Recombinant microorganism with high yield of L-tryptophan as well as construction method and application of recombinant microorganism

By metabolically reconstructing Klebsiella and redirecting its glycolytic flux to the L-tryptophan synthesis pathway, a recombinant strain that efficiently produces L-tryptophan was constructed, which solved the problems of insufficient production and yield in existing technologies and achieved high-yield, low-cost L-tryptophan fermentation production.

CN120683027AActive Publication Date: 2025-09-23SHANGHAI RECOM BIOTECHNOLOGY CO LTD
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202510558266.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-29
Publication Date
2025-09-23
Estimated Expiration
2045-04-29

AI Technical Summary

Technical Problem

Existing microbial fermentation methods still have room for improvement in the production and yield of L-tryptophan. Traditional chemical synthesis methods have problems of high cost and environmental pollution. Existing microbial modification methods fail to fully utilize the glycolytic flux of Klebsiella to increase L-tryptophan production.

Method used

By systematically reconstructing the metabolism of Klebsiella, knocking out genes related to by-product synthesis, redirecting the pyruvate anabolism flow to the L-tryptophan synthesis pathway, and enhancing the L-tryptophan synthesis flux, a recombinant strain that efficiently produces L-tryptophan was constructed.

Benefits of technology

Under optimized fermentation conditions, the recombinant strain can efficiently produce L-tryptophan, with a yield of 60g/L and a yield of 0.23g/g. The culture medium is simple, the fermentation cost is low, and the product component is single and easy to separate.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120683027A_ABST
    Figure CN120683027A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of metabolic engineering, and particularly relates to a recombinant microorganism with high yield of L-tryptophan as well as a construction method and application of the recombinant microorganism. According to the present invention, the recombinant Klebsiella oxytoca capable of highly producing the L-tryptophan is constructed through the gene engineering technology by screening the knocked-out or added gene, such that the recombinant Klebsiella oxytoca capable of highly producing the L-tryptophan is constructed, the recombinant Klebsiella oxytoca takes glucose as a substrate and can be used for efficiently producing L-tryptophan under a fermentation condition, the yield reaches 60g / L, and the yield is 0.23 g / g. The invention provides a method for efficiently producing L-tryptophan by microorganisms by redirecting anabolic flux of 2, 3-butanediol to synthesis of L-tryptophan through pyruvic acid, and the method has the advantages of simple production process, low cost, high yield, important economic benefit and good prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of metabolic engineering, and in particular relates to a recombinant microorganism capable of producing high amounts of L-tryptophan, a construction method thereof, and an application thereof. Background Art

[0002] Tryptophan (L-Trp), also known as D, L-α-amino-β-indolyl propionic acid, is an aromatic amino acid with a molecular formula of C 11 H 12 O2N2, with a relative molecular mass of 204.21. Tryptophan has three isomers: L-, D-, and the racemic DL form. The levorotatory form, L-Trp, is biologically active and is an essential amino acid for humans. L-Trp appears as white crystals or crystalline powder at room temperature, is odorless, and has a melting point of 289°C. Its solubility in water at room temperature is 11.4 g / L. It is slightly soluble in ethanol, insoluble in chloroform, and relatively stable in alkaline solutions.

[0003] Tryptophan is a key precursor for auxin biosynthesis in plants. Its structure is similar to that of IAA (indole-3-acetic acid) and is ubiquitous in higher plants. As one of the eight essential amino acids, L-tryptophan cannot be synthesized in mammals and must be ingested externally. Therefore, L-tryptophan is widely used in various industries, including food, pharmaceuticals, and feed. In the food industry, L-tryptophan is used as a nutritional supplement, food fortifier, and preservative. Furthermore, L-tryptophan is a precursor for the fermentation production of the food pigment indigo. In the pharmaceutical manufacturing industry, L-tryptophan is commonly used in health supplements, biopharmaceuticals, and pharmaceutical raw materials. Furthermore, as a precursor of the neurotransmitters serotonin and melatonin, L-tryptophan is used in the synthesis of antidepressants and tranquilizers. In the feed industry, L-tryptophan is used as a feed additive, positively impacting growth, production, nutritional metabolism, and immunity in poultry and livestock. To date, the market demand for L-tryptophan has exceeded 28,000 tons per year, and the market size of this product continues to expand. However, relatively backward production technology has resulted in high production costs and low yields of L-tryptophan, which in turn limits its large-scale application.

[0004] Traditional industrial production of L-tryptophan relies on fermentation methods that primarily include chemical synthesis and protein hydrolysis. However, this method of chemical synthesis has numerous drawbacks, including high production costs, demanding process conditions, and environmental pollution. With the advancement of recombinant genetic technology and the ongoing analysis of metabolic networks in model organisms, the use of genetically engineered microorganisms to synthesize L-tryptophan has garnered significant attention.

[0005] Escherichia coli is currently the main strain for the production of L-tryptophan by fermentation. With the continuous development of metabolic engineering technology, the yield and yield of L-tryptophan produced by microbial fermentation have been continuously improved. Based on the mutagenic strain E. coli TRP0, Guo et al. obtained the recombinant strain E. coli TRP12 by metabolic engineering methods such as eliminating the negative feedback effect, strengthening tryptophan transport and enhancing precursor supply. After fermentation in a 5L tank, the L-tryptophan concentration reached 52.1g / L and the conversion rate reached 0.171g / g (Guo L et al., Biotechnol Bioeng., 2022, 119(3): 983-993). Xiong et al., based on the tryptophan production strain, increased the precursor supply by introducing the phosphoketolase pathway, the non-PTS system and the oxaloacetate carboxykinase pathway. In a 5L fermentor, the constructed recombinant strain L-tryptophan conversion rate reached 0.227g / g (Xiong B et al., Biotechnol Bioeng., 2021, 118 (3): 1393-1404). In addition, Corynebacterium glutamicum has also been developed for l-tryptophan production. Dong et al. transformed C. glutamicum by systemic metabolic engineering such as enhancing the L-tryptophan biosynthetic pathway, reprogramming the central metabolic flow, mining metabolic bottlenecks, enhancing the transport system and precursor supply, and inhibiting competitive pathways. The obtained recombinant strain can achieve 16.2g / L of L-tryptophan accumulation in shake flask fermentation, and the conversion rate reached 0.160g / g (Dong YF et al., BioRxiv., 2024, 11.04.621991).

[0006] Although existing microbial fermentation methods have achieved significant results in terms of L-tryptophan production and yield, further expanding fermentation methods and improving their production or yield remain relentless goals in this field. Microorganisms such as Klebsiella oxytoca can efficiently synthesize 2,3-butanediol or acetoin by metabolizing carbohydrates such as glucose (Jantama K., Metab Eng., 2015, 30:16-26). The precursors for the synthesis of 2,3-butanediol and acetoin are pyruvate, indicating that K. oxytoca possesses a robust glycolytic flux. Based on this, metabolic flux redirection strategies are expected to redirect the robust 2,3-butanediol and acetoin synthesis pathways toward L-tryptophan synthesis.

[0007] Based on this, designing a high-yield L-tryptophan strain construction strategy and applying it to the fermentation production of L-tryptophan remains a challenge in this field. Summary of the Invention

[0008] In view of the shortcomings of the prior art, the present invention provides a recombinant microorganism with high L-tryptophan production and a construction method thereof, with the aim of efficiently preparing L-tryptophan.

[0009] The present invention provides a recombinant microorganism for producing L-tryptophan, wherein the starting strain of the recombinant microorganism is selected from a strain of the genus Klebsiella; the recombinant microorganism overexpresses the phosphoenolpyruvate synthase gene ppsA, the tryptophan operon partial gene cluster trpE fbr D gene.

[0010] Preferably, the tryptophan operon partial gene cluster trpE fbr The nucleotide sequence of the D gene is shown in SEQ ID NO.15.

[0011] Preferably, the starting strain is selected from at least one of Klebsiella oxytoca, Klebsiella terrestris, Klebsiella plantarum and Klebsiella pneumoniae.

[0012] The present invention provides a recombinant microorganism for producing L-tryptophan as described in any of the above items. The recombinant microorganism is constructed based on the starting strain, by inactivating byproduct and / or enzyme genes in the 2,3-butanediol synthesis pathway, and enhancing genes related to L-tryptophan synthesis flux; the byproduct is selected from at least one of acetic acid, formic acid, succinic acid, and lactic acid; and the gene related to L-tryptophan synthesis flux is selected from at least one of L-tryptophan synthesis-related enzyme genes, metabolic pathway-related genes, efflux protein genes, and endogenous strong promoter genes.

[0013] Preferably, the inactivation includes knockout or knockdown, and the enhancement includes overexpression.

