Streptomyces DNA (deoxyribonucleic acid) large fragment deletion tool as well as recombinant plasmid and application thereof

By combining the TnpB system and the homologous recombination system, a large DNA fragment deletion tool suitable for Streptomyces was developed, which solved the problem of large fragment editing in the Streptomyces genome, achieved efficient editing, and promoted the development of metabolic engineering and synthetic biology.

CN120683079APending Publication Date: 2025-09-23SHANGHAI JIAOTONG UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510597499.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-09
Publication Date
2025-09-23

AI Technical Summary

Technical Problem

Editing large fragments of the Streptomyces genome is difficult, and existing tools are inefficient and difficult to apply in Streptomyces, especially due to its large genome and high GC content, and the lack of effective genetic manipulation tools.

Method used

By combining the TnpB system and homologous recombination system, a large DNA fragment deletion tool suitable for Streptomyces was developed, including TnpB nuclease, guide RNA and large DNA fragment deletion box, to achieve efficient editing through homologous recombination repair.

Benefits of technology

It has achieved efficient editing of large gene regions in Streptomyces, provided a powerful research tool, promoted the development of metabolic engineering and synthetic biology, and avoided the off-target risk of the CRISPR system.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120683079A_ABST
    Figure CN120683079A_ABST
Patent Text Reader

Abstract

The invention discloses a streptomyces DNA (deoxyribonucleic acid) large fragment deletion tool as well as a recombinant plasmid and application thereof. The streptomyces DNA large fragment deletion tool comprises TnpB nuclease, guide RNA (ribonucleic acid) and a DNA large fragment deletion box. The DNA large fragment deletion box comprises a target DNA large fragment upstream homologous arm and a target DNA large fragment downstream homologous arm; and the lengths of the upstream and downstream homologous sequences of the targeted DNA large fragment are 1.5-10kb respectively. The invention also discloses a recombinant plasmid comprising the streptomycete DNA large fragment deletion tool, application of the streptomycete DNA large fragment deletion tool or the recombinant plasmid in streptomycete DNA large fragment knockout, and a streptomycete DNA large fragment knockout method. According to the invention, a homologous recombination system is combined with an efficient TnpB mini gene editing system, so that accurate and efficient editing of streptomyces DNA large fragments can be realized, and the method has great popularization and application values.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, in particular to a tool for deleting large DNA fragments of Streptomyces, a recombinant plasmid thereof and an application thereof. Background Art

[0002] Editing large fragments of microbial genomic DNA is an important technical means for genome simplification, metabolic pathway optimization and genetic research. Streptomyces is the largest genus among actinomycetes. It is considered to be a group with great development value because it can produce a large number of valuable active secondary metabolites and its genome also contains rich silent biosynthetic gene clusters. However, due to its large genome (8-10Mb) and high GC content (generally GC content exceeds 70%), genetic operations such as gene editing of Streptomyces are very difficult compared to other microorganisms. The means of genetic manipulation are very limited, especially when editing large fragments of the genome, there is a lack of effective tools.

[0003] The TnpB protein is a programmable nuclease recently discovered in transposon systems. It may be an evolutionary ancestor of the Cas12 protein. It is guided by a long noncoding RNA of approximately 231 nt to cleave a DNA sequence near the 5' end of the TTGAT target. Its size is only about one-third that of the Cas protein (approximately 400 amino acids), making it a highly sought-after target by researchers both domestically and internationally. To date, TnpB nucleases have been successfully applied to endogenous gene editing in a variety of species, including human cells, mouse embryos, and monocotyledonous and dicotyledonous plants. Researchers have also conducted large-scale, systematic research and study on the widespread distribution of TnpB nucleases in organisms, identifying multiple TnpB species with targeted editing activity. However, compared to Cas9, TnpB, like other compact gene editing tools, suffers from low editing efficiency. More importantly, existing small editors have not yet been reported for gene editing in Streptomyces.

