Lactobacillus salivarius D7-21 and application thereof
By adding saliva combined with Lactobacillus D7-21 to the feed, the problem of insufficient optimization of the intestinal morphology and structure of poultry by probiotic strains in the existing technology is solved, the intestinal development of chicks is promoted, and the growth performance and immune regulation ability are improved.
Patent Information
- Application Number
- CN202510904044.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-01
- Publication Date
- 2025-09-23
AI Technical Summary
In the existing technology, the research on the mechanism of optimizing the morphological structure and function of poultry intestines by specific probiotic strains is relatively weak, which affects the improvement of broiler growth performance.
Provided is a saliva-associated Lactobacillus D7-21, which has good colonization ability and acid and salt resistance. By adding the strain to feed, the intestinal development of chicks can be promoted, and additives and feed for promoting intestinal development of chicks can be prepared to improve intestinal health.
Saliva combined with Lactobacillus D7-21 showed a significant promoting effect on the development of chicken small intestine, improving the growth performance and immune regulation ability of the chicks' intestines and enhancing the stability of intestinal function.
Smart Images

Figure CN120683012A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biotechnology, and in particular to a saliva-associated lactobacillus D7-21 and an application thereof. Background Art
[0002] There is a significant correlation between the intestinal health of poultry and their growth and development efficiency. The small intestine, as the core functional area for nutrient digestion and absorption, has a physiological state that directly determines the growth rate and feed conversion efficiency of poultry. In intensive broiler farming, the integrity of intestinal development and functional stability are key factors in improving production performance. Recent studies have shown that the intestinal microbiome plays a key role in maintaining intestinal homeostasis, promoting nutrient metabolism, and enhancing immune regulation. Targeted regulation of intestinal microbial composition and promoting the colonization of beneficial bacteria has become an important technical approach to optimize broiler intestinal health and improve overall production efficiency.
[0003] Promoting healthy small intestinal development in poultry farming to enhance overall growth performance requires a combination of nutritional regulation and microbial intervention strategies. Existing research suggests that optimizing the structure and function of the intestinal microbiome, immune regulation, and improving nutrient absorption efficiency are key solutions. Current research primarily focuses on the impact of intestinal health on broiler growth, but research on the mechanisms by which specific probiotic strains optimize intestinal morphology, structure, and function remains limited. Summary of the Invention
[0004] The purpose of the present invention is to overcome the deficiencies of the prior art and provide a saliva-associated Lactobacillus D7-21 and its application; saliva-associated Lactobacillus ( Ligilactobacillus salivarius ) is a lactic acid bacterium widely present in the poultry intestine, with excellent colonization ability and multiple potential benefits. This study investigates the role and mechanism of Lactobacillus salivae D7-21 in the development of the chicken small intestine. By further exploring the effects of Lactobacillus salivae D7-21 on small intestinal development in chickens, it may provide new scientific evidence for intestinal health management in broiler chickens.
[0005] To achieve the above purpose, the technical solution designed by the present invention is as follows: The present invention provides a saliva-associated lactobacillus ( Ligilactobacillus salivarius )D7-21, its deposit number is: CCTCC NO: M 20241905.
[0006] The above strains belong to Lactobacillus salivarius ( Ligilactobacillus salivarius ), named Ligilactobacillus salivariusD7-21, referred to as salivary Lactobacillus D7-21; on February 19, 2025, the salivary Lactobacillus D7-21 was deposited in the China Center for Type Culture Collection, with the preservation address being Wuhan University, Wuhan City, Hubei Province, and its preservation number is: CCTCC NO: M 2025249.
[0007] The present invention also provides a use of the saliva combined with Lactobacillus D7-21 in promoting intestinal development in chicks.
[0008] The present invention also provides a use of the saliva combined with Lactobacillus D7-21 in preparing an additive for promoting intestinal development in chicks.
[0009] The present invention also provides an additive for promoting intestinal development in chicks, wherein the additive contains the above-mentioned salivary lactobacillus D7-21, wherein the effective viable count of salivary lactobacillus D7-21 is 10 9 -10 10 cfu / mL.
[0010] The present invention also provides a feed for promoting intestinal development of chicks, wherein the feed is prepared by adding the above-mentioned additives to the basic diet, wherein the effective viable count of saliva-combined Lactobacillus D7-21 is 10 11 cfu / kg.
[0011] Furthermore, the effective viable count of the saliva combined with Lactobacillus D7-21 is 1x10 11 -5x10 11 cfu / kg.
