Engineered DNA polymerase and application thereof
By introducing specific mutation sites into Phi29 DNA polymerase, the problem of binding to artificially modified substrates under high salt concentrations was solved, and the amplification efficiency and sustainability under high salt conditions were improved.
Patent Information
- Application Number
- CN202410318830.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-03-20
- Publication Date
- 2025-09-23
Smart Images

Figure CN120683070A_ABST
Abstract
Description
Technical Field
[0001] The present application relates to the field of enzyme technology, and in particular to engineered DNA polymerase and its application. Background Art
[0002] Polymerase-nanopore sequencing is a method for sequencing by detecting electrochemical signals. A good electrochemical signal relies on high salt concentrations and artificially modified non-natural substrates. However, high salt concentrations can adversely affect polymerase activity, and the polymerase's ability to bind to artificial substrates can affect sequencing efficiency.
[0003] Phi29 DNA polymerase, derived from the Bacillus subtilis phage Phi29, is widely used in DNA amplification reactions via rolling circle replication or multiple displacement amplification due to its excellent processivity, strand displacement activity, and high fidelity. However, it also has strong exonuclease activity and poor salt tolerance, making it difficult to bind artificially modified substrates in high salt concentrations, limiting its application in nanopore sequencing.
[0004] During the experiment, it was found that after introducing key mutation sites on the Phi29 DNA polymerase, its exonuclease activity would be greatly reduced, but its ability to extend using artificially modified non-natural substrates under high salt concentration conditions still needs to be improved. Summary of the Invention
[0005] The present application aims to solve at least one of the technical problems existing in the prior art. To this end, the present application proposes an engineered DNA polymerase for amplification using an artificially modified non-natural substrate under high salt concentration conditions and its application.
[0006] In a first aspect of the present application, a DNA polymerase is provided, comprising an amino acid sequence obtained by mutation of at least one of the following positions in the amino acid sequence from position 1 to position 575 as shown in SEQ ID NO. 14: M97K; Q99D; N396R; D510Q, or D510H, or D510S, or D510K, or D510R, or D510M; Or I504R, or I504K, or I504M.
[0007] The DNA polymerase provided in the above embodiments of the present application has the following beneficial effects: The DNA polymerase in the present application has one or more mutation sites including M8R, D12A, G197D, M97K, Q99D, N396R, D510Q, D510H, D510S, D510K, D510R, D510M, I504R, I504K, and I504M. The results show that these polymerases have better processivity and better amplification effect when extending using non-natural substrates under high salt conditions.
[0008] In some embodiments of the present application, the DNA polymerase comprises the amino acid sequence from position 1 to position 575 as shown in any one of SEQ ID Nos. 1 to 13. In some embodiments of the present application, the amino acid sequence of the DNA polymerase comprises the amino acid sequence shown in SEQ ID NO. 14 after at least one mutation in the aforementioned positions; optionally, a tag or DNA binding domain sequence is connected to the N-terminus and / or C-terminus of the aforementioned amino acid sequence.
[0009] In some embodiments of the present application, the amino acid sequence of the DNA polymerase has the amino acid sequence from position 1 to position 575 as shown in any one of SEQ ID No. 1 to 13; optionally, a tag or DNA binding domain sequence is connected to the N-terminus and / or C-terminus of the above amino acid sequence.
[0010] In some embodiments of the present application, the tag includes at least one tag that facilitates the solubilization, purification, and detection of the DNA polymerase. It is understood that the DNA polymerase may include one or more tags; multiple tags may include a combination of multiple identical tags or a combination of multiple different tags. For example, tags that facilitate the solubilization of the DNA polymerase include, but are not limited to, a nus tag or maltose binding protein; tags that facilitate the purification of the DNA polymerase include, but are not limited to, a strep tag, a His tag, a GST tag, a pelB signal sequence, or an ompA signal sequence; tags that facilitate the detection of the DNA polymerase include, but are not limited to, horseradish peroxidase (HRP), β-galactosidase, luciferase, green fluorescent protein (GFP), HcRed, DsRed, or cyan fluorescent protein (CFP).
[0011] In some embodiments of the present application, the DNA binding domain includes but is not limited to at least one of Sso7d, DBD, and HI.
