Method for increasing synthesis amount of lignin in arabidopsis thaliana by using agropyron cristatum AmCOMT gene

Abstract

The invention provides a method for increasing the synthesis amount of lignin in arabidopsis thaliana by using an agropyron cristatum AmCOMT gene, and belongs to the field of plant genetic engineering. The method comprises the following steps: transferring a nucleic acid molecule which is derived from Mongolian agropyron cristatum and is used for coding caffeic acid oxygen methyl transferase into arabidopsis thaliana, and enabling the arabidopsis thaliana to over-express the caffeic acid oxygen methyl transferase. According to the application, the COMT gene of the agropyron mongolicum is successfully transferred into the arabidopsis thaliana and is efficiently expressed in the arabidopsis thaliana, so that the transgenic arabidopsis thaliana containing the AmCOMT gene is obtained, the content of lignin in the cell wall of the arabidopsis thaliana is remarkably increased, and the stress resistance of the arabidopsis thaliana to drought, high-salt and other environments is remarkably enhanced.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant genetic engineering, and in particular relates to a method for increasing the amount of lignin synthesis in Arabidopsis thaliana by utilizing the AmCOMT gene of wheatgrass. Background Art

[0002] Agropyron mongolicum is a xerophytic, monocotyledonous, cross-pollinated perennial grass found in xerophytic and psammophytic desert steppes. Wild sources are pure diploid (2n=2x=14, PP), demonstrating strong adaptability and resilience, including tolerance to drought, barrenness, and windblown sand. It is primarily distributed in Inner Mongolia, Shanxi, Shaanxi, Gansu, Ningxia, and Xinjiang, China. With relatively high levels of various nutrients, including carotene and crude fiber, soft stems and leaves, good quality, and a prolonged green leaf period, Agropyron mongolicum provides high-quality winter and spring forage for livestock, possessing high forage, ecological, and breeding value. Therefore, tapping into the rich resistance gene resources of Agropyron mongolicum has great potential and utility for improving the adaptability of grass crops.

[0003] The biosynthesis of monolignin requires two methylation reactions. COMT, a crucial methylase in the phenylpropanoid metabolic pathway, catalyzes the multistep methylation of hydroxylated monolignin precursors and plays a major role in the lignin biosynthesis pathway. During the growth and development of dicotyledonous angiosperms, COMT catalyzes the conversion of caffeic acid, 5-hydroxyconiferaldehyde, and 5-hydroxyconiferyl alcohol to ferulic acid, sinapyl aldehyde, and sinapyl alcohol, respectively. In gymnosperms, COMT only catalyzes the conversion of caffeic acid. COMT is the rate-limiting enzyme in the synthesis of S-type monolignin and is closely involved in the conversion of G-type lignin to S-type lignin. Numerous studies have investigated the effects of the COMT gene on lignin synthesis, with most results indicating that mutations in or inhibition of the COMT gene lead to reduced lignin content and altered lignin composition. COMT is primarily involved in the synthesis of S-type lignin and has a significant impact on total lignin content.

[0004] Therefore, further exploring the physiological and biochemical functions of lignin may provide new ideas for research on plant growth and development, as well as plant stress physiology. However, existing technologies have not yet successfully explored the function and impact of the COMT gene in transgenic plants of Mongolian wheatgrass. Summary of the Invention

[0005] In order to solve the above problems, the present invention uses genetic engineering to amplify the AmCOMT gene of Mongolian wheatgrass, construct a prokaryotic expression vector, induce the acquisition of prokaryotic expression protein, and determine the activity of the prokaryotic expression protein of the AmCOMT gene by HPLC (high performance liquid chromatography) detection. The AmCOMT gene is then transferred into the model plant Arabidopsis thaliana and successfully expressed. The results showed that the synthesis of lignin in Arabidopsis thaliana was significantly improved, and the plant's resistance to drought, high salt, etc. was significantly enhanced.

[0006] The first object of the present application is to provide a method for increasing the amount of lignin synthesis in Arabidopsis thaliana, comprising the following steps:

[0007] The nucleic acid molecule encoding caffeic acid oxygen methyltransferase derived from wheatgrass is transferred into Arabidopsis thaliana to express or overexpress the caffeic acid oxygen methyltransferase;

[0008] The caffeic acid oxygen methyltransferase is selected from any one of the following:

[0009] A1), comprising the amino acid sequence shown in SEQ ID NO.1;

[0010] A2) a protein having an amino acid sequence identity of more than 80% with that of A1) and having the same function;

[0011] A3) A fusion protein obtained by connecting a protein tag to the N-terminus and / or C-terminus of the amino acid sequence described in A1) or A2).

[0012] In one embodiment, A2) has at least 80%, 85%, 90%, 95%, or 98% identity with the amino acid sequence of A1) and has the same function.

[0013] In one embodiment, the protein tag in A3) can be a conventional tag protein, such as a His tag, a SUMO tag, etc.

[0014] In one embodiment, the method increases the lignin content in Arabidopsis thaliana cell walls, such as the cell walls of stem cells.

[0015] In one embodiment, the nucleic acid molecule encoding caffeic acid oxygen methyltransferase comprises the nucleotide sequence shown in SEQ ID NO.2.