[0014] Preferably, the enzyme genes in the by-product and / or 2,3-butanediol synthesis pathway are selected from at least one to sixteen of the pyruvate kinase encoding gene pykF, the tryptophanase encoding gene tnaA, the transcriptional repressor trpR of the tryptophan operon, the attenuator trpL of the tryptophan operon, the pyruvate oxidase gene pox, the phosphotransacetylase gene pta, the acetate kinase ackA, the fumarate reductase subunit A gene frdA, the lactate dehydrogenase gene ldhD, the pyruvate formate lyase gene pflB, the alcohol dehydrogenase gene adhE, the α-acetolactate synthase gene budB, the α-acetolactate decarboxylase gene budA, the 2,3-butanediol dehydrogenase gene budC, the glycerol dehydrogenase gene gldA, and the 1,3-propanediol dehydrogenase gene dhaT.

[0015] Preferably, the gene related to L-tryptophan synthesis flux is selected from the promoter P of the 2,3-butanediol synthesis gene cluster. budABC、3-deoxy-d-arabinoheptulose-7-phosphate synthase mutant protein encoding gene aroG fbr , serA, a gene encoding a mutant protein of 3-phosphoglycerate dehydrogenase fbr , 3-dehydroquinate synthase encoding gene aroB, shikimate dehydrogenase encoding gene aroE, chorismate synthase encoding gene aroC, tryptophan operon partial gene cluster trpDC, tryptophan operon partial gene cluster trpBA, transketolase encoding gene tktA, aromatic amino acid efflux protein encoding gene ywkB, phosphoenolpyruvate carboxykinase gene pck, glutamine synthase encoding gene glnA, L-tryptophan efflux protein gene yddG, at least one to thirteen of the following.

[0016] The present invention provides a method for constructing a recombinant microorganism for producing L-tryptophan as described in any of the above items, the construction method comprising, on the basis of a starting strain, inactivating byproduct and / or enzyme genes in the 2,3-butanediol synthesis pathway, and enhancing genes related to L-tryptophan synthesis flux; the byproduct is selected from at least one of acetic acid, formic acid, succinic acid, and lactic acid; and the gene related to L-tryptophan synthesis flux is selected from at least one of L-tryptophan synthesis-related enzyme genes, metabolic pathway-related genes, efflux protein genes, and endogenous strong promoter genes.

[0017] The present invention provides use of any of the above-mentioned recombinant microorganisms for producing L-tryptophan in producing L-tryptophan.

[0018] Preferably, the overexpression includes the phosphoenolpyruvate synthase gene ppsA, the tryptophan operon gene cluster trpE fbr The recombinant microorganism with the D gene is cultured using a fermentation medium containing glucose.

[0019] Preferably, the concentration of glucose in the fermentation medium is 80-100 g / L;

[0020] And / or, the inoculum size of the recombinant microorganism during cultivation is 5-10% by volume;

[0021] And / or, the stirring speed during the culture is 500-1000 rpm; and / or, the pH during the culture is 6.8±0.1; and / or, the temperature during the culture is 37±0.5°C; and / or, the glucose concentration is maintained at 0-5 g / L during the culture; and / or, the culture time is 40-60 hours.

[0022] The present invention provides a recombinant microorganism that produces high L-tryptophan yields, a method for constructing it, and its use. By screening for genes to be deleted or added, the present invention selects a recombinant Klebsiella oxytoca that produces high L-tryptophan yields. The recombinant Klebsiella oxytoca of the present invention can be used to efficiently produce L-tryptophan. The features and outstanding effects of the present invention are as follows:

[0023] (1) The present invention designs a strategy for constructing a high-yield L-tryptophan engineered strain. By systematically reconstructing the metabolism of a 2,3-butanediol or acetoin-producing strain, and knocking out by-product synthesis-related genes to inhibit the synthesis of 2,3-butanediol, acetic acid, formic acid, succinic acid, and lactic acid, an exogenous L-tryptophan biosynthetic pathway is introduced to redirect the intracellular pyruvate anabolic flux from 2,3-butanediol synthesis to L-tryptophan production, thereby constructing an L-tryptophan-producing strain. Furthermore, by enhancing the L-tryptophan synthesis flux and strengthening the L-tryptophan efflux, an engineered strain capable of efficiently producing L-tryptophan is obtained.

[0024] (2) The optimal engineered strain of Klebsiella oxytocaine produced L-tryptophan using glucose as a substrate under the fermentation conditions provided by the present invention, with a yield of 60 g / L and a yield of 0.23 g / g.

[0025] (3) The recombinant strain constructed by the present invention requires a simple culture medium, low fermentation substrate and culture costs, and at the same time, the engineered strain has a high L-tryptophan production, and the product components are single and easy to separate.

[0026] Obviously, based on the above contents of the present invention, according to common technical knowledge and customary means in this field, without departing from the above basic technical ideas of the present invention, other various forms of modifications, replacements or changes can be made.

[0027] The following further describes the above content of the present invention in detail through specific embodiments in the form of examples. However, this should not be construed as limiting the scope of the above subject matter of the present invention to the following examples. All technologies implemented based on the above content of the present invention fall within the scope of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 This is the L-tryptophan synthesis metabolic pathway of the recombinant Klebsiella oxytoca of the present invention. DETAILED DESCRIPTION

[0029] In the following examples and experimental examples, reagents and materials not otherwise specified are commercially available.

[0030] In the following examples, the materials, reagents, plasmids, special kits, strains, etc. used were obtained from commercial sources unless otherwise specified.

[0031] The nucleotide sequence information of the gene involved in the present invention is as follows:

[0032] Gene ppsA nucleotide sequence (SEQ ID NO.1):

[0033]

[0034] Nucleotide sequence of gene budA (SEQ ID NO.2):

[0035] ATGAACCATTCTGCTGAATGCTCTTGTGAAGAGAGCCTGTGTGAAACTCTACGAGGGTTTTCCGCGCAACATCCCGATAGCGTCATCTACCAGACCTCTCTGATGAGCGCGCTGTTGAGCGGCGTTTATGAAGGTAATACCACCATCGCTGATTTACTCACCCACGGCGATTTTGGCCTGGGAACCTTTAATGAACTGGACGGCGAGCTGATCGCGTTTAGCAGCGAGGTATACCAGCTGCGCGCCGACGGCAGCGCCCGTAAAGCCCGAATGGAACAGCGCACGCCGTTTGCGGTGATGACCTGGTTTCAGCCGCAGTATCGTAAAACGTTCGATAAACCGGTGAGCCGCCAGCAGTTGCACGACATTATCGACCAGCAAATACCCTCCGATAATCTCTTCTGCGCCTTGCGCATTAACGGTCATTTTCGTCATGCGCATACCCGCACCGTACCGCGCCAGACCCCGCCCTACCGGGCGATGACCGACGTGCTCGACGACCAGCCGGTATTCCGCTTCAACCAGCGCGAAGGGGTACTGGTCGGCTTCCGTACCCCGCAGCATATGCAGGGCATTAACGTTGCCGGCTACCACGAACATTTCATCACCGATGACCGTCAGGGCGGCGGTCATCTGCTCGATTATCAGCTCGACCACGGCGTGCTGACCTTTGGCGAAATCCACAAATTGATGATTGACCTTCCTGCCGATAGCGCCTTCCTGCAGGCGGATCTGCACCCGGACAATCTAGATGCCGCTATTCGCTCAGTCGAAAACTAA

[0036] Mutant protein gene aroG fbr(D146N) Nucleotide sequence (SEQ ID NO.3):

[0037]

[0038] Gene budB nucleotide sequence (SEQ ID NO.4):

[0039]

[0040] Gene tnaA nucleotide sequence (SEQ ID NO.5):

[0041]

[0042] Promoter P budABC Nucleotide sequence (SEQ ID NO.6):

[0043] ATCGAAAACGTCTCAAACAATCATAGATTCTATATTGGAACTGTGAGCTGAATCG CGTCAACATTTATTTAACCTTTCTGATATTCGTTGAACGAGGAAGCGGGTA

[0044] Nucleotide sequence of gene trpL (SEQ ID NO.7):

[0045] GATGACTCCTGCTGGACATGAACCTGTACCCGTCATACTTTAAGTCACAAGCAGATTGACTGATGTTCTGCAGCTTAAGGGATTAAGGATAGTGATAAGCGCATCATCATACCGACTGATAGAGAAAATCTGCAAACGGGGGTTGACTTTAATCTCTCGGACTAGTTAACTAGTACGCAAGTTCACATGAAGGGGTATCATCAATGAAAACGCAACTCATCACTCTGCACGGCTGGTGGCGCACCTCCTGTTATCGGGCGGCGTGATCGCGTTTTGCACTCAGCATACAGATACCCGGCCCGCCAATGAGCGGGCTTTTTATTGGACAAATTATTACAGCGAACAGGCGACAACAAATA

[0046] Nucleotide sequence of gene trpR (SEQ ID NO.8):

[0047] ATGACCCAACAATCCCCCTATTCAGCAGCGGTAGCCGAACAGCGTCATCAGGAGTGGCTGCGTTTTGTCGCGCTCTTACAGCAGGCGTACGCCGACGATCTTCATCTGCCGCTTTTACAGCTTATGCTGACCCCCGACGAGCGCGAGGCGCTGGGTACGCGGGTACGTATTATTGAAGAGCTGCTGCGCGGTGAGATGAGCCAGCGCGAGCTAAAAAATGAACTCGGCGCCGGCATCGCGACCATCACCCGCGGTTCGAACAGCCTCAAATCAGCGCCGCCGGAGCTGCGTTTATGGCTGGAGCAGTCGTTGTTTAACGCTGGCGATAAATAG