[0012] In some embodiments of the present application, the DNA polymerase comprises an amino acid sequence as shown in SEQ ID No. 14 after at least one of the following mutations occurs: A1) M97K; A2) Q99D; A3) N396R; A4) D510Q, or D510H, or D510S, or D510K, or D510R, or D510M; A5) I504R, or I504K, or I504M.
[0013] In some embodiments of the present application, the DNA polymerase has an amino acid sequence as shown in any one of SEQ ID No. 1 to 13.
[0014] In a second aspect of the present application, a biomaterial is provided, which is any one of B1) to B5): B1) a nucleic acid molecule encoding the aforementioned DNA polymerase; B2) an expression cassette containing the nucleic acid molecule described in B1); B3) a recombinant vector containing the nucleic acid molecule described in B1) or the expression cassette described in B2); B4) a recombinant cell containing the nucleic acid molecule described in B1), or the expression cassette described in B2), or the recombinant vector described in B3; B5) A composition comprising the nucleic acid molecule described in B1), or the expression cassette described in B2), or the recombinant vector described in B3), or the recombinant cell described in B4).
[0015] In some embodiments of the present application, the nucleic acid molecule comprises a nucleotide sequence from position 1 to position 1728 as shown in any one of SEQ ID Nos. 15 to 27; optionally, the above nucleotide sequence also includes a nucleotide sequence of a tag or a DNA binding domain, for example, a nucleotide sequence of a tag or a DNA binding domain is also included after position 1728.
[0016] In some embodiments of the present application, the nucleic acid molecule comprises a nucleotide sequence as shown in any one of SEQ ID No. 15 to 27.
[0017] In some embodiments of the present application, the expression cassette contains the aforementioned nucleic acid molecule and a marker gene.
[0018] In some embodiments of the present application, the marker gene includes at least one of a drug resistance marker gene and a reporter gene.
[0019] In some embodiments of the present application, the drug resistance marker gene includes at least one of a puromycin resistance gene, a neomycin resistance gene, a kanamycin resistance gene, a chloramphenicol resistance gene, an erythromycin resistance gene, a tetracycline resistance gene, a hygromycin resistance gene, an ampicillin resistance gene, a bleomycin resistance gene, a streptomycin resistance gene, a gentamicin resistance gene, a spectinomycin resistance gene, an apramycin sulfate resistance gene, and a nourseothricin resistance gene.
[0020] In some embodiments of the present application, the reporter gene includes at least one of a chloramphenicol acetyltransferase gene, a luciferase gene, a β-glucuronidase gene, a horseradish peroxidase gene, a β-galactosidase gene, a secretory alkaline phosphatase gene, a fluorescent protein gene, and the like.
[0021] In some embodiments of the present application, the expression cassette further includes eukaryotic or prokaryotic elements for controlling expression, such as regulatory sequences, enhancers, promoters, terminators, signal sequences, etc. for initiating and terminating transcription and / or translation of DNA polymerase genes.
[0022] In some embodiments of the present application, the recombinant vector includes a plasmid, a cosmid, a phage, a virus (such as adenovirus, lentivirus, adeno-associated virus, etc.) or any other vector commonly used in genetic engineering.
[0023] In some embodiments of the present application, the recombinant vector is any one of bacterial, fungal, insect, viral, and mammalian vectors.
[0024] In some embodiments of the present application, the recombinant vector is a pET vector.
[0025] In some embodiments of the present application, the recombinant vector is any one of a pET-21a vector, a pET-28a vector, a pET-30a vector, and a pET-32a vector.
[0026] In some embodiments of the present application, the recombinant vector is a recombinant vector obtained by inserting a nucleic acid molecule encoding a DNA polymerase into the multiple cloning site of the vector.
[0027] In some embodiments of the present application, the recombinant cells include prokaryotic cells and eukaryotic cells. It is understood that the recombinant cells do not include propagation materials.
[0028] In some embodiments of the present application, the prokaryotic cell includes at least one of bacteria and algae.
[0029] In some embodiments of the present application, the eukaryotic cell includes at least one of a fungus (such as yeast, mold), a mammalian cell, and an insect cell.
[0030] In some embodiments of the present application, the recombinant cell comprises Escherichia coli, such as Escherichia coli BL21 (DE3). In some embodiments of the present application, the recombinant cell is a recombinant cell obtained by introducing a nucleic acid molecule, an expression cassette or a recombinant vector into the cell.