[0016] In one embodiment, the method of transfer comprises the step of introducing any one of the following substances into the recipient of Arabidopsis thaliana:

[0017] B1), the nucleotide sequence shown in SEQ ID NO.2;

[0018] B2), an expression cassette containing the nucleotide sequence described in B1);

[0019] B3) a recombinant vector containing the nucleotide sequence described in B1) or the expression cassette described in B2);

[0020] B4) A recombinant microorganism containing the nucleotide sequence described in B1), or containing the expression cassette described in B2), or containing the recombinant vector described in B3).

[0021] In one embodiment, the expression cassette in B2) may include functional elements such as a promoter, a terminator, and a marker gene, which can be routinely selected according to actual conditions.

[0022] In one embodiment, the recombinant vector in B3) includes but is not limited to plasmid, phage, cosmid, and animal virus.

[0023] Preferably, the vector is a plasmid, such as pGWC, pMDC32, pET series, pUC series and other plasmid vectors.

[0024] In one embodiment, B4) the recombinant microorganism is selected from one or more of Agrobacterium, Escherichia coli, Corynebacterium glutamicum, Bacillus subtilis, and yeast.

[0025] In one embodiment, the receptor is selected from a plant cell, a plant cell line, a plant protoplast, a plant tissue, a plant organ and / or a whole plant of Arabidopsis thaliana.

[0026] It is understandable that the receptors described in this application should be understood as receptors for plant gene transformation, which means that the explants used for transformation can efficiently and stably regenerate asexual lines through tissue culture or other non-tissue culture methods, and can accept exogenous DNA integration and transform and select antibiotic-sensitive regeneration systems.

[0027] In one embodiment, the methods of transformation described herein include, but are not limited to, Agrobacterium vector transformation and / or gene gun transformation. For example, Agrobacterium containing a nucleic acid molecule encoding caffeic acid oxygen methyltransferase derived from wheatgrass can be transformed into plants using the floral dip method.

[0028] The second object of the present application is to provide a method for cultivating Arabidopsis thaliana with high lignin content, comprising the following steps:

[0029] The nucleic acid molecule encoding caffeic acid oxygen methyltransferase from Wheatgrass in Mongolia was transferred into the recipient of Arabidopsis thaliana;

[0030] cultivating the recipient to become a plant that overexpresses the caffeic acid oxygen methyltransferase;

[0031] The caffeic acid oxygen methyltransferase is selected from any one of the following:

[0032] A1), comprising the amino acid sequence shown in SEQ ID NO.1;

[0033] A2) a protein having an amino acid sequence identity of more than 80% with that of A1) and having the same function;

[0034] A3) A fusion protein obtained by connecting a protein tag to the N-terminus and / or C-terminus of the amino acid sequence described in A1) or A2).

[0035] In one embodiment, the nucleic acid molecule encoding caffeic acid oxytransferase comprises the nucleotide sequence shown in SEQ ID NO.2.

[0036] In one embodiment, the method of transfer comprises the step of introducing any one of the following substances into the recipient of Arabidopsis thaliana:

[0037] B1), the nucleotide sequence shown in SEQ ID NO.2;

[0038] B2), an expression cassette containing the nucleotide sequence described in B1);

[0039] B3) a recombinant vector containing the nucleotide sequence described in B1) or the expression cassette described in B2);

[0040] B4) A recombinant microorganism containing the nucleotide sequence described in B1), or containing the expression cassette described in B2), or containing the recombinant vector described in B3).

[0041] In one embodiment, the receptor is selected from a plant cell, a plant cell line, a plant protoplast, a plant tissue, a plant organ and / or a whole plant of Arabidopsis thaliana.

[0042] The third object of the present application is to provide a method for improving the stress resistance of Arabidopsis thaliana to drought and / or high salt environments, comprising the following steps:

[0043] The nucleic acid molecule encoding caffeic acid oxygen methyltransferase derived from wheatgrass is transferred into Arabidopsis thaliana to express or overexpress the caffeic acid oxygen methyltransferase;

[0044] The caffeic acid oxygen methyltransferase is selected from any one of the following:

[0045] A1), comprising the amino acid sequence shown in SEQ ID NO.1;

[0046] A2) a protein having an amino acid sequence identity of more than 80% with that of A1) and having the same function;

[0047] A3) A fusion protein obtained by connecting a protein tag to the N-terminus and / or C-terminus of the amino acid sequence described in A1) or A2).

[0048] In one embodiment, the nucleic acid molecule encoding caffeic acid oxygen methyltransferase comprises the nucleotide sequence shown in SEQ ID NO.2.

[0049] In one embodiment, the method of transfer comprises the step of introducing any one of the following substances into the recipient of Arabidopsis thaliana:

[0050] B1), the nucleotide sequence shown in SEQ ID NO.2;

[0051] B2), an expression cassette containing the nucleotide sequence described in B1);

[0052] B3) a recombinant vector containing the nucleotide sequence described in B1) or the expression cassette described in B2);

[0053] B4) A recombinant microorganism containing the nucleotide sequence described in B1), or containing the expression cassette described in B2), or containing the recombinant vector described in B3).