[0048] Nucleotide sequence of gene aroB (SEQ ID NO.9):

[0049]

[0050] Gene ldhD nucleotide sequence (SEQ ID NO.10):

[0051] ATGAAAATCGCTGTGTACAGTACGAAACAGTACGACAAGAAGTATCTGCAGCATGTCAATGATGCATACGGCTTTGAACTGGAATTTTTTGACTTCCTGCTCACCGAAAAGACCGCCAAAACCGCCAACGGCTGTGAAGCGGTATGCATTTTCGTTAACGATGACGGTAGCCGCCCGGTACTTGAAGAACTGAAAGCCCACGGCGTGAAGTACATCGCGCTGCGCTGCGCCGGGTTCAACAACGTTGACCTCGACGCCGCGAAAGAGCTGGGCCTGCGGGTAGTACGCGTCCCGGCCTACTCGCCGGAAGCGGTCGCTGAGCACGCAATCGGCATGATGATGTCGCTGAACCGCCGCATTCATCGCGCCTATCAGCGCACTCGCGATGCTAACTTCTCCCTTGAGGGGCTGACCGGCTTCACTATGCACGGTAAAACCGCTGGCGTTATCGGCACCGGTAAGATTGGCGTTGCCGCGCTGCGCATCCTTAAAGGTTTCGGTATGCGCCTGCTGGCGTTTGATCCCTATCCAAGCGCCGCCGCGCTGGATATGGGCGTGGAGTATGTCGATCTGGAAACGCTATACCGGGAGTCCGATGTTATCTCCCTGCACTGCCCGCTGACCGATGAGAACTATCATTTGCTGAACCATGCCGCGTTCGATCGGATGAAAGATGGGGTGATGATCATCAACACCAGTCGCGGCGCGCTTATCGATTCGCAGGCAGCGATCGATGCCCTGAAGCACCAGAAAATTGGCGCGCTGGGGATGGACGTGTATGAGAACGAACGCGATCTGTTCTTTGAAGATAAGTCTAACGACGTTATTCAGGACGATGTCTTCCGCCGTCTTTCCGCCTGCCACAACGTTCTGTTTACCGGTCACCAGGCGTTTTTGACCGCAGAGGCGTTGATCAGTATCTCGCAGACCACCCTCGACAACCTGCGTCAGGTGGATGCTGACGAAACCTGCCCTAACGCACTGGTCTGA

[0052] Gene aroE nucleotide sequence (SEQ ID NO.11):

[0053] ATGGAAACCTATGCTGTTTTTGGTAATCCGATAGCCCACAGCAAATCGCCATTCATTCATCAGCAATTTGCTCAGCAACTGAATATTGAACATCCCTATGGGCGCGTGTTGGCACCCATCAATGATTTCATCAACACACTGAACGCTTTCTTTAGTGCTGGTGGTAAAGGTGCGAATGTGACGGTGCCTTTTAAAGAAGAGGCTTTTGCCAGAGCGGATGAGCTTACTGAACGGGCAGCGTTGGCTGGTGCTGTTAATACCCTCATGCGGTTAGAAGATGGACGCCTGCTGGGTGACAATACCGATGGTGTAGGCTTGTTAAGCGATCTGGAACGTCTGTCTTTTATCCGCCCTGGTTTACGTATTCTGCTTATCGGCGCTGGTGGAGCATCTCGCGGCGTACTACTGCCACTCCTTTCCCTGGACTGTGCGGTGACAATAACTAATCGGACGGTATCCCGCGCGGAAGAGTTGGCTAAATTGTTTGCGCACACTGGCAGTATTCAGGCGTTGAGTATGGACGAACTGGAAGGTCATGAGTTTGATCTCATTATTAATGCAACATCCAGTGGCATCAGTGGTGATATTCCGGCGATCCCGTCATCGCTCATTCATCCAGGCATTTATTGCTATGACATGTTCTATCAGAAAGGAAAAACTCCTTTTCTGGCATGGTGTGAGCAGCGAGGCTCAAAGCGTAATGCTGATGGTTTAGGAATGCTGGTGGCACAGGCGGCTCATGCCTTTCTTCTCTGGCACGGTGTTCTGCCTGACGTAGAACCAGTTATAAAGCAATTGCAGGAGGAATTGTCCGCGTGA

[0054] Gene adhE nucleotide sequence (SEQ ID NO.12):

[0055]

[0056] Gene aroC nucleotide sequence (SEQ ID NO.13):

[0057]

[0058] Gene frdA nucleotide sequence (SEQ ID NO.14):

[0059]

[0060] Mutant protein gene trpE fbr(S40F) D nucleotide sequence (SEQ ID NO.15):

[0061]

[0062] Gene pflB nucleotide sequence (SEQ ID NO.16):

[0063]

[0064] Gene trpDC nucleotide sequence (SEQ ID NO.17):

[0065]

[0066] Gene pox nucleotide sequence (SEQ ID NO.18):

[0067]

[0068] Gene trpBA nucleotide sequence (SEQ ID NO.19):

[0069]

[0070] Gene pta nucleotide sequence (SEQ ID NO.20):

[0071]

[0072] Gene tktA nucleotide sequence (SEQ ID NO.21):

[0073]

[0074] Gene pykF nucleotide sequence (SEQ ID NO.22):

[0075]

[0076] Mutant protein gene serA fbr(H344A,N346A,N364A) Nucleotide sequence (SEQ ID NO.23):

[0077]

[0078] Nucleotide sequence of gene budC (SEQ ID NO.24):

[0079] ATGAAAAAAGTCGCACTCGTGACCGGCGCAGGCCAGGGTATCGGTAAAGCTATCGCCCTTCGCCTGGTTCAAGATGGCTTTGCCGTGGCCATCGCCGATTATAACGATGCCACCGCACAGGCGGTTGCTGACGAAATTAACCAGCACGGCGGCCAGGCGCTGGCGGTGAAGGTCGATGTCTCGAAACGCGATCAGGTTTTTGCCGCCGTTGAGCAGGCGCGTAAGGGCCTTGGCGGTTTTGACGTGATCGTTAACAACGCCGGGGTCGCGCCCTCTACGCCTATCGAAGAGATTCGCGAGGACGTCATCGATAAAGTCTACAATATCAACGTTAAGGGCGTTATCTGGGGCATTCAGGCCGCGGTAGATGCGTTTAAAAAAGAGGGCCACGGCGGCAAGATCATCAACGCCTGCTCCCAGGCGGGCCACGTGGGTAACCCGGAACTGGCGGTCTACAGTTCAAGCAAGTTTGCCGTGCGCGGCCTGACGCAAACCGCCGCCCGCGATCTGGCGCATCTGGGAATTACCGTTAACGGCTACTGCCCGGGGATCGTCAAAACCCCCATGTGGGCGGAAATTGACCGTCAGGTTTCCGAAGCGGCGGGCAAACCGCTGGGCTACGGAACCCAGGAATTTGCGAAACGCATTACCCTCGGTCGTCTTTCCGAACCGGAAGACGTCGCGGCCTGCGTCTCTTATCTGGCCGGTCCGGACTCCAACTACATGACCGGTCAGTCGCTGCTGATCGATGGCGGTATGGTATTCAGTTAA

[0080] Nucleotide sequence of gene glnA (SEQ ID NO.25):

[0081]

[0082] Gene dhaT nucleotide sequence (SEQ ID NO.26):

[0083]

[0084] Gene ywkB nucleotide sequence (SEQ ID NO.27):

[0085] TTGAGCATCTTAGATATCTTAATCCTCCTGGCGCCGATCTTCTTTGTTATCGTGCTGGGTTGGTTTGCAGGACATTTTGGAAGTTATGATGCCAAGTCGGCAAAAGGGGTAAGTACGTTAGTAACGAAATACGCACTTCCAGCTCACTTTATCGCTGGTATTTTGACAACTTCCAGAAGTGAATTTTTATCACAAGTACCTTTAATGATTTCTTTAATTATTGGGATTGTTGGTTTCTATATCATCATTCTTTTGGTTTGCAGATTTATATTCAAGTATGATTTAACGAACTCATCTGTATTTTCTTTGAACTCTGCACAGCCGACATTCGCATTTATGGGTATCCCGGTATTGGGAAGCTTATTCGGAGCGAATGAAGTTGCGATTCCGATCGCGGTCACAGGTATCGTGGTTAACGCGATTCTTGATCCGCTCGCGATCATTATCGCTACTGTTGGTGAGTCTTCTAAGAAAAACGAAGAGAGTGGCGACAGCTTCTGGAAGATGACAGGAAAATCAATCCTGCATGGTCTTTGTGAGCCGCTTGCAGCTGCTCCGTTAATCAGTATGATCTTGGTGCTGGTTTTCAATTTCACTCTTCCTGAGCTGGGTGTTAAAATGCTTGATCAGCTTGGAAGCACAACATCTGGTGTTGCTCTCTTCGCTGTTGGTGTTACCGTTGGTATTCGTAAAATTAAACTCAGTATGCCGGCTATCGGTATTGCGTTACTAAAAGTTGCGGTTCAGCCTGCGTTAATGTTCCTGATTGCTCTTGCTATCGGACTTCCAGCTGACCAAACAACAAAAGCAATCCTTCTTGTTGCATTCCCTGGTTCTGCCGTTGCAGCCATGATTGCGACTCGTTTCGAGAAACAAGAAGAAGAAACTGCAACTGCGTTTGTGGTCAGTGCGATTCTGTCATTGATTTCACTTCCAATCATTATCGCGCTTACTGCGTAA