[0031] In some embodiments of the present application, the recombinant cell is a recombinant Escherichia coli obtained by introducing a recombinant vector into Escherichia coli.
[0032] In some embodiments of the present application, the DNA polymerase, nucleic acid molecule, expression cassette, recombinant vector, or recombinant cell in the composition and other components in the composition can be pre-mixed or independently packaged to form a composition.
[0033] In a third aspect of the present application, a method for preparing the aforementioned DNA polymerase is provided, comprising the following steps: S1: The cDNA sequence encoding DNA polymerase is transferred into the host cell to obtain a recombinant cell; S2: Inducing the recombinant cells to express the DNA polymerase and purifying it.
[0034] In some embodiments of the present application, S1 deduces the cDNA sequence based on the amino acid sequence of the DNA polymerase.
[0035] In some embodiments of the present application, after inducing expression of the recombinant cells in S2, the bacteria are collected, lysed and centrifuged, the supernatant is collected, and then the supernatant is purified by affinity column chromatography to obtain DNA polymerase.
[0036] In some embodiments of the present application, affinity column chromatography is Co 2+ Affinity column chromatography.
[0037] In some embodiments of the present application, after purifying the DNA polymerase to obtain a purified protein solution in S2, the purified protein solution is further concentrated to achieve the desired concentration of the DNA polymerase.
[0038] The fourth aspect of the present application provides the use of the aforementioned DNA polymerase, or the aforementioned biological material, or the aforementioned composition in the replication, amplification or sequencing of template DNA, or in the preparation of products for the replication, amplification or sequencing of template DNA.
[0039] In some embodiments of the present application, amplification includes at least one of polymerase chain reaction (PCR), loop-mediated amplification (LAMP), rolling circle amplification (RCA), strand displacement amplification (SDA), multiple displacement amplification (MDA) and cross primer amplification (CPA).
[0040] In some embodiments of the present application, the replication, amplification or sequencing of the template DNA comprises incorporating a nucleotide substrate into the template DNA, wherein the nucleotide substrate comprises a non-natural nucleotide.
[0041] In some embodiments of the present application, the non-natural nucleotide includes a natural nucleotide having a polyphosphate group, the terminal phosphate group of the polyphosphate group is covalently linked to one end of a connecting arm, and the other end of the connecting arm is connected to an oligonucleotide.
[0042] Among them, natural nucleotides refer to compounds formed by three repeated phosphate groups, pentose (such as ribose or deoxyribose), purine bases (such as adenine, guanine) or pyrimidine bases (such as thymine, cytosine, uracil).
[0043] In some embodiments of the present application, the natural nucleotide in the non-natural nucleotide has two or more phosphate groups, for example, a diphosphate group, a triphosphate group, a tetraphosphate group, a pentaphosphate group, a hexaphosphate group, a heptaphosphate group, an octaphosphate group, or more phosphate groups. The terminal phosphate group of a polyphosphate group refers to the last phosphate group in the polyphosphate group in the order from closest to the pentose sugar to the farthest.
[0044] In some embodiments of the present application, the terminal phosphate group is connected by introducing an amino group, an ester group, or a carboxyl group to form an amide bond with the ester group, the carboxyl group, or the amino group at one end of the linker.
[0045] In some embodiments of the present application, the other end of the tether is connected to the oligonucleotide via a click chemistry reaction, for example, by a cycloaddition reaction, a nucleophilic ring-opening reaction, a non-aldol carbonyl chemistry, and an addition reaction of a carbon-carbon multiple bond.
[0046] In some embodiments of the present application, the other end of the connecting arm has an alkynyl group and the oligonucleotide has an azide group; or the other end of the connecting arm has an azide group and the oligonucleotide has an alkynyl group, and the connecting arm and the oligonucleotide undergo an azide-alkyne cycloaddition reaction to connect.
[0047] In some embodiments of the present application, the connecting arm is selected from any one of the following:
[0048] In some embodiments of the present application, the oligonucleotide includes more than 4 nucleotides, for example, 4 to 100 nucleotides, specifically 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 nucleotides.
[0049] In some embodiments of the present application, any nucleotide in the oligonucleotide is selected from any one of thymidine, adenosine, and cytidine.
