Method for enhancing enzymatic degradation capacity of PET (polyethylene terephthalate) plastic by using biofilm

Abstract

The invention discloses a method for enhancing the enzymatic degradation capacity of PET (polyethylene terephthalate) plastic by using a biofilm, which comprises the following steps: by taking escherichia coli as host bacteria, constructing engineering bacteria of a gene cluster csgBACEFG of over-expression Curli, and fusing the gene cluster csgBACEFG with SpyTag; the method comprises the following steps: constructing a fusion protein of PET degrading enzyme and SpyCatcher; obtaining a biofilm fixed with the fusion protein based on the biofilm formed by expression of the engineering bacteria and the fusion protein; and degrading the PET plastic by using the fusion protein fixed on the biofilm. According to the method disclosed by the invention, the quantity of enzyme displayed on the PET surface and the reusability are improved, and meanwhile, the degradation capability of the PET film is enhanced.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, in particular to a method for enhancing the enzymatic degradation ability of PET plastic by utilizing biofilm. Background Art

[0002] Polyethylene terephthalate (PET) is a polymer of terephthalic acid (TPA) and ethylene glycol (EG) monomers. Due to its excellent heat resistance, plasticity, and mechanical strength, it is widely used in industrial production for food packaging, textile fibers, and thermoplastic resins. However, its difficulty in degradation poses a serious threat to the ecological environment and human health. Currently, most PET waste is still disposed of by landfill or incineration, causing serious secondary pollution. With the increasing severity of environmental pollution, biodegradation is widely considered to be a sustainable solution to PET plastic pollution. Due to its smooth surface, PET can quickly accumulate microorganisms and organic matter, providing an ideal environment for bacterial attachment and growth. The formation of biofilms on the PET surface is the preferred survival mode of plastic-degrading microorganisms. The direct contact between the biofilm and the plastic surface enhances the interfacial interaction between the microbial exoenzymes and the polymer substrate. This synergistic mechanism is considered to be one of the key steps in achieving efficient plastic biodegradation.

[0003] Curli nanofibers are the main component of Escherichia coli biofilms. They are a highly stable functional amyloid protein that plays a key role in the adhesion process between cells and between cells and solid carrier surfaces. The discovery of the work of engineering biofilm Escherichia coli Curli to assemble living materials has officially opened the prelude to the emerging field of engineered living materials, which not only allows the use of the inherent dynamic properties of organisms, but also can provide naturally endowed or artificially designed properties by introducing functional material modules. Escherichia coli biofilms are an ideal platform for cell catalysis because functionalized Curli nanofibers can precisely control the number and direction of enzymes at the nanoscale to maximize the catalytic efficiency of complex biological transformations. Due to the size limitations of the Curli system in secretion, it is difficult to effectively display large-sized tagged proteins. Researchers have tried to display short peptide sequences through the Curli system, and then anchor large-sized proteins to the surface of Curli fibers with the help of non-covalent or covalent interactions. by Strengthening the anchoring between enzymes or between enzymes and carriers. For example, surface display of PET-degrading enzymes using the Curli system can enhance the interaction between the enzyme and the substrate. However, most existing E. coli biofilms expressing Curli overexpress CsgA, resulting in weak PET adsorption. Further improvement of the enzymatic degradation of PET plastics remains a challenge that requires further exploration. Summary of the Invention

[0004] The purpose of the present invention is to provide a method for enhancing the enzymatic degradation ability of PET plastic by utilizing biofilm. This method can enhance the amount of Curli formed in the plastic PET, improve the interfacial catalytic efficiency by coordinating the interaction between the substrate and the enzyme through the biofilm Curli, and enhance the degradation of the plastic PET.

[0005] To achieve the above object, the present invention adopts the following technical solutions: A method for enhancing the enzymatic degradation ability of PET plastic using biofilm, the method comprising: Using Escherichia coli as the host bacteria, a gene cluster overexpressing Curli was constructed csgBACEFG The engineered bacteria, the gene cluster csgBACEFG Fusion SpyTag; Construct a fusion protein of PET degrading enzyme and SpyCatcher; immobilizing the fusion protein on the biofilm formed by fermentation of the engineered bacteria; Utilize fusion proteins fixed on biofilm to degrade PET plastic.

[0006] In some embodiments of the present invention, the engineering bacteria are constructed by combining an arabinose-inducible promoter and csgBACEFG-spytag The recombinant operon constructed was integrated into multiple sites of the Escherichia coli host genome to obtain overexpression csgBACEFG Engineered bacteria; described csgBACEFG-spytag For connection spytag genetic csgBACEFG gene cluster.

[0007] In some embodiments of the present invention, the gene cluster csgBACEFG Derived from Escherichia coli K12 series strains.

[0008] In some embodiments of the present invention, the gene cluster csgBACEFG The way to obtain is: Obtained from Escherichia coli csgBAC Operon and csgDEFG Operon, a gene cluster obtained by homologous recombination csgBACEFG of the recombinant plasmid.

[0009] In some embodiments of the present invention, the recombinant operon is integrated into the host bacterial genome using the CASTs system.

[0010] In some embodiments of the present invention, the host bacteria is Escherichia coli BW25113.