[0012] Beneficial effects of the present invention: (1) Saliva-associated Lactobacillus D7-21 has a certain acid resistance and can still grow in MRS medium with pH = 3; (2) Lactobacillus salivae D7-21 has a certain salt tolerance and can grow in MRS medium supplemented with 4 g / L bile salts and in MRS medium supplemented with 8% NaCl; (3) Saliva combined with Lactobacillus D7-21 can promote intestinal development in chicks after being added to feed. BRIEF DESCRIPTION OF THE DRAWINGS
[0013] Figure 1 This is the comparison result of the genome amplified sequence of Lactobacillus salivarius D7-21 in the NCBI database.
[0014] Figure 2 This is a picture of saliva-associated Lactobacillus D7-21 cultured on MRS solid medium for 48 hours.
[0015] Figure 3 The Gram staining results of saliva combined with Lactobacillus D7-21.
[0016] Figure 4 This is the growth curve of saliva-associated Lactobacillus D7-21 under anaerobic conditions in MRS liquid medium.
[0017] Figure 5 Statistical results of the improvement in the ratio of duodenal villus height to crypt depth in chicks after the addition of saliva combined with Lactobacillus D7-21 to the feed.
[0018] Figure 6 The results of immunohistochemical staining of ZO-1 protein in the ileum of chicks. DETAILED DESCRIPTION
[0019] The present invention is further described in detail below with reference to specific embodiments so that those skilled in the art can understand.
[0020] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.
[0021] The preparation method of the MRS solid culture medium in the embodiment of the present invention is as follows Prepare 10 g peptone, 5 g beef powder, 4 g yeast powder, 2 g glucose, 1 mL Tween 80, 2 g dipotassium hydrogen phosphate, 5 g sodium acetate, 2 g triammonium citrate, 0.2 g magnesium sulfate, 0.05 g manganese sulfate, and 15 g agar powder. Make up to 1 L with distilled water, adjust the pH to 7.2 ± 0.1, and sterilize at 121°C under high temperature and high pressure for 15 min.
[0022] The preparation method of the MRS liquid culture medium in the embodiment of the present invention is as follows Prepare 10 g peptone, 5 g beef powder, 4 g yeast powder, 2 g glucose, 1 mL Tween 80, 2 g dipotassium hydrogen phosphate, 5 g sodium acetate, 2 g triammonium citrate, 0.2 g magnesium sulfate, and 0.05 g manganese sulfate. Make up to 1 L with distilled water, adjust the pH to 7.2 ± 0.1, and sterilize at 121°C under high temperature and high pressure for 15 min.
[0023] The sources or configuration methods of the reagents in the embodiments of the present invention are as follows: NaCl source: Sinopharm Chemical Reagent Co., Ltd. Bile salt source: Beijing Solebow Technology Co., Ltd. Preparation method of MRS culture medium containing different concentrations of NaCl: add different amounts of NaCl to MRS culture medium and then sterilize at 121℃ and high temperature and high pressure for 15 minutes.
[0024] Preparation method of MRS culture medium containing different concentrations of bile salts: add different masses of bile salts to MRS culture medium and then sterilize at 121℃ and high temperature and high pressure for 15 minutes.
[0025] The experiments in the examples of the present invention were all repeated at least three times, and the experimental data were statistically analyzed using SPSS 24.0 software. A one-way analysis of variance was used, and a P<0.05 was considered statistically significant.
[0026] Example 1 Saliva-associated Lactobacillus ( Ligilactobacillus salivarius ) Isolation and culture of D7-21 1. Sample Collection The samples were isolated from the small intestinal digesta of white-feathered broiler chickens, and the organisms were separated and purified using MRS culture medium. The samples were then anaerobically cultured in a constant temperature anaerobic operating chamber (Shanghai Longyue LAI-3) at 37°C for 48 hours. The anaerobic gas composition was N2:CO2:H2=80:10:10. Single colonies were picked and purified by plate streaking to obtain pure culture of each strain.
[0027] The genomic DNA of the isolated strain was extracted by referring to the bacterial genome advance kit (BL1044A, Biosharp) and detected by 1% agarose gel electrophoresis. No diffusion or tailing phenomenon was found. The quality and concentration of the extracted DNA were detected by UV spectrophotometer.
[0028] DNA samples with an A260 / 280nm ratio between 1.8 and 2.0 and no less than 20 ng / μL were considered qualified.
[0029] 2. Identification of Saliva-associated Lactobacillus D7-21 2.1 16S rDNA PCR amplification 16S rDNA universal primers were used to amplify the genomic DNA of qualified strains by PCR. The primers were synthesized by Wuhan Jinkairui Bioengineering Co., Ltd. The specific sequences are as follows: Upstream primer 27F: 5′AGAGTTTGATCATGGCTCAG3′; Downstream primer 1492R: 5'TAGGGTTACCTTGTTACGACTT3'.