[0050] In some embodiments of the present application, zero, one or more nucleotides at any position in the oligonucleotide are modified based on natural nucleotides, such as the introduction, deletion, or replacement of any group or atom at any position of the nucleotide, which can be synthesized using methods known in the art or purchased.
[0051] In a fifth aspect of the present application, a kit for replicating, amplifying or sequencing template DNA is provided, wherein the kit comprises the aforementioned DNA polymerase.
[0052] In some embodiments of the present application, the kit further comprises a buffer.
[0053] In some embodiments of the present application, the kit further comprises a nucleotide substrate.
[0054] In some embodiments of the present application, the kit further comprises a primer.
[0055] In some embodiments of the present application, the kit further comprises a salt, such as a potassium salt.
[0056] In some embodiments of the present application, the potassium salt includes a potassium salt of an inorganic acid or a potassium salt of an organic acid.
[0057] In some embodiments of the present application, the potassium salt includes at least one of potassium chloride (KCl) and potassium glutamate (KGlu).
[0058] In some embodiments of the present application, the kit further comprises a buffer and a nucleotide substrate.
[0059] In some embodiments of the present application, the kit further comprises a buffer, a primer and a nucleotide substrate.
[0060] In some embodiments of the present application, the nucleotide substrate comprises a non-natural nucleotide.
[0061] In some embodiments of the present application, the non-natural nucleotide includes a natural nucleotide having a polyphosphate group, the terminal phosphate group of the polyphosphate group is covalently linked to one end of a connecting arm, and the other end of the connecting arm is linked to an oligonucleotide.
[0062] In some embodiments of the present application, the natural nucleotide in the non-natural nucleotide has more than 2 phosphate groups, for example, 2 to 8 phosphate groups or more phosphate groups.
[0063] In some embodiments of the present application, the terminal phosphate group is connected by introducing an amino group, an ester group, or a carboxyl group to form an amide bond with the ester group, the carboxyl group, or the amino group at one end of the linker.
[0064] In some embodiments of the present application, the other end of the tether is connected to the oligonucleotide via a click chemistry reaction, for example, by a cycloaddition reaction, a nucleophilic ring-opening reaction, a non-aldol carbonyl chemistry, and an addition reaction of a carbon-carbon multiple bond.
[0065] In some embodiments of the present application, the other end of the connecting arm has an alkynyl group and the oligonucleotide has an azide group; or the other end of the connecting arm has an azide group and the oligonucleotide has an alkynyl group, and the connecting arm and the oligonucleotide undergo an azide-alkyne cycloaddition reaction to connect.
[0066] In some embodiments of the present application, the connecting arm is selected from any one of the following:
[0067] In some embodiments of the present application, the oligonucleotide includes more than 4 nucleotides, for example, 4 to 100 nucleotides, specifically 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 nucleotides.
[0068] In some embodiments of the present application, any nucleotide in the oligonucleotide is selected from any one of thymidine, adenosine, and cytidine.
[0069] In some embodiments of the present application, zero, one or more nucleotides at any position in the oligonucleotide are modified based on natural nucleotides, such as the introduction, deletion, or replacement of any group or atom at any position of the nucleotide, which can be synthesized using methods known in the art or purchased.
[0070] In a sixth aspect of the present application, a method for replicating, amplifying or sequencing a template DNA is provided, the method comprising the steps of contacting the template DNA with a primer, a nucleotide substrate and the aforementioned DNA polymerase in a buffer.
[0071] In some embodiments of the present application, a method for replicating or amplifying template DNA is provided, comprising mixing the template DNA with a primer, a nucleotide substrate, and the aforementioned DNA polymerase in a buffer, and reacting the mixture under specific temperature conditions for a certain period of time.
[0072] In some embodiments of the present application, the method for replicating or amplifying a template DNA comprises mixing the template DNA with a primer, a nucleotide substrate, and the aforementioned DNA polymerase in a buffer, and reacting at a temperature of 20-40°C for 10 minutes to 5 hours. In some embodiments, the reaction is at a temperature of 20-40°C or 20-30°C for 10 minutes to 3 hours, or 10 minutes to 1 hour.