[0011] In some embodiments of the present invention, the recombinant operon is integrated into the E. coli genome. codA-cynR , uvrB-ybhK , ptsG-fhuE and ydgA-uidC Location.

[0012] In some embodiments of the present invention, the bacterial solution of the engineered bacteria is added to the culture medium to induce the biosynthesis of Curli to form a biofilm containing SpyTag, and the fusion protein is co-incubated with the biofilm containing SpyTag to obtain a biofilm with fixed fusion protein.

[0013] In some embodiments of the present invention, the bacterial solution of the engineered bacteria is added to a culture medium containing a carrier to induce the biosynthesis of Curli, so that the biofilm is attached to the carrier; and the carrier attached with the biofilm is co-incubated with the fusion protein.

[0014] In some embodiments of the present invention, the carrier is a film-like PET plastic to be degraded, or a cell slide.

[0015] In some embodiments of the present invention, the PET degrading enzyme is FAST-PETase.

[0016] The present invention has the following beneficial effects: The present invention overexpresses the Curli gene cluster csgBACEFG Increase the expression of Curli, enhance adhesion to plastic, and fuse the SpyTag tag to the recombinant operon csgBACEFG middle csgA The C-terminus of the gene was targeted and the recombinant operon was integrated into the host bacterial chromosome to construct an engineered Curli strain. Furthermore, SpyCatcher was fused with a PET-degrading enzyme (FAST-PETase) for expression and secretion. Thus, the functionalized Curli nanofibers produced by the biofilm engineered bacteria can covalently capture the SpyCatcher-labeled PET-degrading enzyme, increasing the local concentration of the PET-degrading enzyme on the plastic surface and accelerating PET depolymerization. The applicants discovered that compared to the free enzyme FAST-PETase-SpyCatcher, the FAST-PETase-SpyCatcher-loaded E. coli biofilm engineered bacteria increased the amount of enzyme displayed on the PET surface and its reusability, while also enhancing the degradation of PET film. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 Verification of biofilm biomass and PET adsorption of SpyTag-integrated strains; A: Biomass of biofilm stained with crystal violet; B: Biomass adsorbed on the PET surface; C: Image of the 96-well plate and biofilm adsorbed on the PET surface after crystal violet staining.

[0018] Figure 2The application of CSGO biofilm loaded with FAST-PETase-SpyCatcher to degrade NanoPET; A: Schematic diagram of the workflow for biofilm degradation of NanoPET; B: The biofilm cell slide immobilized with FAST-PETase-SpyCatcher was inverted and cultured on a NanoPET plate for 7 days. The left plate contained the cell slide, while the right plate was clear of the cell slide.

[0019] Figure 3 The reusability of the biofilm of BW25113::CsgBACEFG4-SpyTag strain loaded with FAST-PETase-SpyCatcher to degrade NanoPET; A: Image of the biofilm after 5 cycles of degradation of NanoPET; B: Total enzyme activity measurement of FAST-PETase-SpyCatcher before and after fixation; C: 1 OD 600 Comparison of the total enzyme activity of biofilm and planktonic cells; D: After 5 cycles, the concentrations of the depolymerization products TPA and MHET were determined by HPLC.

[0020] Figure 4 Figure 3. Reusability of NanoPET degradation by BW25113::CsgBACEFG4-SpyTag planktonic cells loaded with FAST-PETase-SpyCatcher. A: Determination of total enzyme activity of FAST-PETase-SpyCatcher before and after immobilization. B: Determination of the yield of depolymerization products TPA and MHET by HPLC after 5 cycles.

[0021] Figure 5 Figure 2. BW25113::CsgBACEFG4-SpyTag biofilm chassis catalyzes PET film degradation; A: SEM images of PET film adsorbed with no biofilm (upper row) and 2-day-old biofilm (lower row) for 12 h, scale bar: 50 μm; B: HPLC analysis of the release of degradation products from depolymerized PET films of different biofilm thicknesses; C: Images showing crystal violet staining of biofilms attached to the PET surface after two and four days of culture; D: Biofilm biomass attached to the PET surface. DETAILED DESCRIPTION

[0022] The present invention discloses a method for enhancing the enzymatic degradation ability of PET plastics by utilizing biofilm. Those skilled in the art can refer to the contents of this article and appropriately improve the process parameters to achieve the method. It should be particularly noted that all similar replacements and modifications are obvious to those skilled in the art, and they are all considered to be included in the present invention. The experimental methods in the following examples that do not specify specific conditions are generally carried out under conventional conditions or according to the conditions recommended by the manufacturer. Unless otherwise defined, all professional and scientific terms used in the text have the same meanings as those familiar to those skilled in the art. In addition, any methods and materials similar or equivalent to the described contents can be applied to the method of the present invention. The preferred implementation methods and materials described in the text are for demonstration purposes only.

[0023] The sources of materials involved in the examples are as follows: E. coli BL21 and BW25113 strains are commercial strains and can be purchased through commercial channels.

[0024] csgBAC、csgEFG It is derived from the genome of Escherichia coli BW25113, which is derived from E. coliK-12 W1485, a derivative strain of E. coli K12.