[0004] Patent CN113528408B discloses a method and application for efficient large-scale genome deletion based on the CRISPR-nCas3 system, which is mainly applied to Zymomonas mobilis and similar cells. Zymomonas mobilis and similar bacteria have significant differences in physiological characteristics from Streptomyces. Zymomonas mobilis and similar bacteria are Gram-negative bacteria with small genomes (~2-3Mbp), while Streptomyces are Gram-positive bacteria with large genomes (~8-12Mbp), GC content of more than 70%, and multi-copy genes and repetitive sequences. There are significant challenges in applying CRISPR-nCas3-based large-scale deletion technology to Streptomyces genome editing. Multiple obstacles such as delivery efficiency, genome complexity, and genetic tool compatibility need to be overcome, resulting in its high difficulty in application in Streptomyces. Summary of the Invention

[0005] In response to the current situation that there is still a lack of large-fragment genome editing tools in Streptomyces, the present invention deeply analyzes the core elements and action mechanisms of the small-volume, programmable TnpB nuclease for gene editing. By utilizing the TnpB system and homologous recombination system, an efficient large-fragment gene editing tool suitable for Streptomyces is developed, thereby achieving efficient editing of large-fragment gene regions in Streptomyces. This provides a powerful set of tools for conducting basic and applied research in Streptomyces, and promotes the development of metabolic engineering, systems biology, and synthetic biology.

[0006] To solve the above technical problems, the purpose of the present invention is to provide a tool for deleting large DNA fragments of Streptomyces, a recombinant plasmid thereof and its application.

[0007] The object of the present invention is achieved through the following technical solutions:

[0008] In a first aspect, the present invention provides a large DNA fragment deletion tool for Streptomyces based on the TnpB system, comprising: TnpB nuclease, guide RNA, and a large DNA fragment deletion box.

[0009] As some specific embodiments of the present invention, the large DNA fragment deletion box includes the following core elements in sequence according to the direction of editing the targeted large DNA fragment: an upstream homology arm of the targeted large DNA fragment and a downstream homology arm of the targeted large DNA fragment; the upstream and downstream homologous sequences of the targeted large DNA fragment are used to provide a homologous recombination repair template when the large DNA fragment is deleted, wherein the lengths of the upstream and downstream homologous sequences of the targeted large DNA fragment are 1.5-10kb, respectively.

[0010] As some specific embodiments of the present invention, the guide RNA includes an RNA backbone, a targeting segment, and a hepatitis delta virus (HDV) ribozyme.

[0011] As some specific embodiments of the present invention, the nucleotide sequence of the RNA backbone is shown as SEQ ID NO.3; the targeting segment is located at the 3' end of the RNA backbone, and is a nucleic acid sequence with a length of 12-40nt after the TAM sequence (5'TTGAT) on the large fragment of the targeting gene; the nucleotide sequence of the hepatitis delta virus (HDV) ribozyme is shown as SEQ ID NO.5, which is used to stabilize the RNA backbone-gene targeting segment structure.

[0012] As some specific embodiments of the present invention, the TnpB nuclease is a codon-optimized TnpB nuclease that can be expressed in Streptomyces, and its DNA similarity with its wild-type TnpB derived from Deinococcus radiodurans ISDra2 is 79.74%; the amino acid sequence of the TnpB nuclease is shown in SEQ ID NO.1, and the nucleotide sequence is shown in SEQ ID NO.2.

[0013] In a second aspect, the present invention provides a recombinant plasmid comprising the Streptomyces DNA large fragment deletion tool described above. The recombinant plasmid is a Streptomyces DNA large fragment deletion plasmid containing an apramycin resistance selection marker.

[0014] As some specific embodiments of the present invention, the recombinant plasmid is constructed by inserting TnpB nuclease, guide RNA, and DNA large fragment deletion cassette into the Escherichia coli-Streptomyces shuttle plasmid.

[0015] As some specific embodiments of the present invention, the method for constructing the recombinant plasmid includes:

[0016] S1. Replace the Cas9 and sgRNA fragments on the Streptomyces-Escherichia coli shuttle plasmid vector pCRISPR-Cas9 with TnpB nuclease and guide RNA, respectively, to obtain the plasmid pTnpB-reRNA;

[0017] S2. Cut the plasmid pTnpB-reRNA with SphI endonuclease to obtain linearized pTnpB-reRNA;

[0018] S3. Seamlessly clone and assemble the large DNA fragment deletion cassette into the linearized plasmid vector pTnpB-reRNA to obtain the plasmid pSTAGE-BGC.

[0019] In a third aspect, the present invention provides a use of the Streptomyces DNA large fragment deletion tool or recombinant plasmid as described above in knocking out Streptomyces DNA large fragments.