[0073] In some embodiments of the present application, a method for sequencing a template DNA is provided, comprising the following steps: contacting the template DNA with the primer, nucleotide substrate, and the aforementioned DNA polymerase in a buffer; Under the catalysis of DNA polymerase, the nucleotide substrate is guided to be incorporated into the template DNA and the incorporation order of the nucleotide substrate is determined.
[0074] In some embodiments of the present application, the method for sequencing template DNA is nanopore sequencing.
[0075] In some embodiments of the present application, the buffer further includes a certain concentration of salt.
[0076] In some embodiments of the present application, the salt in the buffer comprises a potassium salt.
[0077] In some embodiments of the present application, the potassium salt includes a potassium salt of an inorganic acid or a potassium salt of an organic acid.
[0078] In some embodiments of the present application, the potassium salt includes at least one of potassium chloride and potassium glutamate.
[0079] In some embodiments of the present application, the buffer comprises a potassium salt at a final concentration of 50 mM, 100 mM, 150 mM, 200 mM, 250 mM, 300 mM, 350 mM, 400 mM, 450 mM, or 500 mM or more.
[0080] In some embodiments of the present application, the buffer comprises a potassium salt at a final concentration of 50-500 mM, 100-500 mM, 50-400 mM, 100-400 mM, 50-300 mM, or 100-300 mM.
[0081] In some embodiments of the present application, during the incorporation process, the DNA polymerase is complexed on the nanopore or is in a relatively close position to the nanopore.
[0082] In some embodiments of the present application, the nanopore includes a biological nanopore, a solid-state nanopore, or a composite nanopore of a biological nanopore and a solid-state nanopore. In some embodiments of the present application, the biological nanopore includes at least one of the following: a Staphylococcus aureus α-hemolysin protein nanopore (α-HL) and a Mycobacterium smegmatis porin A (MspA). In some embodiments of the present application, the solid-state nanopore includes a nanopore fabricated from at least one of silicon nitride, silicon dioxide, aluminum oxide, glass capillaries, molybdenum disulfide, and graphene.
[0083] In some embodiments of the present application, a specific method for determining the incorporation order of nucleotide substrates includes analyzing electrical and / or optical signals of the system during the incorporation process based on the differences in the chemical properties of different nucleotide substrates, thereby determining the incorporation order of different nucleotide substrates. Non-limiting examples of electrical signals include current signals, and specific detection methods include detecting ion current and tunneling current; non-limiting examples of optical signals include fluorescence signals, and specific detection methods include fluorescence resonance energy transfer detection.
[0084] In some embodiments of the present application, when a nucleotide substrate is incorporated into a template DNA under the catalysis of a DNA polymerase to form a product chain complementary to the template DNA, the modified tag is released from the nucleotide substrate by the polymerase. The released tag is then translated through the nanopore via, for example, a transpore voltage, thereby altering the transpore current. By detecting this current change, the base sequence of the template DNA can be deduced.
[0085] In some embodiments of the present application, the nucleotide substrate comprises a non-natural nucleotide.
[0086] In some embodiments of the present application, the non-natural nucleotide includes a natural nucleotide having a polyphosphate group, the terminal phosphate group of the polyphosphate group is covalently linked to one end of a connecting arm, and the other end of the connecting arm is linked to an oligonucleotide.
[0087] In some embodiments of the present application, the non-natural nucleotide has more than 2 phosphate groups of the natural nucleotide, for example, 2 to 8 phosphate groups or more phosphate groups.
[0088] In some embodiments of the present application, the terminal phosphate group is connected by introducing an amino group, an ester group, or a carboxyl group to form an amide bond with the ester group, the carboxyl group, or the amino group at one end of the linker.
[0089] In some embodiments of the present application, the other end of the tether is connected to the oligonucleotide via a click chemistry reaction, for example, by a cycloaddition reaction, a nucleophilic ring-opening reaction, a non-aldol carbonyl chemistry, and an addition reaction of a carbon-carbon multiple bond.
[0090] In some embodiments of the present application, the other end of the connecting arm has an alkynyl group and the oligonucleotide has an azide group; or the other end of the connecting arm has an azide group and the oligonucleotide has an alkynyl group, and the connecting arm and the oligonucleotide undergo an azide-alkyne cycloaddition reaction to connect.
[0091] In some embodiments of the present application, the connecting arm is selected from any one of the following:
[0092] In some embodiments of the present application, the oligonucleotide includes more than 4 nucleotides, for example, 4 to 100 nucleotides, specifically 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 nucleotides.
