wine fermentation had a large initial fermentation weight loss and ended on the 8th day; while the SAU-M4 had a low initial fermentation weight loss and ended on the 10th day. The fermentation was relatively slow, and the final fermentation liquid had an alcohol content of >9% Vol and a total sugar content of <4 g / L, indicating that SAU-M4 was able to fully utilize sugar for fermentation.
[0021] (3) Identification of strain SAU-M4
[0022] Morphological identification: After activating the culture in YPD liquid medium for 24 hours, use a sterile inoculation loop to pick up a loop of bacterial liquid and streak it on a YPD plate. After incubating at 30℃ for 48 hours, record the characteristics of the colony according to size, color, texture, edge shape, etc.; wash the colony with sterile saline and observe the single cell morphology under a microscope at 100 times. The colony and cell morphology of strain SAU-M4 are as follows: Figure 1 shown.
[0023] Molecular Identification: To extract the SAU-M4 genome, strain SAU-M4 was inoculated into YPD liquid culture medium and cultured on a shaker at 30°C, 200 rpm for 48 hours. The SAU-M4 genome was extracted according to the genome sequencing kit instructions. 5 μL of PCR product was separated by 1.2% (1× TAE) agarose gel electrophoresis and imaged using a UV gel imaging system. The PCR amplification product was then sent to Sangon Biotech Co., Ltd. for sequencing.
[0024] The strain SAU-M4 was sequenced and the following ITS sequence was obtained: TGGCTAGATCATATTTTGAATGGATTTTTTTGTTTTGGCAAGAGCATGAGAGCTTTTACTGGGCAAGAAGACAAGAGATGGAGAGTCCAGCCGGGCCTGCGCTTAAGTGCGCGGTCTTGCTAGGCTTGTAAGTTTCTTTCTTGCTATTCCAAACGGTGAGAGATTTCTGTGCTTTTGTTATAGGACAATTAAAA CCGTTTCAATACAACACACTGTGGAGTTTTCATATCTTTGCAACTTTTTCTTTGGGCATTCGAGCAATCGGGGCCCAGAGGTAACAAACACAAACAATTTTATCTATTCATTAAATTTTTGTCAAAAACAAGAATTTTCGTAACTGGAAATTTTAAAATATTAAAAACTTTCAACAACGGATCTCTTGGTTCTCG CATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACATTCTGTTTGGTAGTGAGTGATACTCTTTGGAGTTAACTTGAAATTGCTGGCCTTTT CATTGGATGTTTTTTTCAAAGAGAGGTTTCTCTGCGTGCTTGAGGTATAATGCAAGTACGGTCGTTTTAGGTTTTACCAACTGCGGCTAATCTTTTTTTATACTGAGCGTATTGGAACGTTATCGATAAGAAGAGAGCGTCTAGGCGAACAATGTTCTTAAAGTTGACCTCAAATCAGTAGATGCCAATCCCC
[0025] The sequences were imported into NCBI for BLAST homology comparison and, combined with morphological characteristics, the strain SAU-M4 was identified as Saccharomyces cerevisiae ( Saccharomyces cerevisiae It was deposited in the General Microbiology Center of China Culture Collection of Microorganisms (CGMCC), located at Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, with the deposit number CGMCC No. 34303 and the deposit date April 22, 2025.
[0026] Case study 2: Fermentation performance determination of strain SAU-M4
[0027] (1) SO2 tolerance test: The activated SAU-M4 strain seed liquid was inoculated at a 2% inoculum (v / v) into YPD liquid medium at SO2 concentrations of 50, 100, 150, 200, 250, and 300 mg / L, and the OD was measured after culturing at 30°C for 24 h. 600nm , draw the SO2 growth tolerance curve of yeast. Figure 2 As shown in the figure, as the SO2 concentration increases, the growth of the strain decreases.
[0028] (2) pH tolerance test: The activated SAU-M4 strain seed liquid was inoculated at a 2% inoculum (v / v) into YPD liquid culture medium with pH values of 2.5, 3.0, 3.5, 4.0, 4.5, and 5.0, respectively. The OD values were measured after culturing at 30°C for 24 h. 600nm , draw the pH growth tolerance curve of yeast. Figure 3 As shown, when the pH is 4.5, the OD value is the largest and the yeast growth is the highest. When the pH is less than 4.5, the yeast growth decreases slightly. When the pH is 2.5, the growth drops sharply, indicating that the lowest pH value that the yeast can tolerate is between 3-2.5.
[0029] (3) Alcohol tolerance test: The activated SAU-M4 strain seed liquid was inoculated with 2% inoculum (v / v) into YPD liquid medium with alcohol content (v / v) of 8%, 10%, 12%, 14%, and 16%, respectively. The OD values were measured after culturing at 30°C for 24 h. 600nm , draw the alcohol tolerance curve of yeast. Figure 4 As shown, as the alcohol concentration increases, the OD value decreases and the growth rate decreases. When the alcohol content is 12%, the yeast hardly grows, indicating that the strain can tolerate a maximum alcohol content range of 10%-12%.