[0025] The 96-well plate was purchased from Corning, Corning™ Costar™ 96-Well (U-Shaped-Bottom Microplate).

[0026] PET was purchased from Goodfellow GmbH in amorphous form with a thickness of 0.25 mm.

[0027] Cell slides were purchased from Shanghai Jizhi Biochemical Technology Co., Ltd. with diameters of 25 mm and 20 mm.

[0028] Unless otherwise specified, the remaining materials are conventional materials and can be obtained from commercial channels.

[0029] The culture medium components involved in the embodiment are: LB medium: 5 g / L yeast powder, 10 g / L peptone, and 10 g / L sodium chloride.

[0030] M63+ minimal medium (1 L): 100 mM KH2PO4, 17 mM sodium succinate, 15 mM (NH4)2SO4, 100 mM MgSO4, 1 M D-glucose, 1.5 mM FeSO4, adjusted to pH 7.0.

[0031] 5×MSM medium: 10 g / L (NH4)2SO4, 1 g / L MgSO4·7H2O, 0.05 g / L CaCl2·2H2O, 0.005 g / L FeSO4·7H2O, 7.5 g / L Na2HPO4·12H2O, 7.5 g / L KH2PO4.

[0032] The preparation formula of the NanoPET plate in the embodiment is as follows: taking 200 mL as an example, 50 mL of ultrapure water, 40 mL of 5×MSM medium, and 2 g of agar powder were weighed into a conical flask, and the mixture was sterilized at 121°C and autoclaved for 20 min. The prepared NanoPET emulsion was heated to 65°C, and 110 mL of the NanoPET emulsion was poured into the prepared conical flask with shaking, mixed, and then poured into the plate.

[0033] In the examples, the degraded nano-PET (NanoPET) emulsion was prepared as follows: an amorphous PET plastic film was purchased, shredded into flake particles, pulverized using a blender, and filtered through a 40-mesh steel sieve to obtain particles with a particle size of ≤425 μm. 1 g of PET particles was weighed and added to 40 mL of hexafluoroisopropanol. The mixture was allowed to stand at room temperature for 12 hours, shaken several times until the plastic particles were completely dissolved, and then added dropwise using a separatory funnel at a rate of 0.5 mL / min to 800 mL of ultrapure water at 30°C and 1000 rpm. The resulting white, turbid emulsion was then subjected to a rotary evaporator at 60°C and 190 mbar to remove the hexafluoroisopropanol and concentrate to half its volume. The precipitated plastic was then filtered using a Büchner funnel to obtain 400 mL of NanoPET emulsion.

[0034] The formula of the washing buffer is: 0.5% Tween-20, 8.5 g NaCl, 1.4 g Na2HPO4, 0.2 g NaH2PO4, adjust the pH to 7.4, adjust the volume to 1 L, and store at 4°C.

[0035] Example 1 Purification and expression of the fusion protein FAST-PETase-SpyCatcher.

[0036] The FAST-PETase-SpyCatcher gene was synthesized by Nanjing GenScript Biotech Co., Ltd. and inserted into the NdeI and XhoI sites of the plasmid pET-29a(+) to construct the recombinant plasmid pET-29a(+)-FAST-PETase-SpyCatcher. The recombinant plasmid was then transferred into E. coliThe PET was expressed, secreted, and purified in BL21. FAST-PETase is an existing enzyme. Refer to LU H, DIAZ DJ, CZARNECKI NJ, et al. Machine learning-aided engineering of hydrolases for PET depolymerization [J]. Nature, 2022, 604(7907): 662-7. The protein purification steps are as follows: E. coli BL21 recombinant plasmid pET-29a(+)-FAST-PETase-SpyCatcher was cultured in LB medium containing 50 μg / mL kanamycin at 37°C overnight. 1% of the culture medium was transferred to 500 mL of fresh LB medium. When the OD 600 When the RI value reached 0.6-0.8, 0.1 mM isopropyl-β-D-thiogalactopyranoside (IPTG) was added and cultured at 18°C ​​for 24 hours for protein expression. The fermentation broth was centrifuged at 8000 rpm for 10 minutes, and the cell pellet was collected. The cell pellet was disrupted and centrifuged at 8000 rpm for 10 minutes. The supernatant was the crude enzyme. The protein was purified using a nickel affinity layer. Imidazole was removed using a protein ultrafiltration tube (Millipore, 10 kDa), and the enzyme protein was concentrated. Protein concentration was determined by the Bradford method, and protein expression was analyzed by 12.5% ​​SDS-PAGE.

[0037] The protein concentration was determined by aspirating 200 μL of the protein quantification kit TaKaRa Bradford Protein Assay Kit and 4 μL of enzyme solution, reacting at room temperature for 5 min, and measuring with a microplate reader at a wavelength of 595 nm.

[0038] Protease activity is measured by adding 980 μL of PB (pH 8) buffer, 10 μL of 10 mM 4-nitrophenyloctanoate substrate, and 10 μL of enzyme solution to a 1 mL volume. The assay is then incubated at 37°C in a water bath for 5 minutes, with the enzyme wavelength set at 410 nm. One unit (U) of FAST-PETase-SpyCatcher activity is defined as the amount of enzyme that catalyzes the formation of 1 micromole of p-nitrophenol per minute under the assay conditions.