[0086] Gene gldA nucleotide sequence (SEQ ID NO.28):

[0087]

[0088] Gene pck nucleotide sequence (SEQ ID NO.29):

[0089]

[0090] Gene ackA nucleotide sequence (SEQ ID NO.30):

[0091]

[0092] Example 1 Construction of an L-tryptophan-producing strain from Klebsiella oxytoca CICC21518

[0093] The starting strain, K. oxytoca CICC21518, was purchased from the China Industrial Microbiological Collection Center under the accession number CICC21518. K. oxytoca CICC21518 is a Gram-negative bacterium that grows aerobically or facultatively anaerobically, with an optimal culture temperature of 37°C. K. oxytoca CICC21518 is positive in the Voges-Proskauer (VP) reaction, indicating its ability to metabolize citrate for growth. K. oxytoca has a broad substrate spectrum, fermenting lactose slowly but also mannitol, inositol, sorbitol, melibiose, styraxol, and raffinose.

[0094] 1.1 Replacement of the α-acetolactate decarboxylase gene budA with the phosphoenolpyruvate synthase gene ppsA from Escherichia coli W3110

[0095] The ppsA sequence of the phosphoenolpyruvate synthase gene is 2379 bases long, and its nucleotide sequence is shown in SEQ ID NO. 1. The budA sequence of the α-acetolactate decarboxylase gene is 780 bases long, and its nucleotide sequence is shown in SEQ ID NO. 2.

[0096] (1) Construction of gene replacement vector: The genomic DNA of K.oxytoca CICC21518 was prepared by conventional methods. The process referred to the method of small-scale preparation of bacterial genomes in the "Concise Guide to Molecular Biology" published by Science Press, and the genomic DNA of K.oxytoca CICC21518 was extracted. The genomic DNA of K.oxytoca CICC21518 was used as a template to amplify the upstream and downstream homologous arms of the budA gene by PCR for subsequent gene replacement. The middle segment replacement gene ppsA was amplified using the E.coli W3110 genome as a template. The obtained upstream homologous arms and gene ppsA were used as templates for recombinant PCR, and then the obtained recombinant fragment and upstream and downstream homologous arms were subjected to recombinant PCR to obtain the gene replacement fragment of ΔbudA::ppsA, which contained restriction sites of EcoRI and BamHI at both ends.

[0097] The suicide plasmid pR6KmobsacB was double-digested with restriction endonucleases EcoRI and BamHI. The digestion product was recovered from nucleic acid gel and ligated with the gene replacement fragment using T5 exonuclease to obtain the gene replacement plasmid pR6KmobsacB-ΔbudA::ppsA.

[0098] (2) Gene knockout step: inoculate Escherichia coli S17-1λpir carrying the plasmid obtained in step (1) and Klebsiella oxytoca CICC21518 and culture them at 37°C overnight, transfer the above strains and culture them at 37°C until OD 600nm The concentration is approximately 0.6-0.8. 5 mL of Escherichia coli and 1 mL of Klebsiella oxytoca were collected separately, centrifuged at 6500 rpm for 3 minutes to collect the cells, washed twice with 0.85% saline, mixed the two cells with 100 μL of saline, and dropped onto an LB plate. The cells were then placed in a 37°C incubator for overnight culture. After washing the biofilm with 0.85% saline to collect the cells, the cells were centrifuged at 6500 rpm for 3 minutes to collect the cells, washed twice with 0.85% saline, diluted 4-10 times, and spread onto an M9 solid plate containing 20% ​​citrate supplemented with kanamycin. The plates were cultured at 37°C for 36-48 hours. The grown single colonies were picked and cultured at 37°C in LB medium containing kanamycin. The upstream and downstream primers were used to perform PCR verification of the bacterial liquid to obtain the correct single exchange target bacteria that can simultaneously PCR out long and short fragments.

[0099] The correct single-exchange target strain was transferred to LB medium without resistance and cultured at 37°C overnight. It was then transferred to LB medium containing 15% sucrose and cultured at 37°C for 10-12 hours. Two generations were transferred, and gradient dilutions were spread on LB solid medium containing 15% sucrose and cultured at 37°C overnight. The grown single colonies were picked and placed in LB medium. The upstream and downstream primers were used for bacterial liquid PCR verification. The genome of the single colony with the correct band size verified by PCR was extracted and the genome was verified by temperature gradient PCR using the above primers. The correct band size was the double-exchange target bacteria.

[0100] 1.2 Using the gene encoding the mutant protein of 3-deoxy-D-arabinoheptulose-7-phosphate synthase aroG from Escherichia coli W3110 fbr(D146N) Replacement of the α-acetolactate synthase gene budB

[0101] 3-deoxy-D-arabinoheptulose-7-phosphate synthase mutant protein gene aroG fbr(D146N) The sequence length is 1053 bases, and its nucleotide sequence is shown in SEQ ID NO. 3. The sequence length of the α-acetolactate synthase gene budB is 1680 bases, and its nucleotide sequence is shown in SEQ ID NO. 4.

[0102] The gene encoding the mutant protein of 3-deoxy-D-arabinoheptulose-7-phosphate synthase aroG from Escherichia coli W3110 was used. fbr(D146N) The α-acetolactate synthase encoding gene budB was replaced. The vector construction and operation steps were similar to those for replacing the budA gene with the ppsA gene in step 1.1 of this example. The Klebsiella oxytocae used in this step was carried out based on the steps in step 1.1.

[0103] 1.3 Knockout of the tryptophanase encoding gene tnaA

[0104] The tryptophanase encoding gene tnaA has a sequence length of 1416 bases, and its nucleotide sequence is shown in SEQ ID NO.5.

[0105] Knockout vector construction: PCR amplification of the upstream and downstream homology arms of the tnaA gene was performed. Using the obtained upstream and downstream homology arms as templates for recombination, PCR amplification of the recombinant fragment yielded a truncated fragment of tnaA containing EcoRI and BamHI restriction sites at both ends.

[0106] The truncated recombinant fragment of tnaA and the suicide plasmid pR6KmobsacB were double-digested with the restriction endonucleases EcoRI and BamHI, respectively. The digestion products were recovered from a nucleic acid gel and ligated with the gene replacement fragment using T5 exonuclease to obtain the gene replacement plasmid pR6KmobsacB-ΔtnaA. The gene manipulation procedures were similar to those in step 1.1 of this example, where the ppsA gene was replaced with the budA gene. This step used the same Klebsiella oxytocae strains as in step 1.2.

[0107] 1.4 The promoter of the endogenous 2,3-butanediol biosynthesis pathway gene cluster P budABC Replaces the attenuator trpL of the tryptophan operon

[0108] The promoter of the endogenous 2,3-butanediol biosynthesis pathway gene cluster P budABC The sequence length is 106 bases, and its nucleotide sequence is shown in SEQ ID NO. 6. The sequence length of the attenuator trpL of the tryptophan operon is 45 bases, and its nucleotide sequence is shown in SEQ ID NO. 7.

[0109] The promoter of the endogenous 2,3-butanediol biosynthesis pathway gene cluster P budABC The construction and operation steps of the attenuator trpL vector replacing the tryptophan operon refer to the operation steps of replacing the budA gene with the ppsA gene in step 1.1 of this example. The Klebsiella oxytoca used in this step is based on the steps in step 1.3.

[0110] 1.5 Knockout of the transcriptional repressor trpR of the tryptophan operon

[0111] The sequence length of the transcriptional repressor trpR of the tryptophan operon is 327 bases, and its nucleotide sequence is shown in SEQ ID NO.8.

[0112] The construction and operation steps of the knockout vector for the transcriptional repressor trpR of the tryptophan operon refer to the operation steps for knocking out the tnaA gene in step 1.3 of this example. The Klebsiella oxytoca used in this step is based on the steps in step 1.4.

[0113] 1.6 Replacement of the lactate dehydrogenase gene ldhD with the 3-dehydroquinate synthase gene aroB from E. coli W3110

[0114] The 3-dehydroquinate synthase gene aroB from E. coli W3110 has a length of 1089 bases, and its nucleotide sequence is shown in SEQ ID NO. 9. The lactate dehydrogenase gene ldhD has a length of 990 bases, and its nucleotide sequence is shown in SEQ ID NO. 10.