[0054] In one embodiment, the receptor is selected from a plant cell, a plant cell line, a plant protoplast, a plant tissue, a plant organ and / or a whole plant of Arabidopsis thaliana.

[0055] The fourth object of the present application is to provide a method for cultivating Arabidopsis thaliana with high resistance to drought and / or high salt environments, comprising the following steps:

[0056] The nucleic acid molecule encoding caffeic acid oxygen methyltransferase from Wheatgrass in Mongolia was transferred into the recipient of Arabidopsis thaliana;

[0057] cultivating the recipient to become a plant that overexpresses the caffeic acid oxygen methyltransferase;

[0058] The caffeic acid oxygen methyltransferase is selected from any one of the following:

[0059] A1), comprising the amino acid sequence shown in SEQ ID NO.1;

[0060] A2) a protein having an amino acid sequence identity of more than 80% with that of A1) and having the same function;

[0061] A3) A fusion protein obtained by connecting a protein tag to the N-terminus and / or C-terminus of the amino acid sequence described in A1) or A2).

[0062] In one embodiment, the nucleic acid molecule encoding caffeic acid oxygen methyltransferase comprises the nucleotide sequence shown in SEQ ID NO.2.

[0063] In one embodiment, the method of transfer comprises the step of introducing any one of the following substances into the recipient of Arabidopsis thaliana:

[0064] B1), the nucleotide sequence shown in SEQ ID NO.2;

[0065] B2), an expression cassette containing the nucleotide sequence described in B1);

[0066] B3) a recombinant vector containing the nucleotide sequence described in B1) or the expression cassette described in B2);

[0067] B4) A recombinant microorganism containing the nucleotide sequence described in B1), or containing the expression cassette described in B2), or containing the recombinant vector described in B3).

[0068] In one embodiment, the receptor is selected from a plant cell, a plant cell line, a plant protoplast, a plant tissue, a plant organ and / or a whole plant of Arabidopsis thaliana.

[0069] The fifth object of the present application is to provide an application of a biomaterial in any of the following:

[0070] 1. Increasing the amount of plant lignin synthesis, and / or preparing products that increase the amount of plant lignin synthesis;

[0071] II. Improving the resistance of plants to drought environments, and / or preparing products that improve the resistance of plants to drought environments;

[0072] III. Improving the stress resistance of plants to high-salt environments, and / or preparing products that improve the stress resistance of plants to high-salt environments;

[0073] The plants include Arabidopsis thaliana;

[0074] The biological material is selected from any one of the following:

[0075] A1), comprising the amino acid sequence shown in SEQ ID NO.1;

[0076] A2) a protein having an amino acid sequence identity of more than 80% with that of A1) and having the same function;

[0077] A3) a fusion protein obtained by connecting a protein tag to the N-terminus and / or C-terminus of the amino acid sequence described in A1) or A2);

[0078] B1), the nucleotide sequence shown in SEQ ID NO.2;

[0079] B2), an expression cassette containing the nucleotide sequence described in B1);

[0080] B3) a recombinant vector containing the nucleotide sequence described in B1) or the expression cassette described in B2);

[0081] B4) A recombinant microorganism containing the nucleotide sequence described in B1), or containing the expression cassette described in B2), or containing the recombinant vector described in B3).

[0082] In one embodiment, the use comprises the step of transferring the biological material or product into a plant recipient.

[0083] In one embodiment, the plant receptor is selected from a plant cell, a plant cell line, a plant protoplast, a plant tissue, a plant organ and / or a whole plant.

[0084] The sixth object of the present application is to provide a product for increasing the amount of lignin synthesis in plants and / or increasing the resistance of plants to drought and / or high-salt environments, wherein the product comprises the biological material; and the plant comprises Arabidopsis thaliana.

[0085] This application has at least the following beneficial effects:

[0086] 1. This application uses degenerate primers to clone and identify a COMT gene from Mongol wheatgrass, and conducts bioinformatics analysis on it. At the same time, the expression levels of the AmCOMT gene in different tissues of Mongol wheatgrass are analyzed, and a relatively detailed functional study is conducted on it using Arabidopsis experiments. The purpose is to explore genes related to the excellent stress resistance traits of Mongol wheatgrass, provide basic materials for further enriching the functions of the COMT gene family, and provide important candidate genes for the genetic breeding of stress tolerance of Mongol wheatgrass.

[0087] 2. This application successfully transferred the COMT gene of Mongolian wheatgrass into Arabidopsis thaliana and made it highly expressed in Arabidopsis thaliana, obtaining transgenic Arabidopsis thaliana containing the AmCOMT gene and significantly increasing the lignin content in the Arabidopsis cell wall, thereby significantly enhancing the Arabidopsis thaliana's resistance to drought, high salt and other environmental stresses. BRIEF DESCRIPTION OF THE DRAWINGS

[0088] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate embodiments consistent with the invention and, together with the description, serve to explain the principles of the invention.