[0039] Example 2 Method for constructing engineered bacteria overexpressing the Curli gene cluster.

[0040] Using Escherichia coli BW25113 as the host bacteria, engineered bacteria BW25113::CsgBACEFG4 and BW25113::CsgBACEFG4-SpyTag overexpressing the Curli gene cluster were constructed.

[0041] BW25113::CsgBACEFG4 is an engineered bacterium that overexpresses the Curli gene cluster CsgBACEFG. The construction method is to use the CASTs system to transform the arabinose promoter and csgBACEFG The recombinant operon was integrated into the genome of Escherichia coli BW25113 codA-cynR , uvrB-ybhK , ptsG-fhuE and ydgA-uidC Location.

[0042] The specific construction process is as follows: Construction of pDonor-CsgBACEFG plasmid: amplification using primers pDonor csgBAC_F and pDonor csgBAC_R csgBAC gene fragments and amplified using primers pDonor csgEFG_F and pDonor csgEFG_R csg Using the pDonor plasmid containing an arabinose-inducible promoter as a template, the linearized vector was amplified using the upstream primer pDonor-csgBACEFGV_F and the downstream primer pDonor-csgBACEFG V_R and purified and recovered. The recovered vector was then cloned using the ClonExpressMultiS One Step Cloning Kit. csgBAC gene fragments, csg The gene fragments were subjected to multi-fragment homologous recombination with the linearized pDonor vector.

[0043] The recombinant product was transformed into Dh5α and plated on LB plates supplemented with 100 µg / mL ampicillin. Single colonies were selected and transferred to LB plates supplemented with 100 µg / mL ampicillin for enrichment. After verification of colony identity using PCR with primers pDonor-csgBACEFG_F and pDonor-csgBACEFG_R, the colonies were transferred to 5 mL LB tubes supplemented with 100 µg / mL ampicillin and cultured overnight at 37°C. Plasmids were extracted using a plasmid miniprep kit and verified by sequencing. Primers are listed in Table 1.

[0044] Table 1 Primers used for plasmid pDonor-CsgBACEFG

[0045] by csgBACEFGGene targeted knock-in in Escherichia coli BW25113 codA-cynR , uvrB-ybhK , ptsG-fhuE and ydgA-uidC Taking the site as an example, the steps are as follows.

[0046] (1) Plasmid transformation: Take out the prepared E. coli BW25113 electroporation competent cells and dissolve them on ice for 5 minutes. Add plasmids pTns and pQCascade (array for 4) respectively. Mix them gently with a pipette and transfer them into a 2 mm pre-cooled electroporation cup. Let it stand on ice for 10 minutes. Use an electroporator to complete the electroporation of the plasmid at 2.5 kV. Then, immediately add 900 μL LB medium (without antibiotics) to the electroporation cup, mix well, and then rejuvenate at 37°C for 1 hour. Take 100 μL of bacterial solution and spread it on an LB double-antibody plate containing 100 μg / mL kanamycin and 50 μg / mL streptomycin. Place it in a 37°C incubator and grow it upside down overnight. Pick a single colony on the plate and transfer it to a new LB double-antibody plate for enrichment. Generally, the colony that can still grow after transfer is the strain with successful plasmid introduction. Colony PCR can also be performed for verification. The recombinant plasmid pDonor-CsgBACEFG was electroporated into the Escherichia coli BW25113 strain that had successfully introduced pTns and pQCascade (array for 4) and then incubated at 37°C for 1 h. The cells were plated on LB plates containing 100 μg / mL ampicillin, 100 μg / mL kanamycin, and 50 μg / mL streptomycin (referred to as the triple antibody) and cultured at 37°C for 16 h.

[0047] (2) Transposition experiment: Scrape hundreds of colonies from the triple antibody plate and transfer them to LB-agar plates containing 100 ng / mL tetracycline, 100 μg / mL ampicillin, 100 μg / mL kanamycin, and 50 μg / mL streptomycin (referred to as the quadruple antibody). Incubate at 37°C for 16 h to obtain single colonies; transfer them to the quadruple antibody LB-agar plates containing 1000 ng / mL high-concentration tetracycline and incubate at 37°C for 16 h. Transfer the high-concentration quadruple antibody plates twice to obtain single colonies, enrich them on the triple antibody plates, and perform colony PCR verification and sequencing verification. If you need to improve the transposition efficiency, you can perform 2-3 more transposition inductions.

[0048] Table 2 Targeting codA-cynR , uvrB-ybhK , ptsG-fhuE and ydgA-uidC Primer verification of the locus

[0049] (3) Elimination of plasmids: For the strains verified to be correct by colony PCR and sequencing, since three plasmids were introduced during the previous transposition integration, in order to terminate the transposition process, the three plasmids of the CASTs system need to be eliminated.