[0115] The construction and operation procedures of the vector for replacing the lactate dehydrogenase gene ldhD with the 3-dehydroquinate synthase gene aroB from E. coli W3110 were similar to the operation procedures for replacing the budA gene with the ppsA gene in step 1.1 of this example. The Klebsiella oxytocae used in this step was based on the procedure in step 1.6.

[0116] 1.7 Replacement of the alcohol dehydrogenase gene adhE with the shikimate dehydrogenase encoding gene aroE from E. coli W3110

[0117] The shikimate dehydrogenase gene aroE from E. coli W3110 has a sequence length of 819 bases, and its nucleotide sequence is shown in SEQ ID NO. 11. The alcohol dehydrogenase gene adhE has a sequence length of 780 bases, and its nucleotide sequence is shown in SEQ ID NO. 12.

[0118] The construction and operation procedures of the vector in which the alcohol dehydrogenase gene adhE is replaced by the shikimate dehydrogenase encoding gene aroE from E. coli W3110 refer to the operation procedures of replacing the budA gene with the ppsA gene in step 1.1 of this example. The Klebsiella oxytocae used in this step was based on the procedure in 1.7.

[0119] 1.8 Replacement of the fumarate reductase subunit A gene frdA with the chorismate synthase encoding gene aroC from E. coli W3110

[0120] The chorismate synthase encoding gene aroC from E. coli W3110 is 1086 bases long, and its nucleotide sequence is shown in SEQ ID NO. 13. The fumarate reductase subunit A gene is 1791 bases long, and its nucleotide sequence is shown in SEQ ID NO. 14.

[0121] The construction and operation procedures of the vector for replacing the fumarate reductase subunit A gene frdA with the chorismate synthase encoding gene aroC from E. coli W3110 were similar to the operation procedures for replacing the budA gene with the ppsA gene in step 1.1 of this example. The Klebsiella oxytocae used in this step was based on the method in step 1.8.

[0122] 1.9 Using the tryptophan operon partial gene cluster trpE from E. coli W3110 fbr(S40F) D replaces the pyruvate formate lyase gene pflB

[0123] Partial gene cluster of the tryptophan operon trpE from E. coli W3110 fbr(S40F) The D sequence is 3158 bases long, and its nucleotide sequence is shown in SEQ ID NO. 15. The pyruvate formate lyase gene pflB gene sequence is 2283 bases long, and its nucleotide sequence is shown in SEQ ID NO. 16.

[0124] The tryptophan operon partial gene cluster trpE from E. coli W3110 fbr(S40F) D. The construction and operation procedures of the pflB vector for replacing the pyruvate formate lyase gene refer to the operation procedures for replacing the budA gene with the ppsA gene in step 1.1 of this example. The Klebsiella oxytocae used in this step was based on the procedure in step 1.8.

[0125] 1.10 Replace the pyruvate oxidase gene pox with the partial gene cluster trpDC of the tryptophan operon from E. coli W3110

[0126] The tryptophan operon partial gene cluster trpDC from E. coli W3110 is 2958 bases long, and its nucleotide sequence is shown in SEQ ID NO. 17. The pyruvate oxidase gene pox gene is 1719 bases long, and its nucleotide sequence is shown in SEQ ID NO. 18.

[0127] The construction and operation procedures of the pox vector, which replaced the pyruvate oxidase gene with the partial gene cluster trpDC of the tryptophan operon from E. coli W3110, refer to the operation procedures of replacing the budA gene with the ppsA gene in step 1.1 of this example. The Klebsiella oxytocae used in this step was based on the procedure in step 1.9.

[0128] 1.11 Replacement of the phosphotransacetylase gene pta with the partial gene cluster trpBA from the tryptophan operon of E. coli W3110

[0129] The trpBA sequence of the tryptophan operon partial gene cluster from E. coli W3110 is 2000 bases long, and its nucleotide sequence is shown in SEQ ID NO. 19. The pta gene sequence of the phosphotransacetylase gene is 2199 bases long, and its nucleotide sequence is shown in SEQ ID NO. 20.

[0130] The construction and operation procedures of the pta vector, which replaced the phosphotransacetylase gene with the trpBA gene from the tryptophan operon of E. coli W3110, were similar to those for replacing the budA gene with the ppsA gene in step 1.1 of this example. The Klebsiella oxytocae strain used in this step was based on the procedure in step 1.10.

[0131] 1.12 Replacement of the pyruvate kinase gene pykF with the transketolase encoding gene tktA from E. coli W3110

[0132] The transketolase encoding gene tktA from E. coli W3110 has a sequence length of 1992 bases, and its nucleotide sequence is shown in SEQ ID NO. 21. The pyruvate kinase gene pykF has a sequence length of 1413 bases, and its nucleotide sequence is shown in SEQ ID NO. 22.

[0133] The construction and operation procedures of the vector using the transketolase encoding gene tktA from E. coli W3110 to replace the pyruvate kinase gene pykF were similar to the operation procedures for replacing the budA gene with the ppsA gene in step 1.1 of this example. The Klebsiella oxytocae used in this step was based on the procedure in step 1.11.

[0134] 1.13 Using the serA gene encoding the mutant protein of 3-phosphoglycerate dehydrogenase from E. coli W3110 fbr(H344A ,N346A,N364A) Replacement of 2,3-butanediol dehydrogenase gene budC

[0135] serA gene encoding a mutant protein of 3-phosphoglycerate dehydrogenase from E. coli W3110 fbr(H344A,N346A,N364A) The sequence length is 1233 bases, and its nucleotide sequence is shown in SEQ ID NO. 23. The 2,3-butanediol dehydrogenase gene budC sequence length is 771 bases, and its nucleotide sequence is shown in SEQ ID NO. 24.

[0136] The serA gene encoding the mutant protein of 3-phosphoglycerate dehydrogenase from E. coli W3110 was used fbr(H344A ,N346A,N364A) The construction and operation steps of the budC vector replacing the 2,3-butanediol dehydrogenase gene were similar to those of step 1.1 of this example, in which the ppsA gene replaced the budA gene. The Klebsiella oxytocaine used in this step was based on the steps in step 1.12.

[0137] 1.14 Replacement of the 1,3-propanediol dehydrogenase gene dhaT with the glutamine synthase encoding gene glnA from Corynebacterium glutamicum ATCC13032

[0138] The glutamine synthase encoding gene glnA from Corynebacterium glutamicum ATCC13032 has a 1434-base sequence, and its nucleotide sequence is shown in SEQ ID NO. 25. The 1,3-propanediol dehydrogenase gene dhaT has a 1164-base sequence, and its nucleotide sequence is shown in SEQ ID NO. 26.

[0139] The construction and operation procedures of the vector using the glutamine synthase encoding gene glnA from Corynebacterium glutamicum ATCC13032 to replace the 1,3-propanediol dehydrogenase gene dhaT were similar to the operation procedures for replacing the budA gene with the ppsA gene in step 1.1 of this example. The Klebsiella oxytocae used in this step was based on the procedure in step 1.13.

[0140] 1.15 Replacement of the glycerol dehydrogenase gene gldA with the aromatic amino acid efflux protein gene ywkB from Bacillus subtilis 168

[0141] The aromatic amino acid efflux protein gene ywkB from B. subtilis 168 has a sequence length of 960 bases, and its nucleotide sequence is shown in SEQ ID NO. 27. The glycerol dehydrogenase gene gldA has a sequence length of 1104 bases, and its nucleotide sequence is shown in SEQ ID NO. 28.

[0142] The construction and operation procedures of the vector for replacing the glycerol dehydrogenase gene gldA with the aromatic amino acid efflux protein gene ywkB from Bacillus subtilis 168 were similar to the operation procedures for replacing the budA gene with the ppsA gene in step 1.1 of this example. The Klebsiella oxytocae used in this step was based on the procedure in step 1.14.

[0143] 1.16 Replacement of the acetate kinase gene ackA with the phosphoenolpyruvate carboxykinase gene pck from Bacillus subtilis 168

[0144] The pck sequence of the phosphoenolpyruvate carboxykinase gene from B. subtilis 168 is 1584 bases long, and its nucleotide sequence is shown in SEQ ID NO. 29. The ackA sequence of the acetate kinase gene is 1203 bases long, and its nucleotide sequence is shown in SEQ ID NO. 30.

[0145] The construction and operation procedures of the vector for replacing the acetate kinase gene ackA with the phosphoenolpyruvate carboxykinase gene pck from Bacillus subtilis 168 were similar to the operation procedures for replacing the budA gene with the ppsA gene in step 1.1 of this example. The Klebsiella oxytocae bacteria used in this step were based on the procedure in step 1.15.