[0089] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for the embodiments or the description of the prior art. For those skilled in the art, other drawings can be obtained based on these drawings without inventive work. In the drawings:

[0090] Figure 1 This is the result of AmCOMT gene PCR detection;

[0091] Figure 2 This is the result diagram of the AmCOMT gene phylogenetic tree;

[0092] Figure 3 This is the result of COMT candidate gene domain analysis;

[0093] Figure 4 This is the result of spatial expression analysis of AmCOMT gene;

[0094] Figure 5 This is the result of analysis of the expression of AmCOMT gene under induced conditions;

[0095] Figure 6 This is the electrophoresis pattern of the prokaryotic expression protein of pET32a-AmCOMT;

[0096] Figure 7 This is the result of HPLC detection of AmCOMT gene;

[0097] Figure 8 This is the result of Maule staining of transgenic Arabidopsis thaliana material. DETAILED DESCRIPTION

[0098] In order to more clearly illustrate the overall concept of the application, the following is described in detail in the form of embodiments. In the following description, a large amount of specific details are provided so that a more thorough understanding of the application is provided. However, it will be apparent to those skilled in the art that the application can be implemented without the need for one or more of these details. In other examples, in order to avoid confusion with the application, some technical features well known in the art are not described.

[0099] Unless otherwise specified, the materials, reagents, carriers, and E. coli used in the following examples can all be purchased from the company through commercial channels.

[0100] In the following examples, the PCR amplification reaction marker was purchased from Quanshijin Biotechnology Co., Ltd. (catalog number BM101-01), the PCR amplification reaction enzyme was purchased from TaKaRa Co., Ltd. (catalog number DR044A), and the marker used in the protein electrophoresis experiment was purchased from Quanshijin Biotechnology Co., Ltd. (catalog number DM111-02).

[0101] Example 1: Construction of a full-length cDNA library of Agropyron mongolica

[0102] The tender leaves of Mongolian wheatgrass were taken and the total RNA of tender stems was extracted using the TransZol method (Quanshijin Biotechnology Co., Ltd., catalog number: ET101-01). The content and purity of the total RNA were detected using a nucleic acid analyzer. The total RNA was used for reverse transcription reaction. The kit used was One-Step gDNA Removal and cDNA Synthesis SuperMix (Gen Biotech, catalog number: AE311-02).

[0103] The specific steps are as follows:

[0104] 1.1 Homogenization

[0105] Transfer a tissue sample of Mongolian wheatgrass stored at -80°C to a liquid nitrogen-chilled mortar and pestle. Grind the plant tissue continuously with the pestle until the sample is ground into a powder. Place the sample into a thoroughly pre-chilled 2 mL centrifuge tube. Remove any liquid nitrogen from the tube by shaking to prevent the cap from breaking. Take 50-100 mg of the ground sample (approximately 1 / 5 of the tube) and add 1 mL of TransZol. Vortex to mix thoroughly.

[0106] 1.2 Layering

[0107] Place the homogenized sample on ice for 5 minutes (to allow complete separation of the nucleoprotein). Add 200 mL of chloroform, cap the tube tightly, shake vigorously for 3 seconds, and place on ice for 3 minutes. Centrifuge at 4°C for approximately 15 minutes to separate the layers: a colorless supernatant, a white protein layer in the middle, and a red lower organic phase.

[0108] 1.3 RNA precipitation

[0109] At room temperature, transfer approximately 550-650 mL of supernatant (maximum volume, ensuring quality) to a fresh 2 mL centrifuge tube (this tube must be thoroughly pre-chilled). Add 500 μL of isopropanol, gently invert to mix, and incubate at -20°C for 10 minutes. Centrifuge at high speed for 10 minutes at 4°C (a 1% agarose gel can be prepared during this time), and discard the supernatant (to remove as much isopropanol as possible).

[0110] 1.4 RNA washing

[0111] Add at least 1 mL of 75% ethanol, vortex to mix, and centrifuge at 7500 g for 5 min at 4°C.

[0112] 1.5 RNA Redissolution

[0113] Discard the supernatant, aspirate the ethanol, and air-dry the tube at room temperature with the lid uncovered for 10 minutes. Add 30-40 μL of RNase-free ddH2O to dissolve the RNA for 2-3 minutes.

[0114] 1.6 Detection of total RNA content and purity using agarose gel electrophoresis and nucleic acid analyzer

[0115] 1.7 RNA Reverse Transcription

[0116] Add the following system into the microcentrifuge tube:

[0117] Reagents Dosage Total RNA 50ng-5μg Anchored Oligo(dT) 1 μL 2×ES reaction Mix 10 μL Trans Script RT 1 μL gDNA Remover 1 μL RNase-free Water up to 20μL

[0118] 1.7.1 First, mix the RNA template, Anchored Oligo (dT) and RNase-free water. Incubate at 65°C for 5 minutes, then cool on ice for 2 minutes before adding other reaction components.

[0119] 1.7.2 Mix gently and incubate at 42°C for 15 min.

[0120] 1.7.3 Inactivate Trans Script RT and gDNA Remover by heating at 85°C for 5 seconds.