[0050] 1) Plasmid Transformation: Thaw competent cells prepared from the BW25113 strain containing pDonor, pTns, and pQCascade on ice for approximately 5 minutes. Add the target plasmid, pCutAmp, and gently mix using a pipette. Transfer the cells to a 2 mm electroporation cuvette and incubate on ice for 10 minutes. Electroporate at 2.5 kV. Immediately add 900 μL of antibiotic-free LB medium and resuspend the cells in a culture at 37°C, 200 rpm, for 1 hour. To improve the efficiency of plasmid removal, the revived bacterial liquid was transferred into 4 mL of LB liquid medium containing 10 mM rhamnose and 50 μg / mL apramycin and induced at 37°C and 200 rpm for 3 h. After 2 mL of culture medium was centrifuged at 5000 rpm for 3 min, part of the supernatant was removed and about 100 μL of culture medium was mixed to precipitate cells, which were spread on LB agar plates containing 50 μg / mL apramycin and 10 mM rhamnose and cultured at 37°C overnight.

[0051] 2) Elimination verification: pCutAmp also contains sacB The gene, encoding a L-urease that catalyzes sucrose hydrolysis and fructan polymerization, prevented E. coli harboring pCutAmp from growing on plates containing 10% sucrose. Colonies growing on LB plates containing 50 µg / mL apramycin and 10 mM rhamnose were selected, streaked onto LB plates containing 10% sucrose, and enriched on antibiotic-free LB-agar plates. Colonies from these plates were then plated onto LB plates containing 100 µg / mL ampicillin, 100 µg / mL kanamycin, 50 µg / mL streptomycin, and 50 µg / mL apramycin. Colonies that failed to grow on plates containing all four antibiotics were considered to have eliminated the plasmids pDonor, pTns, pQCascade, and pCutAmp. The resulting integrated strain was designated BW25113::CsgBACEFG4.

[0052] (4) BW25113::CsgBACEFG4-SpyTag csgBACEFG The SpyTag was fused to the gene cluster. The construction method was as follows: using the CASTs system to integrate the arabinose promoter and csgBACEFG-spytag Recombinant operon into the genome of Escherichia coli BW25113 codA-cynR , uvrB-ybhK , ptsG-fhuE and ydgA-uidC Location.

[0053] To construct the pDonor-CsgBACEFG-SpyTag plasmid, the upstream primer csgA-ST_F and the downstream primer csgA-ST_R were designed using the pDonor-CsgBACEFG plasmid containing an arabinose-inducible promoter as a template as follows: csgA-ST_F CATATAAACCCACCAAAATAATACATCATTTGTATTACAGAAACAGGGC csgA-ST_R TTATTTGGTGGGTTTATATGCATCGACCATAACGATGTGCGCACTGCCACCGCCACCGCTACCGCCACCGCCGTACTGATGAGCGGTCG A linker (GGGGSGGGGS) and a SpyTag (AHIVMVDAYKPTK) were added to the downstream primers to amplify the linearized vector. The amplified PCR product was digested with 1 µL of Dnp I at 37°C for 1 hour and then purified. The linearized vector fragment was then homologously recombined using the ClonExpressII One-Step Cloning Kit. The recombinant product was transformed into Dh5α and plated on LB plates supplemented with 100 µg / mL ampicillin.

[0054] Single colonies were selected and transferred to LB plates containing 100 µg / mL ampicillin for enrichment. After verification by colony PCR, the colonies were transferred to 5 mL LB liquid tubes (containing 100 µg / mL ampicillin) and cultured overnight at 37°C. Plasmids were extracted using a plasmid extraction kit and sequenced for verification.

[0055] Will csgBACEFG-spytag Gene targeted knock-in in Escherichia coli BW25113 codA-cynR , uvrB-ybhK , ptsG-fhuE and ydgA-uidC The site was cloned and the steps were the same as for BW25113::CsgBACEFG4, and the site was named BW25113::CsgBACEFG4-SpyTag.

[0056] Example 3 This example specifically illustrates a method for obtaining a biofilm containing fixed fusion proteins based on engineered bacteria.

[0057] The engineered bacteria were inoculated into LB medium and cultured overnight to obtain an overnight bacterial suspension (seed solution). 0.5% arabinose and 1% overnight bacterial suspension were added to M63+ minimal medium and cultured at 30°C and 90 rpm for 3-5 days to allow biofilms to adhere to 20 mm cell slides. The cultured cell slides were rinsed twice with PBS (pH 8.0) and incubated with 1 mL of filter-sterilized PET depolymerase for 12 hours. After incubation, the cell slides were washed three times with PBS (pH 8.0) to remove any unfixed enzyme.

[0058] Example 4 This example measured the biofilm biomass and adhesion to PET plastic in 96-well plates of engineered bacteria overexpressing the Curli gene cluster. The specific steps are as follows: To test biofilm formation in a 96-well plate, transfer 10 μL of overnight LB culture medium into 1 mL of M63+ minimal medium. Add 0.5% arabinose and pipette to mix thoroughly. Then, transfer 100 μL of the culture medium to a UV-sterilized 96-well cell culture plate. Six replicates were performed for each sample. The plates were sealed with parafilm and incubated in a 30°C incubator for 72 h. The suspended bacterial suspension was aspirated, and the plates were immersed in pure water. The plates were then inverted onto paper and gently blotted to remove the liquid or spun dry. This was repeated three times, followed by oven drying for 20 min. Then, 120 μL of 0.1% (w / v) crystal violet solution was added and the plates were stained at room temperature for 30 min. The crystal violet stain was then discarded and washed three times with pure water until the effluent was colorless. The plates were then oven dried for 20 min, and the staining morphology was photographed. 200 μL of 30% (v / v) acetic acid was added to each well to dissolve the crystal violet, and the absorbance at 560 nm was measured using a microplate reader.