[0093] In some embodiments of the present application, any nucleotide in the oligonucleotide is selected from any one of thymidine, adenosine, and cytidine.
[0094] In some embodiments of the present application, zero, one or more nucleotides at any position in the oligonucleotide are modified based on natural nucleotides, such as the introduction, deletion, or replacement of any group or atom at any position of the nucleotide, which can be synthesized using methods known in the art or purchased.
[0095] In some embodiments of the present application, the above-mentioned method of replicating, amplifying or sequencing template DNA is used for non-disease diagnosis or treatment purposes.
[0096] Additional aspects and advantages of the present application will be given in part in the description below, and in part will become obvious from the description below, or will be learned through practice of the present application. BRIEF DESCRIPTION OF THE DRAWINGS
[0097] Figure 1 These are the results of SDS-PAGE protein electrophoresis of some DNA polymerases in the examples of this application. Lanes 1 to 9 represent the results of LU-1, LU-2, LU-3, LU-4, LU-5, LU-6, LU-7, 200 ng BSA, and 400 ng BSA, respectively. M is a marker.
[0098] Figure 2 These are the results of SDS-PAGE protein electrophoresis of another portion of DNA polymerase from the examples of this application. Lanes 1 through 9 represent the results for LU-8, LU-9, LU-10, LU-11, LU-12, LU-13, LU-14, 200 ng BSA, and 400 ng BSA, respectively. M represents a marker.
[0099] Figure 3 Schematic diagram of the structure of non-natural nucleotides in the examples of this application.
[0100] Figure 4The following table shows the results of DNA polymerase activity testing for some of the DNA polymerases described in the examples of this application under different salt concentrations. Lanes 1-6 show the product bands for LU-1, the CK group, LU-11, LU-12, LU-13, and LU-14, respectively, at a salt concentration of 300 mM KGlu, and lanes 7-12 show the product bands for LU-1, the CK group, LU-11, LU-12, LU-13, and LU-14, respectively, at a salt concentration of 150 mM KCl.
[0101] Figure 5 These are the results of DNA polymerase activity testing for another portion of the DNA polymerases described in the Examples of this application under different salt concentrations. Lanes 1 through 11 represent the product bands for the LU-1, LU-2, LU-3, LU-4, LU-5, LU-6, LU-7, LU-8, LU-9, LU-10, and CK groups, respectively, under 300 mM KGlu. DETAILED DESCRIPTION
[0102] The following will clearly and completely describe the concept and technical effects of this application in conjunction with the embodiments to fully understand the purpose, features and effects of this application. Obviously, the embodiments described are only part of the embodiments of this application, not all of them. Based on the embodiments of this application, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of this application.
[0103] The embodiments of the present application are described in detail below. The described embodiments are exemplary and are only used to explain the present application, and should not be understood as limiting the present application.
[0104] In the description of this application, "several" means more than one, "multiple" means more than two, "greater than," "less than," and "exceed" are understood to exclude the number itself, while "above," "below," and "within" are understood to include the number itself. "About" means within the range of ±20%, 10%, 8%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.2%, 0.1%, etc. The use of "first" and "second" in the description is solely for the purpose of distinguishing technical features and is not to be construed as indicating or implying relative importance, or implicitly indicating the quantity of the indicated technical features, or implicitly indicating the order of the indicated technical features.
[0105] In the description of this application, reference to the terms "one embodiment," "some embodiments," "illustrative embodiments," "examples," "specific examples," or "some examples" means that the specific features, structures, materials, or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of this application. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials, or characteristics described can be combined in any appropriate manner in any one or more embodiments or examples.