[0121] Example 2: AmCOMT gene cloning and prokaryotic expression vector construction

[0122] The specific method is as follows:

[0123] 2.1 Using Agropyron mongolicum cDNA as template, use forward primer and reverse primer:

[0124] F1: 5′-ATGGGCTCCATCGCCGCCGG-3′,

[0125] R1: 5′-CTACTTAGTGAACTCGATGGCCC-3′

[0126] Perform PCR amplification. Add 5 μL of amplified product to 1 μL of loading buffer and run electrophoresis. After 15 minutes, observe the gel image using a gel imager. The amplified fragment is approximately 1100 bp. Expand the reaction system and recover the gene fragment using a gel recovery kit. The PCR amplification reaction system (20 μL) consists of: 10 μL 2× buffer, 1 μL forward primer, 1 μL reverse primer, 1 μL DMSO, 1 μL cDNA, 0.8 μL dNTPs, 5 μL water, and 0.2 μL enzyme.

[0127] The reaction conditions of the PCR amplification program were as follows: pre-denaturation at 98°C for 5 min, denaturation at 98°C for 10 s, annealing at 56°C for 5 s, extension at 72°C for 1.5 min, for a total of 35 cycles, extension at 72°C for 10 min, and cooling at 16°C.

[0128] 2.2 Design of adapter primers based on the AmCOMT cDNA sequence (AmCOMT-pET32a-F: GATATCGGATCCGAATTCATGGGCTCCATCGCCGCCGG, AmCOMT-pET32a-R: AGCTTGTCGACGGAGCTCGAATTCCTACTTAGTGAACTCGATGGCCC)

[0129] PCR amplification was performed using Agropyron mongolicum cDNA as a template. The PCR product was recovered from gels to obtain a fragment with a linker. The pET-32a plasmid was digested with ECORI, and the gel-recovered fragment was then ligated to the pET-32a vector using infusion ligase (Nanjing Novozymes Biotech Co., Ltd.) at 37°C for 30 min.

[0130] After PCR product detection by agarose gel electrophoresis, the target band was purified using a gel extraction kit to recover the adapter-containing fragment. The recovered product was ligated to the pET-32a vector using infusion ligase (Nanjing Novozymes Biotech Co., Ltd.) at 37°C for 30 minutes. The ligation product was transformed into competent Escherichia coli DH5a cells, plated onto LB solid medium plates containing carboxybenzyl, and incubated inverted at 37°C overnight. The next day, white colonies were randomly selected for PCR analysis, and the culture medium of the selected positive clones was sent to Qingdao Qingke Biotechnology Co., Ltd. for sequencing.

[0131] The results are as follows Figure 1 As shown. Figure 1 The results showed that the amplified bands were clear and had no obvious tailing phenomenon. The PCR identification was positive for the strain, indicating that the pET32a-AmCOMT prokaryotic expression vector was successfully constructed. The positive strain was preserved for subsequent in vitro catalytic property studies of the gene.

[0132] Example 3: Analysis of the expression pattern and induction of AmCOMT

[0133] Ice grass samples were taken from Mengnong No. 1 ice grass planted by Inner Mongolia Agricultural University in 2018. Tissues from different parts including roots, stems, leaves, leaf sheaths, and young spikes were collected, and RNA was extracted using the TransZol method.

[0134] Reference genes for Agropyron mongolicum were obtained according to the literature (Huang Wenhua. Screening of internal reference genes and quantitative expression analysis of P5CS genes under drought stress in Agropyron mongolicum [D]. Inner Mongolia Agricultural University, 2014). Fluorescence quantitative PCR (qRT-PCR) primers (AmCOMT-qRT-TF: GACGCTGCTCAAGAACTGCT, AmCOMT-qRT-R: CCATGCGTTGGCG TAGATGT; EF-1a-F: TGACTGTGCTGTCCTCATCA, EF-1a-R: GTTGCAGC AGCAAATCATCT) were designed according to the website (http: / / www.genscript.com). qRT-PCR reactions were performed using cDNA (diluted 3-fold) from different Agropyron mongolicum tissues as templates. Three biological replicates were set up for each sample. The following reaction system was prepared on ice: 2 μL cDNA, 10 μL enzyme, 0.5 μL each of upstream and downstream primers (10 μmol / L), and 7 μL of nuclease-free water. The reaction conditions were as follows: 95°C pre-denaturation for 30 seconds; 95°C denaturation for 5 seconds, 60°C annealing and extension for 30 seconds, for 45 cycles. Melting curve determination: 65°C to 95°C. The baseline and cycle threshold (Ct value) were automatically generated by the Light Cycler 480 software. The results are shown in Figure 2. Figure 4 shown.

[0135] By analyzing the expression levels of AmCOMT in different tissues of Mongolian wheatgrass at the heading stage, Figure 4 The results show that the gene is expressed in different tissues of Mongolian ice grass, with the highest expression level in the stem, which is 3.01 times that in the leaves, followed by leaves, roots and young spikes, and the lowest expression level in the leaf sheath, indicating that the gene is specifically expressed in different parts of Mongolian ice grass.

[0136] In order to study the role of AmCOMT in the stress response of Mongol ice grass, Mongol ice grass was placed under different conditions for stress treatment. First, the ice grass seeds were cleaned and disinfected and placed in 1 / 4 Hoagland solution, and cultured for 5 weeks under a 12 / 12 hour light / dark cycle at room temperature (20-22°C). Then, the ice grass seedlings were placed in 1 / 4 Hoagland solution (control group), 1 / 4 Hoagland solution + 50mM NaCl, 1 / 4 Hoagland solution + 150mM NaCl, 1 / 4 Hoagland solution + 75mM mannitol, 1 / 4 Hoagland solution + 150mM mannitol and 1 / 4 Hoagland solution + 4°C low temperature culture medium for stress treatment under different conditions. The seedlings treated with 0h, 6h, 12h and 24h stress were collected and quickly frozen in liquid nitrogen for RNA preparation and subsequent expression analysis. The expression of the AmCOMT gene was determined using real-time fluorescence PCR technology with EF-1a as the internal reference gene. The results are shown in the figure below. Figure 5 shown.