[0030] PCR amplification system and program settings: PCR reaction system: 20 μL system contains 1 μL of strain genomic DNA template, 1 μL of upstream and downstream primers, and 10 μL of Taq enzyme mix (purchased from Nanjing Novozymes Biotech Co., Ltd.); The PCR reaction procedure is as follows: Stage 1: 95°C, 5 min Stage 2: 95°C, 10 s 48℃, 15 s 72℃, 90 s Stage 3: 72℃, 5min Stage 4: 20℃, 10min Among them, Stage 2 repeats 35 cycles 2.2 Sequencing and identification of strain 16S rDNA: The obtained 16S rDNA amplification product was subjected to 1% gel electrophoresis detection, and the qualified amplified sequence was sent to Wuhan Jinkairui Bioengineering Co., Ltd. for sequencing. The 16S rDNA sequence of 1435 bp in length was obtained as shown in SEQ ID NO.1 in the sequence listing: The 16S rRNA sequence of D7-21 was compared with the NCBI database (https: / / blast.ncbi.nlm.nih.gov / ), and the bacteria with the highest homology to D7-21 were Ligilactobacillus salivariusstrain 16079, similarity is 100% ( Figure 1 ). It was confirmed that the isolated D7-21 strain belongs to Lactobacillus salivarius ( Ligilactobacillus salivarius ), named Ligilactobacillus salivarius D7-21, referred to as salivary Lactobacillus D7-21; on February 19, 2025, the salivary Lactobacillus D7-21 was deposited in the China Center for Type Culture Collection, with the preservation address being Wuhan University, Wuhan City, Hubei Province, and its preservation number is: CCTCC NO: M 2025249.
[0031] Example 2 Physicochemical properties of saliva-associated Lactobacillus D7-21 and its acid and salt resistance 1. Physicochemical properties of saliva-associated Lactobacillus D7-21 1.1 Colony morphology and characteristics of saliva-associated Lactobacillus D7-21 The optimal growth conditions for the salivary lactobacillus D7-21 isolated in Example 1 were 37°C and anaerobic conditions. The colonies cultured on MRS solid medium for 48 hours were light white, spherical, and about 1-2 mm in diameter. Figure 2 ).
[0032] Gram staining results showed that the bacteria were Gram-positive rod-shaped rods ( Figure 3 ).
[0033] 1.2 Plotting the growth curve of saliva-associated Lactobacillus D7-21 The growth curve of Lactobacillus D7-21 in saliva for 24 hours ( Figure 3 ) It can be seen that D7-21 entered the logarithmic growth phase at 6 hours and entered the plateau phase at 14 hours. The specific process is as follows: 1) Take the D7-21 strain out of the -80°C freezer, draw a line on the plate, and incubate the plate in a 37°C anaerobic chamber for 24 hours. 2) Pick a single colony from the plate and inoculate it into 10 mL of MRS modified medium. Incubate anaerobically at 37°C for 24 hours. 3) Prepare three identical anaerobic tubes containing 10 mL of MRS medium as technical replicates. Transfer the cultured bacterial suspension to three 10 mL culture tubes at a 1% inoculum volume. All culture solutions were placed in an anaerobic operating chamber at 37°C and the OD600nm absorbance was monitored every 2 hours using a microplate reader. After reaching the plateau phase, the monitoring time was changed to every 6-8 hours. The growth curve of D7-21 was drawn ( Figure 4 ) 2. Acid and salt tolerance of saliva-associated Lactobacillus D7-21 2.1 Detection of the tolerance of saliva-associated Lactobacillus D7-21 to different pH media 1) Prepare MRS culture medium with pH=3.0, 4.0, 5.0, and 6.0 respectively, inoculate the fresh saliva of the second generation activated Lactobacillus D7-21 seed culture into the MRS culture medium with different pH at a ratio of 1:100, and culture anaerobically at 37℃ for 14 hours 2) Measure the absorbance of the final culture solution at OD600nm using a microplate reader.
[0034] 2.2 Tolerance of saliva-associated Lactobacillus D7-21 to different salt concentrations 1) Prepare MRS culture medium with NaCl concentrations (mass fraction) of 2%, 4%, 6%, and 8%, and bile salt concentrations of 1g / L, 2g / L, 3g / L, and 4g / L, respectively. Inoculate fresh saliva-activated Lactobacillus D7-21 seed culture at a ratio of 1:100 into MRS culture medium with different salt concentrations, and incubate anaerobically at 37°C for 14 hours. 2) Measure the absorbance of the final culture solution at OD600nm using a microplate reader.
[0035] 2.3 Experimental results are as follows: Saliva-associated Lactobacillus D7-21 has the ability to tolerate pH=3, 8% NaCl and 4g / L bile salts.