[0146] The recombinant Klebsiella oxytoca was finally obtained and named Klebsiella oxytoca TRP-27. Its genotype was K.oxytoca CICC21518ΔbudA::ppsAΔbudB::aroG fbr(D146N) ΔtnaAΔtrpL::P budABC ΔtrpRΔldhD::aroBΔadhE::aroEΔfrdA::aroCΔpflB::trpE fbr(S40F) DΔpox::trpDCΔpta::trpBAΔpykF::tktAΔbudC::serA fbr(H344A,N346A,N364A) ΔdhaT::glnAΔgldA::ywkBΔackA::pck. Figure 1 Shown is the L-tryptophan synthesis metabolic pathway of the recombinant bacteria of this example.

[0147] Example 2 Production of L-tryptophan by Shake Flask Fermentation of Recombinant Klebsiella oxytoca TRP-27 Using Glucose as a Substrate

[0148] (1) Plate culture: Streak the recombinant strain K.oxytoca TRP-27 onto LB medium containing 1.8% agar in a mass-to-volume ratio and culture at 37°C for 10 h.

[0149] (2) Seed culture: Under sterile conditions, pick a single colony from the plate in step (1) with a sterile pipette tip, then inoculate it into 5 mL of LB liquid medium and culture it on a shaker at 37°C for 10 hours; then inoculate it into 100 mL of LB liquid medium at a 1% (v / v) inoculum and culture it on a shaker at 37°C for 10 hours;

[0150] (3) Shake flask fermentation: Under sterile conditions, the bacterial solution obtained in step (2) was inoculated into a fermentation medium containing 80 g / L glucose at a 5% (v / v) inoculum. The fermentation conditions were as follows: a culture temperature of 37°C, a shaker culture at 180 rpm, and a pH adjusted to 6.8 with aqueous ammonia. The fermentation sample was then analyzed by high-performance liquid chromatography to determine the concentration of l-tryptophan in the fermentation broth. When glucose was no longer consumed, fermentation was stopped, and L-tryptophan was obtained from the fermentation broth.

[0151] The results showed that the recombinant strain K.oxytoca TRP-27 consumed 80 g / L of glucose after culturing for 60 h, the L-tryptophan concentration reached 14.6 g / L, and the L-tryptophan yield reached 0.183 g / g.

[0152] The LB culture medium in steps (1) to (2) is formulated as follows: 10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl, pH 7.0, and sterilized at 121°C for 20 minutes.

[0153] The fermentation medium in step (3) is formulated as follows: glucose 80 g / L, yeast extract 5 g / L, K2HPO4 10 g / L, NaH2PO4 2 g / L, NH4SO4 10 g / L, MgSO4·7H2O 0.7 g / L, and 1 mL of a 1000× trace element solution. The 1000× trace element solution comprises: CaCl2·2H2O 3 g / L, ZnCl2 3 g / L, FeCl3·2H2O 20 g / L, MnCl2·2H2O 11 g / L, CuCl2·2H2O 1 g / L, CoCl2·2H2O 2 g / L, H3BO3 0.35 g / L, and NaMoO4·2H2O 0.024 g / L. In other embodiments, the glucose content can be adjusted within the range of 80 to 90 g / L.

[0154] The detection method of the fermentation product L-tryptophan is as follows:

[0155] Fermentation broth samples were centrifuged at 12,000 rpm for 1 minute. 100 μL of the supernatant was collected and added with 400 μL of 0.5 mol / L sodium bicarbonate (pH 9.0) and 100 μL of 1% 2,4-dinitrofluorobenzene (DNFB). The mixture was shaken and incubated at 60°C in the dark for 1 hour. After cooling to room temperature, 1 mL of 0.01 mol / L KH2PO4 (pH 7.0) was added, shaken, and centrifuged. The supernatant was filtered through a 0.22 μm filter and assayed for L-tryptophan by HPLC. The specific HPLC assay conditions are as follows:

[0156] The liquid chromatograph used was Agilent 1260, and the chromatographic column was Yuexu Welchrom C 18 (4.6mm*250mm, 5μm); the detector is a VWD detector; the detection wavelength is 254nm; the mobile phase A is 0.1% trifluoroacetic acid (TFA) aqueous solution, and the mobile phase B is acetonitrile. Gradient elution is performed using mobile phases A and B in different ratios, as follows: 0-10min, 5% B; 10-13min, 80% B; 13.1-18min, 5% B; flow rate is 1mL / min; column temperature is 30℃; injection volume is 5μL; and analysis time is 18min.

[0157] Example 3 Production of L-tryptophan by Fed-Batch Fermentation of Recombinant Klebsiella oxytoca TRP-27 Using Glucose as a Substrate

[0158] (1) Plate culture: Streak the recombinant strain K.oxytoca TRP-27 onto LB medium containing 1.8% agar in a mass-to-volume ratio and culture at 37°C for 10 h.

[0159] (2) Seed culture: Under sterile conditions, pick a single colony from the plate in step (1) with a sterile pipette tip, then inoculate it into 5 mL of LB liquid medium and culture it on a shaker at 37°C for 10 hours; then inoculate it into 100 mL of LB liquid medium at a 1% (v / v) inoculum and culture it on a shaker at 37°C for 10 hours;

[0160] (3) 7.5L fermentation tank culture: Under sterile conditions, the bacterial solution obtained in step (2) was inoculated into a fermentation medium containing 60g / L glucose at a 10% (v / v) inoculum. The fermentation conditions were as follows: a 5L liquid volume, a culture temperature of 37°C, a stirred culture, a stirring speed of 500 rpm, a dissolved oxygen level, a cascade speed, and aeration maintained at 15% to 20%, and a pH adjusted to 6.8±0.1 with ammonia. During this period, 500g / L of glucose mother solution was added according to the glucose concentration to maintain the glucose concentration at 0g / L. Fermentation was stopped after 40 hours, and L-tryptophan was obtained from the fermentation broth.

[0161] The results showed that the recombinant strain K.oxytoca TRP-27 consumed 272.7 g / L of glucose after 60 hours of culture, and the L-tryptophan concentration reached 60.0 g / L, with an L-tryptophan yield of 0.23 g / g. These are the highest yield and conversion rates to date, and it is also the first time that a high-L-tryptophan-producing strain has been obtained using Klebsiella oxytoca as a chassis strain.

[0162] The detection method of the product L-tryptophan, the LB culture medium formula, and the fermentation medium formula described in the above steps are the same as those in Example 2, except that the concentration of glucose in the fermentation medium formula of this example is 60 g / L.

[0163] The technical solution of the present invention is further illustrated by experiments below.

[0164] Experimental Example 1: Blocking the 2,3-butanediol synthesis pathway and enhancing the L-tryptophan synthesis pathway

[0165] In this experiment, K. oxytoca CICC21518 of the Klebsiella genus was selected as the production host. By blocking the synthesis of 2,3-butanediol to enhance the accumulation of the precursor pyruvate, and simultaneously enhancing the expression of phosphoenolpyruvate synthase and feedback inhibition-insensitive 3-deoxy-D-arabinoheptulose-7-phosphate synthase, the metabolic flow of 2,3-butanediol synthesis was redirected from pyruvate to L-tryptophan synthesis.

[0166] The gene knockout and gene integration used in the present invention are both carried out using two-step homologous recombination technology. The specific operation process is referred to the above embodiment. At the same time, this experimental example selected the phosphoenolpyruvate synthase ppsA (nucleotide sequence is SEQ ID NO.1) from Escherichia coli and the feedback inhibition-insensitive 3-deoxy-7-phosphoheptanoate synthase gene aroG fbr(D146N)(nucleotide sequence is SEQ ID NO.3), and referring to the above gene integration technology, the ppsA gene was integrated into the site of the α-acetolactate decarboxylase gene budA (nucleotide sequence is SEQ ID NO.2), a key gene in the 2,3-butanediol biosynthesis pathway in the K.oxytoca genome, to obtain the recombinant strain K.oxytoca TRP-2; ppsA and aroG fbr(D146N) The genes were respectively integrated into the sites of the α-acetolactate decarboxylase gene budA (nucleotide sequence is SEQ ID NO.2) and the α-acetolactate synthase gene budB (nucleotide sequence is SEQ ID NO.4), which are key genes in the 2,3-butanediol synthesis pathway in the K.oxytoca genome, to obtain the recombinant strain K.oxytoca TRP-4.

[0167] The starting strains K.oxytoca TRP-0, K.oxytoca TRP-2 and the recombinant strain K.oxytoca TRP-4 were cultured in shake flasks for 60 h according to the culture method of Example 2, and the fermentation broth was subjected to high performance liquid chromatography (HPLC) for metabolite analysis.

[0168] Table 1. Effects of blocking the 2,3-butanediol synthesis pathway and enhancing the L-tryptophan synthesis pathway

[0169]

[0170] The fermentation results are shown in Table 1. The results show that the main fermentation product of the starting strain K.oxytoca CICC21518 is 2,3-butanediol. fbr(D146N) After fermentation, the recombinant strain K.oxytoca TRP-4 almost stopped accumulating 2,3-butanediol and accumulated 0.8 g / L of L-tryptophan.