[0137] Depend on Figure 5 The results show that under salt stress of 150mM NaCl concentration, the expression level of AmCOMT gene increased to varying degrees. 6h NaCl treatment significantly increased the expression level of this gene, which was 3.06 times that of the control group, indicating that AmCOMT gene can significantly respond to salt stress in the environment.

[0138] Example 4: Induced expression of engineered bacteria

[0139] The specific method is as follows:

[0140] 3.1 Transfer the correctly sequenced original bacterial solution into 50 mL LB liquid medium at a ratio of 1:100, shake to an OD600 value of 0.6-0.8, then add 15 μL IPTG (1 M) and culture in a shaker at 18°C ​​overnight.

[0141] 3.2 Collect the cells by centrifugation and resuspend them in 30 mL of pre-cooled 10 mM imidazole buffer. Repeat the operation on ice twice. When resuspending for the second time, add 120 μL of saturated PMSF solution.

[0142] 3.3 Ultrasonic fragmentation: on for 5 seconds, off for 4 seconds, for a total of 15 minutes.

[0143] 3.4 Centrifuge the broken bacteria at high speed at 4°C for 30 minutes.

[0144] 3.5 Aspirate the supernatant and pass it through the column. (The supernatant is crude protein)

[0145] 3.6 Protein Purification: In a 4°C refrigerator, add 1 mL of filler to the column. Equilibrate the Ni-NTA column twice with 15 mL of lysis buffer. Before passing the column, remove 500 μL of crude protein for a protein gel electrophoresis control.

[0146] 3.7 Add the protein sample supernatant to the equilibrated column. After the column is washed, wash it two or three times with washing buffer.

[0147] 3.8 Elute the His-tagged protein with elution buffer. Collect the eluted protein in 1.5 mL tubes, 250 μL per tube, and connect 8-10 tubes. Measure the concentration.

[0148] 3.9 Sample boiling: Take 50 μL of supernatant, precipitate, and purified protein sample and boil the sample at 95°C for 10 minutes.

[0149] 3.10 Take the cooked protein sample and add 10 μL loading buffer to run protein gel electrophoresis. At the beginning, adjust the voltage to 80 V. After the marker is separated, increase the voltage to 120 V.

[0150] 3.11 After running the electrophoresis, stain the protein gel and destain it after 1 hour.

[0151] The results are as follows Figure 6 shown. Figure 6 The results in the experiment showed that an obvious specific protein band appeared at the molecular weight of 57 kDa, which was consistent with the theoretical value of 56.66 kDa.

[0152] Example 5: Detection of AmCOMT gene biological activity

[0153] Enzyme activity was detected by HPLC (high performance liquid chromatography) using caffeic acid and cafestol as substrates. The enzyme activity reaction system consisted of 80 μL of buffer, 110 μL of water, 40 μL of CoA (1 mM), 60 μL of ATP (10 mM), 80 μL of protein, and 30 μL of substrate (2 mM). A blank control was added for each substrate. After mixing, the mixture was placed in a 30°C water bath and reacted for 30 minutes. The reaction was terminated by adding methanol solution, filtered, and added to a sample injection bottle for liquid chromatography detection. The results were as follows: Figure 7 shown.

[0154] Figure 7 The results in the literature showed that AmCOMT could react with both caffeic acid and cafestol as substrates, and products were generated.

[0155] Example 6: Overexpression of AmCOMT in transgenic Arabidopsis

[0156] First, a comt mutant of Arabidopsis thaliana was obtained. From a SNAT insertion mutant of SALK_020611C (N681004), a homozygous mutant of the mutant SALK_020611C (N681004) was confirmed using a three-primer PCR experiment. This mutant was obtained by inserting T-DNA into the COMT gene of Arabidopsis thaliana, rendering COMT unable to be properly translated into protein and thus losing COMT function. This mutant is known to be a COMT mutant of Arabidopsis thaliana. The T-DNA can be transformed into plants through Agrobacterium, cross the nuclear membrane, enter the cell nucleus, and randomly integrate into the nuclear genome. This integration of the T-DNA into the nuclear genome can be stably inherited.