[0020] In a fourth aspect, the present invention provides a method for knocking out a large DNA fragment of Streptomyces, comprising the following steps:

[0021] A1. Under non-inducing conditions, the recombinant plasmid described in any of the above items is transformed into the target host, and the large DNA fragment is deleted by homologous exchange of the homology arm sequences of the large DNA fragment deletion cassette with the upstream and downstream homologous sequences of the targeted large DNA fragment. Transformants carrying the large DNA fragment deletion plasmid are obtained by screening for antibiotics associated with the plasmid resistance.

[0022] A2. Streak the transformants from step A1 onto a culture medium plate containing plasmid resistance antibiotics and promoter inducer, and culture at a constant temperature until a single colony is visible;

[0023] A3. Randomly select the single clones from step A2 and perform colony PCR verification to obtain a traceless large DNA fragment knockout strain.

[0024] This invention combines the TnpB nuclease with a homologous recombination repair system, enabling the deletion of gene clusters exceeding 10kb in a single operation. Compared to Cas9 and other methods, its miniaturized structure (~400 aa) is more adaptable to the transformation bottleneck of Streptomyces. Its reRNA-dependent targeting mechanism can precisely recognize high-AT TAM sequences in the Streptomyces genome, avoiding the off-target risks of the CRISPR system.

[0025] Compared with the prior art, the present invention has the following beneficial effects:

[0026] 1) By combining homologous recombination with the efficient TnpB mini-gene editing system, a novel large-fragment deletion tool suitable for Streptomyces DNA was developed;

[0027] 2) The Streptomyces DNA large fragment deletion tool of the present invention can achieve accurate and efficient editing of large Streptomyces DNA fragments, and has great promotion and application value;

[0028] 3) The Streptomyces DNA large fragment deletion tool of the present invention can achieve efficient editing of large fragment gene regions in Streptomyces, providing a powerful tool for conducting basic and applied research in Streptomyces, and promoting the development of metabolic engineering, systems biology, and synthetic biology;

[0029] 4) This invention focuses on combining the TnpB nuclease with the homologous recombination repair system for the first time, enabling the deletion of gene clusters larger than 10 kb in a single operation. Compared with Cas9 and other methods, its miniaturized structure (~400 aa) is more adaptable to the transformation bottleneck of Streptomyces; the reRNA-dependent targeting mechanism can accurately identify high-AT TAM sequences in the Streptomyces genome, avoiding the off-target risks of the CRISPR system. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Other features, objects and advantages of the present invention will become more apparent upon reading the detailed description of non-limiting embodiments with reference to the following drawings:

[0031] Figure 1 The pSTAGE-BGC plasmid map constructed in Example 1;

[0032] Figure 2This is a graph showing the pigment secretion results of randomly selected monoclonal edited strains containing plasmids pSTAGE-BGC-1.0kb, pSTAGE-BGC-1.5kb, pSTAGE-BGC-2.0kb, and pSTAGE-BGC-2.5kb after 14 days of culture in Example 3;

[0033] Figure 3 This is a schematic diagram of the theoretical genome of a strain in which the actinorhodin synthesis gene cluster is successfully deleted in Example 3;

[0034] Figure 4 This is a diagram showing the DNA electrophoresis results of some monoclonal clones deleted from the actinomycetoma biosynthesis gene cluster using pSTAGE-BGC-1.0 in Example 3;

[0035] Figure 5 This is a diagram showing the DNA electrophoresis results of some monoclonal clones deleted from the actinomycetoma biosynthesis gene cluster using pSTAGE-BGC-1.5kb in Example 3;

[0036] Figure 6 This is the Sanger sequencing result of some single clones that successfully knocked out a large fragment of the target gene in the Streptomyces model strain S. ceolicolor M145 using pSTAGE-BGC-1.5kb in Example 3. DETAILED DESCRIPTION

[0037] The present invention will be described in detail below with reference to specific embodiments. The following embodiments will help those skilled in the art to further understand the present invention, but are not intended to limit the present invention in any form. It should be noted that, for those skilled in the art, several variations and improvements can be made without departing from the scope of the present invention. These all fall within the scope of protection of the present invention.

[0038] The present invention uses the model strain Streptomyces coelicolor M145 as the target strain, whose genome sequence number is GeneBank: GCA_008931305.1. The present invention uses SCO5087 (actI), a key gene for actinoporin synthesis in this strain, as the endogenous gene target, with the goal of deleting the actinoporin synthesis gene cluster to test the editing efficiency of the present invention.