[0106] Example 1: Synthesis and identification of DNA polymerase Compared to the wild-type Phi 29 DNA polymerase, the DNA polymerase in this application has one or more mutation sites including M8R, D12A, G197D, M97K, Q99D, N396R, D510Q, D510H, D510S, D510K, D510R, D510M, I504R, I504K, and I504M. The amino acid sequences of these DNA polymerases are shown in SEQ ID Nos. 1 to 14, with purification tags introduced at the ends. The nucleotide sequences are shown in SEQ ID Nos. 15 to 28, respectively. The corresponding relationships are as follows: mutation site Amino acid sequence Nucleotide sequence LU-1 M8R+D12A+G197D SEQ ID NO.14 SEQ ID NO.28 LU-2 M8R+D12A+G197D+D510Q SEQ ID NO.1 SEQ ID NO.15 LU-3 M8R+D12A+G197D+D510H SEQ ID NO.2 SEQ ID NO.16 LU-4 M8R+D12A+G197D+D510S SEQ ID NO.3 SEQ ID NO.17 LU-5 M8R+D12A+G197D+D510K SEQ ID NO.4 SEQ ID NO.18 LU-6 M8R+D12A+G197D+D510R SEQ ID NO.5 SEQ ID NO.19 LU-7 M8R+D12A+G197D+D510M SEQ ID NO.6 SEQ ID NO.20 LU-8 M8R+D12A+G197D+I504R SEQ ID NO.7 SEQ ID NO.21 LU-9 M8R+D12A+G197D+I504K SEQ ID NO.8 SEQ ID NO.22 LU-10 M8R+D12A+G197D+I504M SEQ ID NO.9 SEQ ID NO.23 LU-11 M8R+D12A+G197D+M97K+Q99D SEQ ID NO.10 SEQ ID NO.24 LU-12 M8R+D12A+G197D+M97K SEQ ID NO.11 SEQ ID NO.25 LU-13 M8R+D12A+G197D+N396R SEQ ID NO.12 SEQ ID NO.26 LU-14 M8R+D12A+G197D+M97K+N396R SEQ ID NO.13 SEQ ID NO.27
[0107] The nucleotide sequence of the above DNA polymerase was ligated into the gene expression vector pET-30a+ and transformed into Escherichia coli ER2566 super competent cells (Biyuntian Biotechnology, D1039S). After resistance screening and sequencing verification, 5 μL of the strain was inoculated into 5 mL of LB liquid medium and shaken at 37°C overnight. Then, it was transferred to 10 mL of LB liquid medium and shaken at 37°C for 3 hours. When OD600 = 0.6, the bacterial solution was removed and cooled at 4°C. After cooling, IPTG was added to a final concentration of 0.6mM for induction, and the culture was continued at 16°C for 20 hours. 2+ The fusion polymerase was purified by column affinity chromatography and concentrated using an ultrafiltration column AMICON ULTRA 15 mL 50 K (Millipore, catalog number: UFC905024).
[0108] The obtained DNA polymerase was verified by SDS-PAGE protein electrophoresis to verify the protein size and purity: The Phi29 DNA polymerase (68 kD) obtained above was subjected to SDS-PAGE protein electrophoresis to identify the purity of the DNA polymerase protein. Figure 1 and Figure 2 As shown, Figure 1Middle lanes 1 to 10 are HP-control, HX-A to F, Marker, 200 ng BSA, and 400 ng BSA, respectively; Figure 2 Lanes 1 to 10 in the middle are HX-G~I, Marker, CH-E~H, 200 ng BSA, and 400 ng BSA, respectively. Figure 1 and Figure 2 It can be seen that the protein purity of the obtained DNA polymerase is high and consistent with the expected size.
[0109] Example 2: Testing the ability to amplify using modified non-natural substrates under high salt conditions Rolling circle amplification was performed using four synthetic oligonucleotide-modified non-natural substrates as substitutes for natural substrates, and the amplified products were analyzed by electrophoresis. The reaction system is shown in Table 1: Table 1. Amplification system Reagents Final concentration <![CDATA[50 mM MnCl2]]> 1 mM 1 M HEPEs 20 mM Template + Primer 10 nM 1 M DTT 4 mM substrate 50 μM enzymes 100 nM KCl / KGlu 150 mM / 300 mM The template is: GGCTAAAATCCTTAATTAACCCTTTTCCCTTTTGAATTCCCTCCCCACTCT (SEQ ID No. 29); The primer is: ATTTTAGCCAGAGTGGGGA (SEQ ID No. 30).
[0110] The structures of four non-natural nucleotides T40HA, T40HC, D8G and D22T as non-natural substrates are as follows Figure 3 shown.
[0111] The enzyme was mixed with the template-primer complex and reacted at 25°C for 10 min. Other components were then added and reacted at 30°C for 3 h.