[0157] An AmCOMT overexpression vector was constructed using Gateway technology. The amplified and purified AmCOMT fragment was ligated into the intermediate vector pGWC. pGWC required cleavage with the restriction endonuclease Ahd I to ensure seamless ligation. The resulting pGWC-AmCOMT construct was then ligated into the final vector pMDC32 via LR. The constructed pMDC32-AmCOMT plasmid was then transferred into Agrobacterium (EHa105) for subsequent infection experiments. Transgenic plants were transformed into col-0 and comt mutant Arabidopsis plants using the floral dip method. Transgenic plants were plated on 1 / 2 Murashige-Skoog (MS) growth medium supplemented with 30 mg / L hygromycin and cultured in a 22°C growth chamber under a 16 / 8 hr light / dark cycle. Seeds of homozygous lines were collected. Important points during the transformation process: Cover the infected plants with plastic wrap to maintain humidity. Incubate in the dark for 1 day, then place under normal culture conditions for 2-3 days before removing the plastic wrap. Water the plants approximately 1 week after transformation and repeat the infection periodically. Continue incubating until the plants mature. Harvest the seeds and place them in a dry environment for about 1 week before selecting for transformants. It is important to note that after removing the primary inflorescence, infection is optimal when the secondary inflorescence is approximately 2-10 cm.

[0158] Example 7: Maule staining of transgenic Arabidopsis thaliana

[0159] Maule staining is a method that can color lignin. Wild-type Arabidopsis thaliana (Col-0), comt mutants, transgenic lines overexpressing AmCOMT, and COMT gene complemented mutant lines were planted and cultured until the bolting stage, and then Maule staining was performed. The Arabidopsis stems were sliced ​​by hand, and complete slices were selected and placed in a centrifuge tube. 1 mL of 0.5% potassium permanganate was added to completely soak the slices. The slices were incubated for 2 minutes, and the potassium permanganate solution was aspirated. The slices were then washed with distilled water. An equal volume of 3.7% hydrochloric acid solution was then added for 3-5 minutes. The dye was removed, and the slices were placed on a glass slide. One drop of concentrated ammonia was added with a dropper, and finally observed under a microscope. The results are as follows: Figure 8 shown.

[0160] Depend on Figure 8 The results show that compared with the wild type, the comt mutant had the lightest staining, indicating the lowest lignin content. Overexpression of AmCOMT in the mutant restored the lignin staining to a level close to that of the wild type, indicating that complementation of the AmCOMT gene promotes lignin synthesis. Furthermore, overexpression of AmCOMT in wild-type Arabidopsis significantly deepened the staining of stem sections, suggesting that the overexpressing material may contain higher levels of S-type lignin and lignin content. Determination of the lignin content in Arabidopsis materials revealed that the overexpressing Arabidopsis material had the highest lignin content, the comt mutant material had the lowest total lignin content, and the complemented material had a lignin content and composition comparable to that of the wild type. These results clearly demonstrate that AmCOMT can participate in lignin biosynthesis and is an important gene affecting plant lignin content and composition. The examples of the present application successfully introduced the AmCOMT gene into Arabidopsis thaliana and expressed it efficiently in Arabidopsis thaliana, obtaining transgenic Arabidopsis thaliana containing the AmCOMT gene. The transgenic Arabidopsis thaliana had significantly increased cell wall lignin content, which in turn had a positive effect on cultivating Arabidopsis thaliana with high resistance to drought, high salt and other environments.

[0161] The foregoing is merely an embodiment of the present application and is not intended to limit the present application. For those skilled in the art, the present application may have various changes and variations. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principles of the present application should all be included within the scope of the claims of the present application.

Claims

1. A method for increasing lignin synthesis in Arabidopsis thaliana, characterized in that: The following steps are involved: The nucleic acid molecule encoding caffeic acid oxygen methyltransferase derived from wheatgrass is transferred into Arabidopsis thaliana to overexpress the caffeic acid oxygen methyltransferase; The caffeic acid oxygen methyltransferase is selected from any one of the following: A1), comprising the amino acid sequence shown in SEQ ID NO.1; A2) a protein having an amino acid sequence identity of more than 80% with that of A1) and having the same function; A3) A fusion protein obtained by connecting a protein tag to the N-terminus and / or C-terminus of the amino acid sequence described in A1) or A2).

2. The method according to claim 1, characterized in that The nucleic acid molecule encoding caffeic acid oxygen methyltransferase comprises the nucleotide sequence shown in SEQ ID NO.2; And / or, the transfer method comprises the step of introducing any one of the following substances into the recipient of Arabidopsis thaliana: B1), the nucleotide sequence shown in SEQ ID NO.2; B2), an expression cassette containing the nucleotide sequence described in B1); B3) a recombinant vector containing the nucleotide sequence described in B1) or the expression cassette described in B2); B4) a recombinant microorganism containing the nucleotide sequence of B1), or containing the expression cassette of B2), or containing the recombinant vector of B3); And / or, the receptor is selected from Arabidopsis thaliana plant cells, plant cell lines, plant protoplasts, plant tissues, plant organs and / or whole plants.

3. A method for cultivating Arabidopsis thaliana with high lignin content, characterized in that: The following steps are involved: The nucleic acid molecule encoding caffeic acid oxygen methyltransferase from Wheatgrass in Mongolia was transferred into the recipient of Arabidopsis thaliana; cultivating the recipient to become a plant that overexpresses the caffeic acid oxygen methyltransferase; The caffeic acid oxygen methyltransferase is selected from any one of the following: A1), comprising the amino acid sequence shown in SEQ ID NO.1; A2) a protein having an amino acid sequence identity of more than 80% with that of A1) and having the same function; A3) A fusion protein obtained by connecting a protein tag to the N-terminus and / or C-terminus of the amino acid sequence described in A1) or A2).