[0059] The results are as follows Figure 1 As shown in A and C, the biofilm formation ability was assessed by crystal violet staining, which demonstrated that the strain BW25113::CsgBACEFG4-SpyTag overexpressing the Curli gene cluster exhibited significantly enhanced biofilm formation ability compared with the wild-type BW25113. Compared with BW25113::CsgBACEFG4, BW25113::CsgBACEFG4-SpyTag had reduced biofilm formation ability.

[0060] Adsorption capacity on PET plastic was determined by inoculating 1% of the overnight bacterial suspension into a 15 mL sterile vial containing 5 mL of M63+ minimal medium. A 1.5 cm × 3 cm PET film (amorphous, 0.25 mm thick) purchased from Goodfellow GmbH was placed and tilted into the medium. 0.5% arabinose was added to induce Curli nanofiber expression, and the film was incubated at 30°C and 90 rpm for 72 h. The PET film was removed, held with forceps, and gently washed three times in pure water to remove floating bacteria. The film was then dried and stained in an 8 mL vial of 0.1% (w / v) crystal violet solution for 30 min. The film was then washed three times with pure water and dried. The biofilm distribution on the surface was photographed and recorded. The crystal violet was dissolved in 3 mL of 30% acetic acid, and 200 μL of the solution was transferred to a 96-well plate. The absorbance was measured at 560 nm using a microplate reader. Three biological replicates were set up for each group.

[0061] The results are as follows Figure 1 As shown in B and C, the adhesion to the PET plastic surface was assessed by crystal violet staining. Compared with the wild-type BW25113, the strain overexpressing the Curli gene cluster, BW25113::CsgBACEFG4-SpyTag, showed significantly enhanced PET surface adhesion ability. Compared with BW25113::CsgBACEFG4, BW25113::CsgBACEFG4-SpyTag had reduced PET surface adhesion ability.

[0062] Example 5 The catalytic activity of FAST-PETase-SpyCatcher-loaded E. coli biofilm engineered bacteria on a nanoPET (NanoPET) plate was verified using the following steps: In a six-well plate, 5 mL of M63+ medium and 1% overnight bacterial suspension were added to a 25 mm poly-lysine-coated cell slide (Acmec). Biofilms were allowed to adhere to the slides. 0.5% arabinose was added to induce Curli biosynthesis. The slides were incubated at 30°C and 90 rpm for 3-5 days. The slides were removed from the medium and washed twice in wash buffer (1× PBS + 0.5% Tween-20) at 90 rpm for 20 minutes. After washing, 0.8 mL of purified FAST-PETase-SpyCatcher (enzyme activity = 1.37 U / mL) was added to the slides and incubated for 5 hours. Following incubation, the slides were washed twice with wash buffer for 20 minutes. After washing, the biofilm-attached side of the slides was placed upside down on a NanoPET plate. The plates were incubated at 37°C for 5-7 days, and the plates were observed for the formation of clearing zones.

[0063] The results are as follows Figure 2 As shown, FAST-PETase-SpyCatcher was immobilized on a Curli biofilm formed by BW25113::CsgBACEFG4-SpyTag to evaluate the degradation of PET. To make the biofilm structure more complete, a Curli biofilm containing SpyTag was first formed on a 25 mm cell slide, and then co-incubated with the purified FAST-PETase-SpyCatcher fusion protein to achieve covalent coupling of the enzyme ( Figure 2 After enzyme fixation, the biofilm cells were transferred to NanoPET plates for further culture. The results showed that a transparent degradation zone was only observed in the strain expressing the CsgA-SpyTag fusion protein (BW25113::CsgBACEFG4-SpyTag). Figure 2 Experiments showed that FAST-PETase-SpyCatcher can be effectively captured and immobilized on SpyTag-labeled biofilms, maintaining its catalytic activity and thus exerting its degradation effect.

[0064] Example 6 In this example, the reusability of the engineered strain BW25113::CsgBACEFG4-SpyTag in degrading NanoPET emulsion was determined. The specific steps are as follows: Biofilm catalytic system: 0.5% arabinose and 1% overnight bacterial suspension were added to M63+ minimal medium and cultured at 30°C and 90 rpm for 3-5 days to allow biofilms to attach to 20 mm cell slides. The cultured cell slides were rinsed twice with PBS (pH 8.0) and incubated with 1 mL of filter-sterilized plastic depolymerase for 12 hours. After incubation, the slides were washed three times with PBS (pH 8.0) to remove unbound enzyme. The washed slides were then placed in 5 mL of NanoPET (approximately 0.625 mg / mL) emulsion diluted in PB (pH 8.0) and incubated at 37°C and 90 rpm for 24 hours. The degraded emulsion was aspirated and stored at -20°C. The slides were then transferred to fresh NanoPET emulsion and the cycle repeated five times. The degraded solution was analyzed by high-performance liquid chromatography (HPLC) to measure TPA and MHET production.