[0039] Example 1: Construction of a tool for deleting large DNA fragments in Streptomyces

[0040] 1.1 Plasmid design and construction

[0041] Based on the codon preference of Streptomyces, the TnpB nuclease from Deinococcus radiodurans ISDra2 was codon-optimized. The optimized TnpB nuclease has a DNA similarity of 79.74% with the TnpB nuclease from the wild type of Deinococcus radiodurans ISDra2. The amino acid sequence is shown in SEQ ID NO.1, and the nucleotide sequence is shown in SEQ ID NO.2.

[0042] The guide RNA, named reRNA, consists of the following core components, arranged from the 5' to the 3' end: an RNA backbone (sequence shown in SEQ ID NO. 3), a gene-targeting region (sequence shown in SEQ ID NO. 4 when targeting the SCO5087 gene as described above), and a hepatitis D virus (HDV) ribozyme (sequence shown in SEQ ID NO. 5). All of these gene fragments were synthesized by GenScript Biotech Co., Ltd.

[0043] The codon-optimized TnpB nuclease and reRNA-ZH were used to replace the Cas9 and sgRNA fragments on the Streptomyces-Escherichia coli shuttle plasmid vector pCRISPR-Cas9 (https: / / doi.org / 10.1021 / acssynbio.5b00038), respectively, to obtain the plasmid pTnpB-reRNA.

[0044] The plasmid pTnpB-reRNA was then digested with SphI endonuclease to obtain linearized pTnpB-reRNA. The gene knockout cassette consisting of the upstream and downstream homology arms of the target gene was then seamlessly cloned and assembled with the linearized plasmid vector pTnpB-reRNA (the kit was purchased from Vazyme, ClonExpress Ultra One Step Cloning Kit) to obtain the plasmid pSTAGE-BGC (plasmid map shown in Figure 2). Figure 1 shown).

[0045] The present invention uses the key gene SCO5087 (actI) for actinorhodin synthesis as an endogenous gene target, designs and constructs plasmids pSTAGE-BGC with upstream and downstream homology arms of approximately 1.0 kb, 1.5 kb, 2.0 kb, and 2.5 kb, respectively, and names them pSTAGE-BGC-1.0 kb, pSTAGE-BGC-1.5 kb, pSTAGE-BGC-2.0 kb, and pSTAGE-BGC-2.5 kb for knocking out the actinorhodin synthesis gene cluster (17.4 kb). Among them, the upstream homology arm sequence of approximately 1.0 kb in length is shown in SEQ ID NO. 6, and the downstream homology arm sequence of approximately 1.0 kb in length is shown in SEQ ID NO. 7; the upstream homology arm sequence of approximately 1.5 kb in length is shown in SEQ ID NO. 8, and the downstream homology arm sequence of approximately 1.5 kb in length is shown in SEQ ID NO. 9; the upstream homology arm sequence of approximately 2.0 kb in length is shown in SEQ ID NO. 10, and the downstream homology arm sequence of approximately 2.0 kb in length is shown in SEQ ID NO. 11; the upstream homology arm sequence of approximately 2.5 kb in length is shown in SEQ ID NO. 12, and the downstream homology arm sequence of approximately 2.5 kb in length is shown in SEQ ID NO. 13. All constructed plasmids were subjected to Sanger sequencing to ensure complete accuracy.

[0046] Example 2: Application of the Streptomyces Efficient Ultra-mini Editing System

[0047] 2.1 Conversion

[0048] The target plasmid constructed in Example 1 was transformed into E. coli ET12567 / pUZ8002 (https: / / doi.org / 10.1016 / 0378-1119(92)90549-5) competent cells for plasmid amplification. The specific method is as follows:

[0049] 200 ng of plasmid was added to 100 μL of thawed homemade competent cells E. coli ET12567 / pUZ8002, and the tube wall was gently tapped to mix; after standing on ice for 30 minutes, it was placed in a 42°C water bath for 45 seconds, and then immediately placed on ice for 2-3 minutes; then, antibiotic-free LB liquid medium was added, and cultured at 200 rpm and 37°C for 1 hour; then centrifuged at 5000 rpm for 5 minutes, and 900 μL of supernatant was discarded; the cells were resuspended in the remaining culture medium and added to a 1% PBS containing kanamycin (25 μg / mL), chloramphenicol (12.5 μg / mL) and apramycin (50 μg / mL). mL) solid LB plates and gently spread evenly with a sterile spreader; after overnight incubation at 37°C, single colonies were picked and cultured in 20 mL of LB liquid medium containing 25 μg / mL kanamycin, 12.5 μg / mL chloramphenicol, and 50 μg / mL apramycin. When the culture OD600 reached approximately 0.4, the cells were collected by centrifugation at 5000 rpm for 5 minutes; 20 mL of antibiotic-free LB liquid medium was added, and the mixture was centrifuged at 5000 rpm for 5 minutes. The supernatant was discarded, and this step was repeated twice; finally, the cells were resuspended in 2 mL of LB liquid medium.

[0050] 2.2. Binding transfer and resistance screening

[0051] Under non-inducing conditions, the plasmid from E. coli in step 2.1 was transferred into Streptomyces coelicolor M145 by conjugation as follows:

[0052] Take the previously collected Streptomyces spores, centrifuge at 5000rpm for 5 minutes, discard the supernatant, resuspend the bacteria in 2mL 2×YT liquid medium, place the centrifuge tube containing the spores in a 50℃ water bath for 10 minutes, and then pre-germinate in a shaker at 200rpm and 30℃ for 30 minutes; take 500μL of the E. coli culture collected in step 2.1 and place it in a 1.5mL centrifuge tube containing 200μL of Streptomyces spore suspension, mediate and mix; take 200μL of the mixture and evenly spread it on an MS plate; invert the MS plate and culture it in a 30℃ incubator. After 18 hours, cover the surface of the culture medium with 1mg / mL apramycin and 1mg / mL nalidixic acid. After the surface is dry, continue to invert the MS plate at 30℃ and culture it until the conjugate grows (about 5 days). At this point, the successfully edited conjugate is obtained.

[0053] Example 3: Evaluation of gene editing efficiency

[0054] The single clones obtained in step 2.2 were randomly picked and streaked onto ISP2 solid medium containing plasmid resistance antibiotics (50 μg / mL apramycin, 100 μg / mL nalidixic acid) and 0.5 μg / mL thiostrepton. The culture was inverted and cultured at 30°C for 14 days. The phenotypic changes were observed to evaluate the editing efficiency of different large DNA fragment knockout systems. Some results are shown in Figure 2. Figure 2 As shown, Figure 2 From left to right, the images represent randomly selected colonies from E. coli strains harboring pSTAGE-BGC-1.0kb, pSTAGE-BGC-1.5kb, pSTAGE-BGC-2.0kb, and pSTAGE-BGC-2.5kb plasmids, respectively, after transfer into S. coelicolor M145. If the actinomycetourin biosynthesis gene cluster is successfully knocked out, the mutant strain will be unable to synthesize rhodopsin, resulting in colorless or lighter colonies. After 14 days of culture, the number of randomly selected colonies growing on solid resistance selection medium that were colorless or lighter increased with increasing homology arm length, demonstrating that pSTAGE-BGC can successfully knock out large target gene fragments in the Streptomyces model strain S. coelicolor M145. Extending the homology arm length improves the efficiency of large fragment knockout in Streptomyces.

[0055] The monoclonal clones edited with pSTAGE-BGC-1.0kb and pSTAGE-BGC-1.5kb in step 2.2 were picked and streaked onto ISP2 solid medium containing plasmid-resistant antibiotics (50 μg / mL apramycin, 100 μg / mL nalidixic acid) and 0.5 μg / mL thiostrepton. The cells were inverted and cultured at 30°C until bacteria were visible. A small amount of bacteria was picked and placed in a PCR tube containing 20 μL DMSO. The tube was placed at 100°C for 15 minutes and then refrigerated at -20°C for 30 minutes. This step was repeated twice to fully lyse the cells and obtain cell lysate. Then, NEB was used to lyse the cells. The target site fragment was amplified by PCR using the High-Fidelity 2X Master Mix (Cat. No.: M0492) kit. The primer design is shown in Table 1, the PCR reaction system is shown in Table 2, and the PCR reaction procedure is shown in Table 3.