[0171] Experimental Example 2 Blocking the L-tryptophan degradation pathway

[0172] In this experimental example, the L-tryptophanase encoding gene tnaA (nucleotide sequence is SEQ ID NO. 5) of K. oxytoca CICC21518 was knocked out to increase L-tryptophan accumulation.

[0173] The gene knockout in the present invention uses a two-step homologous recombination technique, and the specific operation process is referred to the above Example 1. The recombinant strain K.oxytoca TRP-4 was knocked out of the tryptophanase tnaA to obtain the recombinant strain K.oxytoca TRP-5.

[0174] The recombinant strains K.oxytoca TRP-4 and K.oxytoca TRP-5 were cultured in shake flasks for 60 h according to the culture method of Example 2, and the fermentation broth was subjected to high performance liquid chromatography (HPLC) for metabolite analysis.

[0175] Table 2. Effects of blocking the l-tryptophan degradation pathway on L-tryptophan production

[0176]

[0177] The fermentation results are shown in Table 2. The results show that after knocking out the tryptophanase tnaA, the L-tryptophan accumulation of the recombinant strain K.oxytocaTRP-5 increased to 1.3 g / L.

[0178] Experimental Example 3: Introducing a strong endogenous promoter to enhance the expression of tryptophan operon genes

[0179] This experiment attempts to introduce the endogenous strong promoter P budABC (nucleotide sequence is SEQ ID NO.6) replaces thrL (nucleotide sequence is SEQ ID NO.7) to enhance the transcription of the L-tryptophan synthesis gene cluster.

[0180] The gene integration used in the present invention adopts a two-step homologous recombination technology. The specific operation process is referred to the above Example 1. Based on the recombinant strain K.oxytoca TRP-5, a strong promoter P was introduced. budABC to the attenuator thrL site to obtain the recombinant strain K.oxytoca TRP-6.

[0181] The recombinant strains K.oxytoca TRP-5 and K.oxytoca TRP-6 were cultured in shake flasks according to the culture method of Example 2 for 60 h, and the fermentation broth was subjected to high performance liquid chromatography (HPLC) for metabolite analysis.

[0182] Table 3. Introduction of strong endogenous promoters to enhance the expression of tryptophan operon genes

[0183]

[0184] The fermentation results are shown in Table 3. The results show that the strong promoter P budABC After replacing thrL, the L-tryptophan accumulation of the recombinant strain K.oxytocaTRP-6 was significantly increased to 5.2 g / L.

[0185] Experimental Example 4 Screening of different rate-limiting genes to improve L-tryptophan production

[0186] In order to further improve L-tryptophan production, this experimental example screened the rate-limiting genes of the L-tryptophan synthesis pathway to ensure the expression level of powerful L-tryptophan synthesis-related genes. Specifically, first, on the basis of recombinant strain K.oxytoca TRP-6, the transcriptional repressor trpR (SEQ ID NO.8) of the L-tryptophan operon was inactivated to obtain recombinant strain K.oxytoca TRP-7. Subsequently, on the basis of recombinant strain K.oxytoca TRP-7, the expression of key genes for shikimic acid synthesis and key genes for L-tryptophan synthesis was enhanced to improve the L-tryptophan accumulation level. Specifically, the 3-dehydroquinic acid synthase encoding gene aroB (SEQ ID NO.9), shikimate dehydrogenase encoding gene aroE (SEQID NO.11), chorismate synthase encoding gene aroC (SEQ ID NO.13), tryptophan operon partial gene cluster trpE from E.coliW3110 were strengthened. fbr D (SEQ ID NO.15), tryptophan operon partial gene cluster trpDC (SEQ ID NO.17), tryptophan operon partial gene cluster trpBA (SEQ ID NO.19) and transketolase encoding gene tktA (SEQ ID NO.21).

[0187] The gene integration and gene knockout used in this experimental example used a two-step homologous recombination technique. The specific operation process is referred to the above Example 1. The above genes were introduced into the D-lactate dehydrogenase gene ldhD (SEQ ID NO. 10) site of the recombinant strain K. oxytoca TRP-7. In addition, this experimental example further integrated all the rate-limiting genes screened into different gene sites of K. oxytoca TRP-7, namely adhE (SEQ ID NO. 12), frdA (SEQ ID NO. 14), pflB (SEQ ID NO. 16), pox (SEQ ID NO. 18), pta (SEQ ID NO. 20), and pykF (SEQ ID NO. 22).

[0188] The obtained series of recombinant K.oxytoca were cultured in shake flasks for 60 h according to the culture method of Example 2, and the fermentation broth was subjected to high performance liquid chromatography (HPLC) for metabolite analysis.

[0189] Table 4 Effects of expression of different rate-limiting genes on increasing L-tryptophan production

[0190]

[0191]

[0192] The results are shown in Table 4. The L-tryptophan production of the recombinant strains obtained by enhancing different rate-limiting genes was improved to varying degrees. fbr(S40F) The recombinant strain containing the D rate-limiting gene (TRP-11) showed the best improvement. Furthermore, all the selected rate-limiting genes were integrated into different gene loci of K.oxytoca TRP-7 to obtain strain K.oxytoca TRP-22, which can accumulate 10.1g / L of L-tryptophan.

[0193] Experimental Example 5: Strengthening L-serine synthesis to increase L-tryptophan production

[0194] In the L-tryptophan biosynthesis pathway, L-serine participates in a reaction catalyzed by tryptophan synthase, which is the final step in L-tryptophan synthesis. Therefore, a sufficient supply of L-serine is beneficial for L-tryptophan production. However, L-serine synthesis is primarily limited by the strict feedback inhibition of 3-phosphoglycerate dehydrogenase by L-serine.

[0195] Therefore, the present invention adopts two-step homologous recombination technology to transform the 3-phosphoglycerate dehydrogenase mutant protein encoding gene serA from E. coli W3110 into the recombinant strain K. oxytoca TRP-22. fbr(H344A,N346A,N364A) (SEQ ID NO.23) was inserted into the site of 2,3-butanediol dehydrogenase gene budC (SEQ ID NO.24) to obtain the recombinant strain K.oxytoca TRP-23.

[0196] The obtained recombinant K.oxytoca was cultured in a shake flask for 60 h according to the culture method of Example 2, and the fermentation broth was subjected to high performance liquid chromatography (HPLC) for metabolite analysis.

[0197] Table 5. Effect of overexpression of feedback-insensitive 3-phosphoglycerate dehydrogenase on improving L-tryptophan production

[0198]

[0199] The results are shown in Table 5. Overexpression of feedback-insensitive 3-phosphoglycerate dehydrogenase can increase the L-tryptophan accumulation level. The obtained strain K.oxytocaTRP-23 can accumulate 12.2 g / L of L-tryptophan.

[0200] Experimental Example 6: Strengthening glutamine supply to increase L-tryptophan production

[0201] In the L-tryptophan synthesis pathway, chorismate is its key intermediate metabolite and is also a precursor substance of L-phenylalanine and L-tyrosine. However, chorismate mainly enters L-tryptophan synthesis through aminobenzoate synthase, and this reaction requires glutamine to participate. Therefore, the supply of glutamine is conducive to L-tryptophan production. The present invention adopts two-step homologous recombination technology. On the basis of recombinant strain K.oxytoca TRP-23, the glutamine synthase encoding gene glnA (SEQ ID NO.25) from Corynebacterium glutamicum ATCC13032 is inserted into the site of 1,3-propylene glycol dehydrogenase gene dhaT (SEQ ID NO.26), obtaining recombinant strain K.oxytoca TRP-24.

[0202] The obtained recombinant K.oxytoca was cultured in a shake flask for 60 h according to the culture method of Example 2, and the fermentation broth was subjected to high performance liquid chromatography (HPLC) for metabolite analysis.

[0203] Table 6. Effect of enhanced glutamine supply on improving L-tryptophan production

[0204]

[0205]

[0206] The results are shown in Table 6. The introduction of the heterologous glutamine synthase encoding gene glnA can increase the L-tryptophan accumulation level. The obtained strain K.oxytocaTRP-24 can accumulate 13.0 g / L of L-tryptophan.

[0207] Experimental Example 7 Strengthening L-tryptophan efflux pathway to increase L-tryptophan production

[0208] The activity and expression of key enzymes in the L-tryptophan biosynthesis pathway are subject to strict feedback inhibition by L-tryptophan. To alleviate this negative feedback effect, in addition to the known introduction of negative feedback-insensitive mutation sites in key enzymes, reducing the intracellular L-tryptophan concentration is also an important approach. In addition, excessive intracellular L-tryptophan concentrations can also inhibit strain growth, and improving L-tryptophan efflux can effectively reduce the intracellular L-tryptophan concentration. Therefore, the present invention uses a two-step homologous recombination technique. Based on the recombinant strain K.oxytoca TRP-24, the aromatic amino acid efflux protein gene ywkB (SEQ ID NO.27) from Bacillus subtilis 168 and the L-tryptophan efflux protein gene yddG from Escherichia coli W3110 are respectively inserted into the site of the glycerol dehydrogenase gene gldA (SEQ ID NO.28), thereby obtaining recombinant strains K.oxytoca TRP-25 and TRP-26.