4. The method according to claim 3, characterized in that The nucleic acid molecule encoding caffeic acid oxygen methyltransferase comprises the nucleotide sequence shown in SEQ ID NO.2; And / or, the transfer method comprises the step of introducing any one of the following substances into the recipient of Arabidopsis thaliana: B1), the nucleotide sequence shown in SEQ ID NO.2; B2), an expression cassette containing the nucleotide sequence described in B1); B3) a recombinant vector containing the nucleotide sequence described in B1) or the expression cassette described in B2); B4) a recombinant microorganism containing the nucleotide sequence of B1), or containing the expression cassette of B2), or containing the recombinant vector of B3); And / or, the receptor is selected from Arabidopsis thaliana plant cells, plant cell lines, plant protoplasts, plant tissues, plant organs and / or whole plants.

5. A method for improving the stress resistance of Arabidopsis thaliana to drought and / or high-salt environments, characterized in that: The following steps are involved: The nucleic acid molecule encoding caffeic acid oxygen methyltransferase derived from wheatgrass is transferred into Arabidopsis thaliana to overexpress the caffeic acid oxygen methyltransferase; The caffeic acid oxygen methyltransferase is selected from any one of the following: A1), comprising the amino acid sequence shown in SEQ ID NO.1; A2) a protein having an amino acid sequence identity of more than 80% with that of A1) and having the same function; A3) A fusion protein obtained by connecting a protein tag to the N-terminus and / or C-terminus of the amino acid sequence described in A1) or A2).

6. The method according to claim 5, characterized in that The nucleic acid molecule encoding caffeic acid oxygen methyltransferase comprises the nucleotide sequence shown in SEQ ID NO.2; And / or, the transfer method comprises the step of introducing any one of the following substances into the recipient of Arabidopsis thaliana: B1), the nucleotide sequence shown in SEQ ID NO.2; B2), an expression cassette containing the nucleotide sequence described in B1); B3) a recombinant vector containing the nucleotide sequence described in B1) or the expression cassette described in B2); B4) a recombinant microorganism containing the nucleotide sequence of B1), or containing the expression cassette of B2), or containing the recombinant vector of B3); And / or, the receptor is selected from Arabidopsis thaliana plant cells, plant cell lines, plant protoplasts, plant tissues, plant organs and / or whole plants.

7. A method for cultivating Arabidopsis thaliana with high resistance to drought and / or high salt environments, characterized in that: The following steps are involved: The nucleic acid molecule encoding caffeic acid oxygen methyltransferase from Mongolian wheatgrass was transferred into the recipient Arabidopsis thaliana; cultivating the recipient to become a plant that overexpresses the caffeic acid oxygen methyltransferase; The caffeic acid oxygen methyltransferase is selected from any one of the following: A1), comprising the amino acid sequence shown in SEQ ID NO.1; A2) a protein having an amino acid sequence identity of more than 80% with that of A1) and having the same function; A3) A fusion protein obtained by connecting a protein tag to the N-terminus and / or C-terminus of the amino acid sequence described in A1) or A2).

8. The method according to claim 7, characterized in that The nucleic acid molecule encoding caffeic acid oxygen methyltransferase comprises the nucleotide sequence shown in SEQ ID NO.2; And / or, the transfer method comprises the step of introducing any one of the following substances into the recipient of Arabidopsis thaliana: B1), the nucleotide sequence shown in SEQ ID NO.2; B2), an expression cassette containing the nucleotide sequence described in B1); B3) a recombinant vector containing the nucleotide sequence described in B1) or the expression cassette described in B2); B4) a recombinant microorganism containing the nucleotide sequence of B1), or containing the expression cassette of B2), or containing the recombinant vector of B3); And / or, the receptor is selected from Arabidopsis thaliana plant cells, plant cell lines, plant protoplasts, plant tissues, plant organs and / or whole plants.

9. Application of biomaterials in any of the following:

1. Increasing the amount of plant lignin synthesis, and / or preparing products that increase the amount of plant lignin synthesis; II. Improving the resistance of plants to drought environments, and / or preparing products that improve the resistance of plants to drought environments; III. Improving the stress resistance of plants to high-salt environments, and / or preparing products that improve the stress resistance of plants to high-salt environments; The plants include Arabidopsis thaliana; The biological material is selected from any one of the following: A1), comprising the amino acid sequence shown in SEQ ID NO.1; A2) a protein having an amino acid sequence identity of more than 80% with that of A1) and having the same function; A3) a fusion protein obtained by connecting a protein tag to the N-terminus and / or C-terminus of the amino acid sequence described in A1) or A2); B1), the nucleotide sequence shown in SEQ ID NO.2; B2), an expression cassette containing the nucleotide sequence described in B1); B3) a recombinant vector containing the nucleotide sequence described in B1) or the expression cassette described in B2); B4) A recombinant microorganism containing the nucleotide sequence described in B1), or containing the expression cassette described in B2), or containing the recombinant vector described in B3).

10. A method for increasing the amount of lignin synthesis in plants and / or improving the resistance of plants to drought and / or high-salt environments The stress-resistant product is characterized by The product comprises the biomaterial according to claim 9; The plants include Arabidopsis thaliana.

Images