[0056] Table 1 PCR amplification primers targeting SCO5087 (actI)

[0057] Primers Sequence (5'-3') Sequence number check-actBGC1.5k-F acgagctgagtcgggacatg SEQ ID NO.14 actBGC-check-R ctgcaacggtgtcagccggc SEQ ID NO.15

[0058] Table 2 PCR reaction system

[0059] system 15 μL <![CDATA[ddH2O]]> 5.25 μL Forward primer (10 μM, SCO5087-LH-F) 0.75μL Reverse primer (10 μM, SCO5087-R) 0.75μL 2 × PhantaFlashMasterMix 7.50 μL Cell lysis buffer (containing DMSO) 0.25 μL

[0060] Table 3 PCR reaction program

[0061]

[0062] The PCR amplification products were subjected to 1% agarose gel electrophoresis. Figure 4 and Figure 5 As shown, the randomly picked colonies grown in the resistance solid screening medium have PCR products and the size is consistent with the theoretical one, indicating that the single clone has successfully knocked out the large fragment of the target gene. Figure 4 Lane 1-8 and Figure 5 Lanes 1-7 show some randomly picked single clones after E. coli containing pSTAGE-BGC-1.0kb plasmid and pSTAGE-BGC-1.5kb plasmid were combined and transferred with S. coelicolor M145. If the target gene large fragment is successfully knocked out, the theoretical PCR band size should be 1702bp ( Figure 3 ), if the actinomycin synthesis gene cluster was not knocked out, the corresponding PCR product could not be detected in 1% agarose gel electrophoresis.

[0063] like Figure 4 As shown in the figure, in the pSTAGE-BGC-1.0kb plasmid editing group, no PCR product that met the theoretical size (1702bp) was detected in any of the 8 single clones, indicating that pSTAGE-BGC-1.0kb failed to efficiently knock out the large fragment of the target gene (actinopurpurogenous gene cluster). Figure 5 As shown, among the 7 single clones in the pSTAGE-BGC-1.5kb editing group, 5 detected PCR products that met the theoretical size (1702bp). These 5 single clones successfully knocked out the actinomycetoma rhodopsin synthesis gene cluster. Therefore, pSTAGE-BGC-1.5kb can successfully knock out large fragments of the target gene in the Streptomyces model strain S. ceolicolor M145. Figure 5 Only the PCR test results of some randomly selected monoclonal clones are shown. Analysis of all randomly selected pSTAGE-BGC-1.5kb binder monoclonal clones showed that the number of strain clones with successful knockout of the actinomycetoma rhodopsin synthesis gene cluster was approximately 50%, indicating that the knockout efficiency of pSTAGE-BGC-1.5kb was 50%.

[0064] The PCR product was then purified and recovered using the WeiZan Plasmid Purification Kit (Cat. No. DC201) and sent to Suzhou Jinweizhi Biotechnology Co., Ltd. for Sanger sequencing analysis. Figure 6 The figure shows the Sanger sequencing results of some monoclonal fragments of the target gene in the pSTAGE-BGC-1.5kb knockout Streptomyces model strain S.ceolicolor M145. Figure 6 Only mutant 1 and mutant 5 (corresponding to Figure 5 The sequencing results of Lane 1 and Lane 5 in the sequence of the PCR product indicated that the large gene fragment of the actinorhodin synthesis gene cluster with a length of 1702 bp was successfully knocked out.

[0065] In summary, the length of the homology arms is crucial for knocking out large fragments of the target gene, and the length of the upstream and downstream homology arms needs to be around 1.5 kb or longer. The above results fully demonstrate that the Streptomyces gene large fragment deletion tool obtained by the present invention can effectively mediate the deletion of large fragments of Streptomyces genes.

[0066] The culture medium used in the above examples is as follows:

[0067] LB medium: Weigh 10 g tryptone, 5 g yeast extract, and 10 g sodium chloride, dissolve in 1 L ddH2O, sterilize at 115°C for 30 minutes, and store at room temperature until ready to use. If preparing solid medium, add 2% agar powder.

[0068] MS medium: Weigh 10 g soybean cake powder, 10 g tryptone, and 10 g agar powder, dissolve in 500 mL tap water, and sterilize at 115°C for 30 min.

[0069] ISP2 medium: Weigh 10 g malt extract, 4 g yeast extract, and 4 g glucose, dissolve in 1 L ddH2O, adjust pH to 7.4, sterilize at 115°C for 30 min, and store at 4°C until used. If preparing solid medium, add 2% agar powder.