[0030] (4) Sugar tolerance test: The activated SAU-M4 strain seed liquid was inoculated with 2% inoculum (v / v) into YPD liquid medium with glucose content of 50 g / L, 100 g / L, 150 g / L, 200 g / L, 250 g / L, and 300 g / L, respectively. The OD values were measured after culturing at 30°C for 24 h. 600nm , draw the sugar tolerance curve of yeast. Figure 5 As shown in the figure, when the sugar content is less than 200 g / L, the cell growth increases with the increase of sugar content, but when it is greater than 200 g / L, the cell growth decreases with the increase of sugar content, indicating that high sugar content will inhibit the growth of the strain.
[0031] Case Study 3: Volatile Compound Analysis and Sensory Analysis of Blueberry Wine Fermented with Strain SAU-M4
[0032] Mature, non-rotten blueberries were pulped, potassium metabisulfite (60 mg / kg) was added, and the soluble solids content of the fermentation broth was adjusted to 22% with white sugar. A control group inoculated with commercial Saccharomyces cerevisiae SAU-M4 served as an experimental group. Fermentation was carried out at a constant temperature of 25°C. Fermentation was stopped when the sugar content fell below 4 g / L. The broth was filtered through eight layers of gauze, sampled, and volatile compounds were determined. The broth was then transferred to a refrigerator for aging.
[0033] (1) Volatile matter determination method:
[0034] Headspace solid-phase microextraction conditions were as follows: 4 mL of sample, 1.0 g of sodium chloride, and 10 μL of 2-octanol (0.4 mg / mL) were added to the headspace vial, equilibrated at 40 °C for 20 min, and headspace adsorption was performed for 30 min.
[0035] Gas chromatography conditions: Agilent VF-Waxms column (60 m×0.25 mm, 0.5 μm), helium (He) flow rate 1 mL / min; temperature program: splitless injection; initial temperature 40°C, hold for 3 min, increase the temperature to 60°C at 2°C / min, hold for 1 min, then increase the temperature to 120°C at 4°C / min, hold for 1 min, and then increase the temperature to 240°C at 6°C / min, hold for 3 min; injection port temperature 260°C, detector temperature 260°C.
[0036] Mass spectrometry conditions: electron ionization source, interface temperature 250°C, ion source temperature 200°C, electron energy 70 eV, mass spectrometry scan range 40.00-800.00 m / z.
[0037] Volatile compound analysis revealed 46 aroma compounds detected in both blueberry wines, including 21 esters, 13 alcohols, 3 acids, 3 aldehydes, 4 terpenes, and 1 phenol. Among the ester compounds, the control group had a 991.75 μg / L ester content, while the experimental group had a 1477.52 μg / L ester content. Ethyl octanoate, ethyl caprylate, ethyl hexanoate, and ethyl acetate were found at higher levels in the experimental group, imparting a rich fruity and floral aroma. Among the alcohol compounds, the experimental group had significantly higher levels than the control group, with higher levels of isoamyl alcohol and phenylethyl alcohol, contributing to violet and rose notes. Trace acids, which modify the aroma, were not detected in the control group, while trace amounts of octanoic acid were detected in the experimental group. Terpenes can impart aromas such as berry, nutty, and floral. Four terpenes were detected in the experiment: styrene, linalool, alpha-terpineol, and beta-citronellol. The total terpene content in the experimental group was 119.15 μg / L, higher than that in the control group. 2,4-Di-tert-butylphenol contributes a phenolic or woody aroma, similar to that of certain antioxidants or industrial chemicals, rather than a typical fruity or floral aroma. 2,4-Di-tert-butylphenol was detected in both groups. In summary, blueberry wine fermented with SAU-M4 yeast has a higher content of aroma compounds and provides a richer aroma.
[0038] Table 1 Volatile substance content of blueberry wine
Claims
1. A strain of Saccharomyces cerevisiae ( Saccharomyces cerevisiae S. cerevisiae SAU-M4 is deposited at the General Microbiology Center of the China General Culture Collection Administration (CGMCC), located at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. The deposit number is CGMCC No. 34303, and the deposit date is April 22, 2025. S. cerevisiae SAU-M4 is characterized by a round colony shape with regular edges, a smooth and moist, creamy surface that is easy to lift, an opaque, shiny, milky white color, and a central bulge. The inoculant is characterized by containing S. cerevisiae SAU-M4 or being prepared from S. cerevisiae SAU-M4.
2. The bacterial agent is a freeze-dried bacterial agent; the preparation method of the freeze-dried bacterial agent comprises: The cerevisiae SAU-M4 according to claim 1 is cultured to obtain bacterial cells, and the bacterial cells are freeze-dried.
3. A method for brewing blueberry wine, comprising inoculating blueberry pulp with the brewer's yeast SAU-M4 as claimed in claim 1 and fermenting the resulting blueberry wine.