[0065] Whole cell catalytic system: 0.5% arabinose and 1% overnight bacterial suspension were added to M63+ minimal medium and cultured at 30°C and 90 rpm for 2 days. The cell culture was centrifuged at 5000 rpm for 10 min and approximately 11 OD 600To the pelleted cells, 1 mL of filter-sterilized plastic depolymerase was added and incubated at 25°C and 150 rpm with shaking for 12 hours. The pellet was collected by centrifugation at 8000 rpm for 5 minutes, resuspended in PBS (pH 8.0), and washed three times by centrifugation at 8000 rpm for 5 minutes to remove unimmobilized enzyme. The washed cell pellet was resuspended in 5 mL of NanoPET (approximately 0.625 mg / mL) diluted in PBS (pH 8.0) and incubated at 37°C and 200 rpm for 24 hours. The pellet was collected by centrifugation at 8000 rpm for 10 minutes, and the entire degraded emulsion was carefully aspirated and stored at -20°C until further use. The cell pellet was then resuspended in fresh NanoPET emulsion and this cycle was repeated five times. The degraded solution was analyzed by high-performance liquid chromatography (HPLC) to measure the yields of TPA and MHET.

[0066] HPLC: The reaction mixture was centrifuged at 15,000 g for 2 min, and the supernatant was filtered through a 0.22 μm nylon membrane. The depolymerization products, terephthalic acid (TPA) and mono(2-hydroxyethyl) terephthalate (MHET), were determined by HPLC using the following parameters: a C18 column (150 × 4.6 mm, 5 μm particle size), the column temperature was maintained at 30°C in the column oven, and the UV detector wavelength was set to 240 nm. The mobile phase consisted of 20% acetonitrile, 1% formic acid, and 79% ultrapure water at a flow rate of 0.8 mL / min.

[0067] The results are as follows Figure 3 As shown in the figure, the maximum loading capacity of Curli nanofibers fused with SpyTag expressed by E. coli biofilm for FAST-PETase-SpyCatcher was evaluated. Excess FAST-PETase-SpyCatcher fusion protein was mixed with Curli nanofibers (about 0.5 OD 600 ) were co-cultured for 12 hours, and the results showed that 75% of the enzyme was successfully immobilized on the nanofibers ( Figure 3 Middle B).

[0068] The FAST-PETase-SpyCatcher-loaded biofilm catalytic system was further used to evaluate its reusability in the degradation of NanoPET. Compared with the free-floating FAST-PETase-SpyCatcher degradation, the biofilm immobilized system had a 106% catalytic activity in releasing TPA and MHET in the first round of reaction ( Figure 3 Notably, the system retained 62% of its initial activity after three cycles ( Figure 3In the fourth round of reuse, the enzyme activity dropped below 50%, indicating that the immobilization system can be stably reused for at least three times ( Figure 3 Among them, the BW25113::CsgBACEFG4-SpyTag biofilm catalytic system loaded with FAST-PETase-SpyCatcher released a total of 2.8 mM of TPA and MHET degradation products in the first three cycles, which was 2.6 times that of the free enzyme ( Figure 3 (D) significantly improved the PET degradation efficiency.

[0069] In order to simplify the application of biofilm catalytic system in PET depolymerization, this study further attempted to directly use planktonic cells to immobilize FAST-PETase-SpyCatcher. Compared with the biofilm system based on carrier (cell slide), the enzyme immobilization efficiency of this method was significantly reduced. Specifically, 1 OD 600 The planktonic cells adsorbed 0.71 U of FAST-PETase-SpyCatcher, which is 1 / 38 of the total enzyme activity immobilized by the carrier-supported biofilm system ( Figure 3 Subsequently, the planktonic cells immobilized with FAST-PETase-SpyCatcher were directly used as whole-cell catalysts for NanoPET degradation. After 12 hours of co-culture with the purified free enzyme, the planktonic cell system absorbed 97% of the enzyme ( Figure 4 Compared with free enzyme, 11 OD 600 The initial catalytic activity of the FAST-PETase-SpyCatcher-loaded planktonic cells was 80%. The system could be reused five times, and the efficiency remained above 50% of the initial enzyme activity. It is worth noting that the total release of TPA and MHET over the five times was 3.0 times that of the free enzyme, significantly improving the degradation efficiency of PET ( Figure 4 In summary, FAST-PETase-SpyCatcher immobilized in intact biofilms not only has higher degradation efficiency but also exhibits good stability and reusability, which is superior to traditional free enzyme systems.