[0070] 2×YT medium: Weigh 16 g tryptone, 10 g malt extract, and 5 g sodium chloride, dissolve in 1 L ddH2O, adjust the pH to 7.0, sterilize at 115°C for 30 min, and store at 4°C until use.

[0071] The above describes the specific embodiments of the present invention. It should be understood that the present invention is not limited to the above specific embodiments, and those skilled in the art may make various variations or modifications within the scope of the claims, which do not affect the essence of the present invention.

Claims

1. A tool for deleting large DNA fragments in Streptomyces based on the TnpB system, characterized in that: include: TnpB nuclease, guide RNA, and large DNA deletion cassette.

2. The Streptomyces DNA large fragment deletion tool according to claim 1, characterized in that The large DNA fragment deletion cassette includes the following core elements in sequence according to the direction of editing the targeted large DNA fragment: an upstream homology arm of the targeted large DNA fragment and a downstream homology arm of the targeted large DNA fragment; the lengths of the upstream homology arm of the targeted large DNA fragment and the downstream homology arm of the targeted large DNA fragment are 1.5-10 kb respectively.

3. The Streptomyces DNA large fragment deletion tool according to claim 1, characterized in that The guide RNA includes an RNA backbone, a targeting segment and a hepatitis D virus ribozyme.

4. The Streptomyces DNA large fragment deletion tool according to claim 3, characterized in that The nucleotide sequence of the RNA backbone is shown in SEQ ID NO.3; the targeting segment is located at the 3' end of the RNA backbone and is a nucleic acid sequence with a length of 12-40 nt following the TAM sequence on the large fragment of the targeting gene; the nucleotide sequence of the hepatitis D virus ribozyme is shown in SEQ ID NO.

5.

5. The Streptomyces DNA large fragment deletion tool according to claim 1, characterized in that The TnpB nuclease is a codon-optimized TnpB nuclease that can be expressed in Streptomyces. The amino acid sequence of the TnpB nuclease is shown in SEQ ID NO.1, and the nucleotide sequence is shown in SEQ ID NO.

2.

6. A recombinant plasmid, characterized in that The method comprises the Streptomyces DNA large fragment deletion tool according to any one of claims 1 to 5.

7. The recombinant plasmid according to claim 6, characterized in that The recombinant plasmid is constructed by inserting TnpB nuclease, guide RNA and DNA large fragment deletion box respectively on the basis of Escherichia coli-Streptomyces shuttle plasmid.

8. The recombinant plasmid according to claim 7, characterized in that The construction method of the recombinant plasmid specifically includes: S1. Replace the Cas9 and sgRNA fragments on the Streptomyces-Escherichia coli shuttle plasmid vector pCRISPR-Cas9 with TnpB nuclease and guide RNA, respectively, to obtain the plasmid pTnpB-reRNA; S2. Cut the plasmid pTnpB-reRNA with SphI endonuclease to obtain linearized pTnpB-reRNA; S3. Seamlessly clone and assemble the large DNA fragment deletion cassette into the linearized plasmid vector pTnpB-reRNA to obtain the plasmid pSTAGE-BGC.

9. Use of the Streptomyces DNA large fragment deletion tool according to any one of claims 1 to 5 or the recombinant plasmid according to any one of claims 6 to 8 in knocking out Streptomyces DNA large fragments.

10. A method for knocking out a large DNA fragment of Streptomyces, characterized in that: The steps include: A1. Under non-inducing conditions, the recombinant plasmid described in any one of claims 6 to 8 is transformed into a target host, and transformants carrying the large DNA fragment deletion plasmid are obtained by homologous exchange of the homology arm sequences of the large DNA fragment deletion cassette with the upstream and downstream homologous sequences of the targeted large DNA fragment, and antibiotic screening for plasmid-related resistance; A2. Streak the transformants from step A1 onto a culture medium plate containing plasmid resistance antibiotics and promoter inducer, and culture at a constant temperature until a single colony is visible; A3. Randomly select the single clones from step A2 and perform colony PCR verification to obtain a traceless large DNA fragment knockout strain.

Citation Information

Patent Citations

  • An efficient method for large genome deletion based on the CRISPR-nCas3 system and its application

    CN113528408B