[0112] The results are as follows Figure 4 and Figure 5 As shown, Figure 4 Lanes 1 to 6 in the middle are the product bands of LU-1, CK group, LU-11, LU-12, LU-13, and LU-14 under the condition of 300 mM KGlu salt concentration, and lanes 7 to 12 are the product bands of LU-1, CK group (without enzyme), LU-11, LU-12, LU-13, and LU-14 under the condition of 150 mM KCl salt concentration; Figure 5Middle lanes 1 to 11 represent the product bands of the LU-2, LU-3, LU-4, LU-5, LU-6, LU-7, LU-8, LU-9, LU-10, LU-1, and CK groups, respectively, at a salt concentration of 300 mM KGlu. As can be seen from the figure, the bands of LU-2 to LU-14 are brighter and longer than that of LU-1, regardless of whether the concentration is high, such as KCl or KGlu. This indicates that these DNA polymerases produce longer products, reaching approximately 50 kb, when extending non-native substrates under high salt conditions, and exhibit better processivity.
[0113] The present application has been described in detail above with reference to the embodiments. However, the present application is not limited to the above embodiments. Various modifications can be made within the scope of knowledge possessed by a person of ordinary skill in the art without departing from the purpose of the present application. In addition, the embodiments of the present application and the features of the embodiments can be combined with each other unless there is a conflict.
Claims
1. A DNA polymerase, characterized in that An amino acid sequence comprising the amino acid sequence from position 1 to position 575 as shown in SEQ ID No. 14 after at least one mutation in the following positions: M97K; Q99D; N396R; D510Q, or D510H, or D510S, or D510K, or D510R, or D510M; or I504R, or I504K, or I504M.
2. The DNA polymerase according to claim 1, wherein The DNA polymerase comprises the amino acid sequence from position 1 to position 575 as shown in any one of SEQ ID No. 1 to 13.
3. Biomaterial, characterized in that The biological material is any one of B1) to B5): B1) a nucleic acid molecule encoding the DNA polymerase according to any one of claims 1 to 2; B2) an expression cassette containing the nucleic acid molecule described in B1); B3) a recombinant vector containing the nucleic acid molecule described in B1) or the expression cassette described in B2); B4) a recombinant cell containing the nucleic acid molecule described in B1), or the expression cassette described in B2), or the recombinant vector described in B3; B5) A composition comprising the nucleic acid molecule described in B1), or the expression cassette described in B2), or the recombinant vector described in B3), or the recombinant cell described in B4).
4. The biomaterial according to claim 3, characterized in that The nucleic acid molecule comprises the nucleotide sequence from position 1 to position 1728 as shown in any one of SEQ ID No. 15 to 27.
5. The method for preparing the DNA polymerase according to any one of claims 1 to 2, characterized in that: The following steps are involved: S1: Transforming the cDNA sequence encoding the DNA polymerase into a host cell to obtain a recombinant cell; S2: Inducing the recombinant cells to express the DNA polymerase and purifying it.
6. Use of the DNA polymerase according to any one of claims 1 to 2, or the biomaterial according to any one of claims 3 to 4, in the replication, amplification or sequencing of template DNA, or in the preparation of products for the replication, amplification or sequencing of template DNA.
7. The use according to claim 6, characterized in that The replication, amplification or sequencing of the template DNA includes incorporating a nucleotide substrate into the template DNA, wherein the nucleotide substrate includes a non-natural nucleotide; The non-natural nucleotide includes a natural nucleotide having a polyphosphate group, wherein the terminal phosphate group of the polyphosphate group is connected to one end of a connecting arm through a covalent bond, and the other end of the connecting arm is connected to an oligonucleotide.
8. A kit for replicating, amplifying or sequencing template DNA, characterized in that The kit comprises the DNA polymerase according to any one of claims 1 to 2.
9. A method for replicating, amplifying or sequencing a template DNA, characterized in that: The method comprises the steps of contacting the template DNA with a primer, a nucleotide substrate and the DNA polymerase according to any one of claims 1 to 2.
10. The method according to claim 9, characterized in that The nucleotide substrate includes a non-natural nucleotide; The non-natural nucleotide includes a natural nucleotide having a polyphosphate group, wherein the terminal phosphate group of the polyphosphate group is connected to one end of a connecting arm through a covalent bond, and the other end of the connecting arm is connected to an oligonucleotide.