[0070] Example 7 The E. coli biofilm engineered bacteria loaded with FAST-PETase-SpyCatcher promote the degradation of PET film. The specific operation steps are as follows: 1% of the overnight bacterial suspension was inoculated into 5 mL of M63+ minimal medium, and approximately 0.14 g of a 1.5 cm × 3 cm PET film and 1% arabinose were added for 2–4 days to induce biofilm formation on the PET surface. The PET film was then removed and placed in 55 mL of 100 mM KH2PO4-NaOH (pH 8.0) buffer, supplemented with 0.17 mL (1.62 mg / mL) of purified FAST-PETase-SpyCatcher. The cells were incubated at 25°C and 60 rpm for 12 hours. To promote enzymatic depolymerization of PET, the culture conditions were increased to 50°C and 90 rpm. The degraded solution was then analyzed by high-performance liquid chromatography (HPLC) to determine the yields of TPA and MHET.

[0071] To determine the biomass of biofilm attached to the PET surface, 1% of the overnight bacterial solution was inoculated into a six-well plate containing 5 mL of M63+ minimal medium. The remaining steps were the same as those for determining the adsorption capacity of plastic PET in Example 4.

[0072] The results are as follows Figure 5 As shown, in order to explore the mechanism of biofilm in enhancing the degradation of PET film, this study designed an enzyme immobilization system based on Curli nanofibers. First, the PET film was placed in an engineered strain culture medium and cultured for 2 days to induce the stable formation of a biofilm on its surface. Subsequently, the FAST-PETase-SpyCatcher fusion enzyme was added to the system, and the SpyTag / SpyCatcher covalent coupling system was used to achieve directional anchoring of the enzyme on the biofilm. In order to optimize the catalytic activity of the enzyme, the reaction temperature was set to 50°C. Judging from the dual results of SEM imaging and the release of PET degradation products, the treatment group with biofilm formation on the surface showed a rougher PET surface structure and had significantly enhanced degradation traces compared to the free enzyme group ( Figure 5 In addition, during the 36-hour reaction, the total amount of TPA and MHET released was 2.5 times that of the free enzyme ( Figure 5 (B) shows that the biofilm can effectively enrich and immobilize enzyme molecules in the solution, significantly accelerating the depolymerization rate of PET by increasing the local enzyme concentration.

[0073] To further explore the effect of biofilm thickness on degradation, we compared the degradation performance of biofilms of different thicknesses after 2 and 4 days of culture. The thickness of the biofilm formed after 4 days of culture was significantly increased ( Figure 5 The biomass attached to the PET surface was 1.9 times that of the 2-day group ( Figure 5 However, the total amount of TPA and MHET released in the 4-day group decreased by 70% compared with the 2-day group ( Figure 5(B in the middle) suggests that excessively thick biofilms may form a physical barrier, limiting effective contact between the enzyme and the substrate surface. Experimental results indicate that a moderate biofilm structure enhances the enzyme-PET interface and significantly improves catalytic efficiency, while excessive biofilm growth restricts enzyme access to the PET surface. This study reveals a nonlinear relationship between biofilm thickness and enzymatic degradation efficiency. The dual function of biofilms in enzyme immobilization and substrate interface regulation provides strong strategic support and theoretical foundation for further improving the efficiency of enzymatic PET depolymerization.

Claims

1. A method for enhancing the enzymatic degradation ability of PET plastic using biofilm, characterized in that: The method comprises: Using Escherichia coli as the host bacteria, a gene cluster overexpressing Curli was constructed csgBACEFG The engineered bacteria, the gene cluster csgBACEFG Fusion SpyTag; Construct a fusion protein of PET degrading enzyme and SpyCatcher; immobilizing the fusion protein on the biofilm formed by fermentation of the engineered bacteria; Utilize fusion proteins fixed on biofilm to degrade PET plastic.

2. The method according to claim 1, characterized in that The engineering bacteria are constructed by inserting an arabinose-inducible promoter and csgBACEFG-spytag The recombinant operon constructed was integrated into multiple sites of the Escherichia coli host genome to obtain overexpression csgBACEFG Engineered bacteria; described csgBACEFG-spytag For connection spytag genetic csgBACEFG gene cluster.

3. The method according to claim 1 or 2, characterized in that The gene cluster csgBACEFG Derived from Escherichia coli K12 series strains.

4. The method according to claim 2, characterized in that The recombinant operon is integrated into the host bacterial genome using the CASTs system.

5. The method according to claim 1 or 2, characterized in that The host bacteria is Escherichia coli BW25113.

6. The method according to claim 5, characterized in that The recombinant operon is integrated into the Escherichia coli genome codA-cynR , uvrB-ybhK , ptsG-fhuE and ydgA-uidC Location.

7. The method according to claim 1, characterized in that The bacterial liquid of the engineered bacteria is added to a culture medium to induce the biosynthesis of Curli, thereby forming a biofilm containing SpyTag. The fusion protein is co-incubated with the biofilm containing SpyTag to obtain a biofilm with fixed fusion protein.

8. The method according to claim 7, characterized in that The bacterial liquid of the engineered bacteria is added to a culture medium containing a carrier to induce the biosynthesis of Curli, so that the biofilm is attached to the carrier; and the carrier attached with the biofilm is co-incubated with the fusion protein.

9. The method according to claim 8, characterized in that The carrier is a film-shaped PET plastic to be degraded, or a cell climbing sheet.

10. The method according to claim 1, characterized in that The PET degrading enzyme is FAST-PETase.

Images