[0036] Table 1 Acid and salt tolerance of D7-21 Example 3 The additive for promoting intestinal development of chicks contains Lactobacillus saliva D7-21, wherein the effective viable count of Lactobacillus saliva D7-21 is 10 9 -10 10 cfu / mL.
[0037] Example 4 A feed for promoting intestinal development in chicks is prepared by adding the additive of Example 3 to the basic diet, wherein the effective viable count of saliva-combined Lactobacillus D7-21 is 10 11 cfu / kg.
[0038] Example 5 Application of feed for promoting intestinal development in chicks The broiler models selected are: Control group: fed with basic diet, Experimental group: fed with the feed of Example 4, Feeding starts from 1 day old and continues for 14 days; the specific test method is as follows: 1. Broiler grouping A total of 160 one-day-old male white-feathered broiler chickens (weight 42±2g) were randomly divided into a control group (BD) and an experimental group (LS), with 8 replicates in each group and 10 chickens in each replicate. The broiler chickens were reared for 14 days.
[0039] 2. Analysis of the results of duodenal villus height and crypt depth of broiler chickens in different groups After the two groups of broilers were treated for 14 days, they were slaughtered and sampled, and the villus height and crypt depth of the duodenal sections of the broilers in different groups were observed using an optical microscope.
[0040] 3. Preparation of duodenal tissue sections: 1) Sampling and fixation Take a 0.5 cm long segment of duodenum and fix it in 4% paraformaldehyde for 24 hours. 2) Dehydration and transparency Use alcohols of varying concentrations as dehydrating agents to gradually remove water from the tissue block. Then, place the tissue block in xylene, a clearing agent that is soluble in both alcohol and paraffin, to clear the block, replacing the alcohol in the tissue block with xylene.
[0041] 3) Wax embedding Place the transparent tissue block in melted paraffin and place it in a wax melting box to keep it warm. Embed the tissue block after the paraffin has completely soaked it. Pour the melted paraffin into a suitable container, quickly pick up the paraffin-soaked tissue block and place it in the container. Let it cool and solidify into a block.
[0042] 4) Slicing and patching Fix the embedded wax block on a microtome and cut into 5-8 μm slices. Flatten the slices in heated water, attach them to a glass slide, and dry them in a 45°C thermostat.
[0043] 5) Dewaxing and staining After being immersed in distilled water, the sections were placed in a hematoxylin aqueous solution for staining for several minutes, and separated in acid water and ammonia water for several seconds each; rinsed with running water for 1 hour, dehydrated in 70% and 90% alcohol by volume for 10 minutes each, and stained in alcohol eosin staining solution for 2-3 minutes. The stained sections were dehydrated with pure alcohol and then made transparent with xylene.
[0044] 6) Seal the slides Drop Canada balsam on the transparent sections and cover with a coverslip for sealing.
[0045] 4. Immunohistochemical staining results of ZO-1 protein in the jejunum of broiler chickens in different groups The sections were dewaxed and rehydrated / antigen retrieval / inactivated / blocked / primary antibody incubated / secondary antibody incubated / DAB color development / hematoxylin counterstaining / dehydrated / mounted, and then observed and photographed using an optical microscope.
[0046] Compared with the control group, the experimental group increased the abundance of ZO-1 protein in the jejunum.
[0047] Although the above embodiments have been described in detail, they are only a part of the embodiments of the present invention, not all of them. People can also obtain other embodiments based on this embodiment without inventiveness, and these embodiments all fall within the scope of protection of the present invention.
Claims
1. A salivary lactobacillus ( Ligilactobacillus salivarius )D7-21, its deposit number is: CCTCC NO: M 20241905.
2. Use of the saliva-combined Lactobacillus D7-21 according to claim 1 in promoting intestinal development in chicks.
3. Use of the saliva-associated Lactobacillus D7-21 according to claim 1 in preparing an additive for promoting intestinal development in chicks.
4. An additive for promoting intestinal development in chicks, characterized in that: The additive contains the salivary lactobacillus D7-21 according to claim 1, wherein the effective viable count of the salivary lactobacillus D7-21 is 10 9 -10 10 cfu / mL.
5. A feed for promoting intestinal development in chicks, characterized by: The feed is a basic diet supplemented with the additive according to claim 4, wherein the effective viable count of the saliva-associated Lactobacillus D7-21 is 10 11 cfu / kg 6. The feed according to claim 5, characterized in that: The effective viable count of the saliva combined with Lactobacillus D7-21 is 1×10 11 -5x10 11 cfu / kg.
Citation Information
Cited By
Lactobacillus hens C2-16-2 and application thereof
CN119592454A
Lactobacillus salivarius combination HC1135 for regulating bone metabolism and improving bone loss as well as preparation and application of lactobacillus salivarius combination HC1135
CN121362700A