[0209] The obtained series of recombinant K.oxytoca were cultured in shake flasks for 60 h according to the culture method of Example 2, and the fermentation broth was subjected to high performance liquid chromatography (HPLC) for metabolite analysis.

[0210] Table 7. Effect of enhancing l-tryptophan efflux on improving L-tryptophan production

[0211]

[0212] The results, shown in Table 7, indicate that the introduction of heterologous L-tryptophan efflux proteins increased L-tryptophan accumulation in all recombinant strains. In particular, strain K.oxytocaTRP-25, which introduced the aromatic amino acid efflux protein gene ywkB, accumulated significantly more L-tryptophan, reaching a yield of 14.0 g / L in shake flask fermentation.

[0213] Experimental Example 8: Enhancing the expression of phosphoenolpyruvate carboxykinase to increase L-tryptophan production

[0214] Phosphoenolpyruvate carboxykinase (PEK) catalyzes the conversion of oxaloacetate into phosphoenolpyruvate, a precursor for L-tryptophan synthesis. Therefore, enhancing the expression of PEK may be beneficial for L-tryptophan production. The present invention employs a two-step homologous recombination technique to insert the PEK gene pck (SEQ ID NO. 29) from Bacillus subtilis 168 into the site of the acetate kinase gene ackA (SEQ ID NO. 30) in the recombinant strain K.oxytoca TRP-26, yielding the recombinant strain K.oxytoca TRP-27.

[0215] The obtained recombinant K.oxytoca was cultured in a shake flask for 60 h according to the culture method of Example 2, and the fermentation broth was subjected to high performance liquid chromatography (HPLC) for metabolite analysis.

[0216] Table 8. Effect of increasing the expression of phosphoenolpyruvate carboxykinase on increasing L-tryptophan production

[0217]

[0218]

[0219] The results are shown in Table 8. The strain K.oxytocaTRP-27 obtained by enhancing the expression of phosphoenolpyruvate carboxykinase was able to accumulate 14.6 g / L of L-tryptophan by shake flask fermentation.

[0220] The above experiments demonstrate that, by integrating Klebsiella oxytoca's metabolic pathways and introducing key L-tryptophan biosynthesis genes from various sources, it is possible to shift the metabolic flux from 2,3-butanediol to L-tryptophan. Further optimization of the L-tryptophan biosynthesis pathway, blocking the L-tryptophan degradation pathway, enhancing the supply of precursors, and screening for transporters significantly promoted the stabilization of the L-tryptophan metabolic flux and the accumulation of the product. This resulted in a genetically engineered strain that efficiently produces L-tryptophan.

[0221] Through the above embodiments and experimental examples, it can be seen that the present invention provides a recombinant microorganism that produces high L-tryptophan, and its construction method and application. The present invention selects a recombinant Klebsiella oxytoca TRP-27 that produces high L-tryptophan by screening for genes to be knocked out or added, and its genotype is K.oxytoca CICC21518ΔbudA::ppsAΔbudB::aroG fbr(D146N) ΔtnaAΔtrpL::P budABC ΔtrpRΔldhD::aroBΔadhE::aroEΔfrdA::aroCΔpflB::trpE fbr(S40F) DΔpox::trpDCΔpta::trpBAΔpykF::tktAΔbudC::serA fbr(H344A,N346A,N364A) ΔdhaT::glnAΔgldA::ywkBΔackA::pck. The recombinant Klebsiella oxytocaine of the present invention can be used for the fermentation production of L-tryptophan. Experiments have confirmed that the engineered strain of the present invention can metabolize glucose to efficiently produce L-tryptophan, with an output of 60.0 g / L and a yield of 0.23 g / g. The present invention provides a method for achieving efficient production of L-tryptophan by microorganisms by redirecting the metabolic flux of 2,3-butanediol synthesis to L-tryptophan synthesis through pyruvate; the L-tryptophan production process provided by the present invention is simple, low-cost, and has important economic benefits and social significance.

Claims

1. A recombinant microorganism for producing L-tryptophan, characterized in that: The starting strain of the recombinant microorganism is selected from a Klebsiella strain; the recombinant microorganism overexpresses the phosphoenolpyruvate synthase gene ppsA, the tryptophan operon partial gene cluster trpE fbr D gene.

2. The recombinant microorganism for producing L-tryptophan according to claim 1, wherein: The tryptophan operon partial gene cluster trpE fbr The nucleotide sequence of the D gene is shown in SEQ ID NO.

15.

3. The recombinant microorganism for producing L-tryptophan according to claim 1, wherein: The starting strain is selected from at least one of Klebsiella oxytoca, Klebsiella terrestris, Klebsiella plantarum and Klebsiella pneumoniae.

4. The recombinant microorganism for producing L-tryptophan according to any one of claims 1 to 3, characterized in that: The recombinant microorganism is constructed by inactivating byproduct and / or enzyme genes in the 2,3-butanediol synthesis pathway on the basis of a starting strain, and enhancing genes related to L-tryptophan synthesis flux; the byproduct is selected from at least one of acetic acid, formic acid, succinic acid, and lactic acid; and the genes related to L-tryptophan synthesis flux are selected from at least one of L-tryptophan synthesis-related enzyme genes, metabolic pathway-related genes, efflux protein genes, and endogenous strong promoter genes.

5. The recombinant microorganism for producing L-tryptophan according to claim 4, characterized in that: The enzyme genes in the by-product and / or 2,3-butanediol synthesis pathway are selected from at least one to sixteen of the pyruvate kinase encoding gene pykF, the tryptophanase encoding gene tnaA, the transcriptional repressor trpR of the tryptophan operon, the attenuator trpL of the tryptophan operon, the pyruvate oxidase gene pox, the phosphotransacetylase gene pta, the acetate kinase ackA, the fumarate reductase subunit A gene frdA, the lactate dehydrogenase gene ldhD, the pyruvate formate lyase gene pflB, the alcohol dehydrogenase gene adhE, the α-acetolactate synthase gene budB, the α-acetolactate decarboxylase gene budA, the 2,3-butanediol dehydrogenase gene budC, the glycerol dehydrogenase gene gldA, and the 1,3-propanediol dehydrogenase gene dhaT.

6. The recombinant microorganism for producing L-tryptophan according to claim 4, wherein: The L-tryptophan synthesis flux-related gene is selected from the promoter P of the 2,3-butanediol synthesis gene cluster. budABC 、3-deoxy-d-arabinoheptulose-7-phosphate synthase mutant protein encoding gene aroG fbr , serA, a gene encoding a mutant protein of 3-phosphoglycerate dehydrogenase fbr , 3-dehydroquinate synthase encoding gene aroB, shikimate dehydrogenase encoding gene aroE, chorismate synthase encoding gene aroC, tryptophan operon partial gene cluster trpDC, tryptophan operon partial gene cluster trpBA, transketolase encoding gene tktA, aromatic amino acid efflux protein encoding gene ywkB, phosphoenolpyruvate carboxykinase gene pck, glutamine synthase encoding gene glnA, L-tryptophan efflux protein gene yddG, at least one to thirteen of the following.

7. The method for constructing a recombinant microorganism for producing L-tryptophan according to any one of claims 1 to 6, characterized in that: The construction method includes inactivating byproduct and / or enzyme genes in the 2,3-butanediol synthesis pathway on the basis of the starting strain, and enhancing the construction of genes related to L-tryptophan synthesis flux; the byproduct is selected from at least one of acetic acid, formic acid, succinic acid, and lactic acid; and the gene related to L-tryptophan synthesis flux is selected from at least one of L-tryptophan synthesis-related enzyme genes, metabolic pathway-related genes, efflux protein genes, and endogenous strong promoter genes.

8. Use of the recombinant microorganism for producing L-tryptophan according to any one of claims 1 to 6 in producing L-tryptophan.

9. The use according to claim 8, characterized in that: Overexpression of phosphoenolpyruvate synthase gene ppsA, tryptophan operon partial gene cluster trpE fbr The recombinant microorganism with the D gene is cultured using a fermentation medium containing glucose.

10. The use according to claim 9, characterized in that: The concentration of glucose in the fermentation medium is 80-100 g / L; And / or, the inoculum size of the recombinant microorganism during cultivation is 5-10% by volume; And / or, the stirring speed during the culture is 500-1000 rpm; and / or, the pH during the culture is 6.8±0.1; and / or, the temperature during the culture is 37±0.5°C; and / or, the glucose concentration is maintained at 0-5 g / L during the culture; and / or, the culture time is 40-60 hours.

Citation Information

Patent Citations

  • TrpE mutant and application thereof in genetically engineered bacteria for producing L-tryptophan

    CN111926002A

  • Escherichia coli tryptophan synthesis strain capable of reducing generation of acetic acid

    CN116536231A

  • Genetically engineered bacterium for producing L-tryptophan as well as construction method and application of genetically engineered bacterium

    CN118086167A

  • In vitro synthesis of l-tryptophan

    WO1986005515A1