Chimera reverse transcription primer and application thereof in precise gene editing

Abstract

The invention discloses a chimera reverse transcription primer and application thereof in precise gene editing, the synthesized chimera primer, namely an RNA: DNA chimera containing sgRNA and a DNA sequence on a 5 '-end 20bp homologous recombination template (HDR), is taken as a template, RNA formed by in vitro transcription of HDR is taken as a template, a round of reverse transcription is performed, and finally a covalent RNA: DNA chimera is formed. The chimeric compound and CRISPR / Cas9 protein form an RNP compound for editing mammalian cell genes under the cooperation of anionic polymer polyglutamic acid, so that the electrotransfection efficiency, the cell viability and the RNP nucleation efficiency can be remarkably improved, and accurate and efficient editing of genome DNA is finally realized; the method has high practical value for improving the gene editing rate of mammalian cells.

Description

Technical Field

[0001] The present invention relates to the field of gene editing technology, and specifically to chimeric reverse transcription primers and their application in precise gene editing. Background Art

[0002] Gene editing technology is a revolutionary breakthrough in the life sciences, and its development reflects humanity's ever-increasing ability to manipulate genes. Since Jennifer Doudna and Emmanuelle Charpentier's teams first demonstrated in 2012 that the CRISPR / Cas9 system could cleave specific DNA sequences in vitro, highlighting its potential as a gene editing tool, Zhang Feng's team successfully applied CRISPR / Cas9 for gene editing in mammalian cells in 2013, marking a leap toward practical application. Since its inception, CRISPR / Cas technology has evolved from a basic scientific tool into a revolutionary, interdisciplinary platform. Its low-cost and high-efficiency advantages have driven changes in biomedicine, agriculture, and industry. Despite challenges such as off-target effects, delivery challenges, and ethical concerns, continued technological advancements (such as precise editing tools and novel delivery systems) and collaborative global governance have the potential to enable safer and more widespread applications in the future, providing key solutions for human health, food security, and sustainable development.

[0003] CRISPR / Cas is a gene editing tool based on the bacterial innate immune system, which targets and cuts specific DNA sequences through RNA-guided nucleases. The in vivo and in vitro delivery of CRISPR systems is a key bottleneck for clinical application. Existing CRISPR delivery systems include: 1) Viral vectors, including adeno-associated virus (AAV) and lentivirus (LV), have advantages in high transduction efficiency and long-term expression, but have shortcomings in immunogenicity and vector capacity (AAV is only ~4.7kb); 2) Non-viral vectors, including lipid nanoparticles (LNPs) and gold nanoparticles, have the advantages of low immunogenicity and large-scale production, but also have the disadvantages of poor in vivo targeting and cytotoxicity; 3) Physical methods, including electroporation and microinjection, can deliver directly and are suitable for in vitro cells, but they are highly damaging to tissues and difficult to use in vivo; Biological vectors, such as exosomes and engineered bacteria, have natural targeting properties and can penetrate biological barriers, but they suffer from low loading efficiency and complex preparation. Beyond delivery, achieving precise repair of target genes while minimizing unnecessary off-target effects is another key challenge facing the CRISPR / Cas system. Existing methods for precise gene editing primarily involve exogenously providing gene editing templates so that the cleaved site is repaired to the target gene according to the predetermined template during homologous recombination repair. However, if the target gene is deleted or the inserted fragment is too large, delivering the target fragment becomes challenging. Fragments larger than 1000 bp are typically delivered using viral vectors. While this significantly increases the efficiency of target fragment introduction, it also creates uncontrollable genetic risks. Furthermore, compared to double-stranded DNA homologous repair templates, single-stranded DNA templates can activate less apoptotic pathways and provide greater gene editing efficiency. Based on this, the present invention uses a partial nucleotide sequence of a guide RNA sequence used to direct Cas9 binding to the target DNA sequence and a DNA template for homologous recombination repair (a Cas9 recognition sequence containing four amino-terminal mutations and a PAM structure is added to both ends of the homologous recombination template). A chimeric primer is synthesized in vitro using chemical synthesis methods to combine the guide RNA and the nucleotide sequence containing a 23-bp DNA homologous recombination template. This primer is used for a single round of reverse transcription, and the RNA bound to the cDNA is digested to produce a guide RNA and a single-stranded homologous recombination template. Simultaneously, the anionic polymer PGA is incubated with the Cas9 protein of the CRISPR / Cas system, the guide RNA generated by in vitro reverse transcription, and the single-stranded homologous recombination template. Because the Cas9 protein recognizes the Cas9 recognition sequences at both ends of the homologous recombination site, but the recognition sequences contain mutations that prevent them from cleaving the target sequence, the CRISPR / Cas system's RNP forms a complex in vitro. Under the guidance of the nuclear localization sequence contained in the Cas9 protein, the complex can be efficiently and accurately positioned next to the genome we want to target, thereby achieving efficient and accurate editing of the target gene. The present invention greatly improves the efficiency of gene editing, effectively reduces the off-target rate, and reduces cytotoxicity. + Take T cells as an example. Summary of the Invention

[0004] The present invention provides chimeric reverse transcription primers and their application in precise gene editing, which solve the defects of low editing rate, cytotoxicity and off-target of existing precise gene technologies, and provide a better solution for editing difficult-to-transduce cells.

[0005] In view of this, the solution of the present invention is: The first aspect of the present invention is to propose a chimeric reverse transcription primer, comprising two primers, sgRNA3:ssHDR3 and sgRNA7:ssHDR7, wherein the sgRNA3 and sgRNA7 target the nucleotide sequences shown in SEQ ID NOs. 1 and 2, respectively, and the corresponding nucleotide sequences of ssHDR3 and ssHDR7 are shown in SEQ ID NOs. 5 and 6, respectively.

[0006] Furthermore, the nucleotide sequence of sgRNA3 is shown as SEQ ID NO.3; and / or, the nucleotide sequence of sgRNA7 is shown as SEQ ID NO.4.

[0007] The second aspect of the present invention is to propose RNA:DNA chimeras, including sgRNA3:ssHDR3 chimeras and sgRNA7:ssHDR7 chimeras, which are obtained by reverse transcription using the chimera reverse transcription primers described in the first aspect with HDR3 and HDR7 as templates, and digesting the bound RNA, wherein the HDR3 and HDR7 contain a CTS sequence and a PAM sequence, respectively.

[0008] Furthermore, the HDR3 and HDR7 are transcribed from homologous repair templates having nucleotide sequences as shown in SEQ ID NO. 7 and 8, respectively.

[0009] The third aspect of the present invention is to provide an RNP complex, which is obtained by incubating the RNA:DNA chimera described in the second aspect with Cas9 protein through PGA.

[0010] Furthermore, the PGA concentration is 100 mg / ml.

[0011] The fourth aspect of the present invention is to provide mammalian cells transfected with the RNP complex described in the third aspect.

[0012] The fifth aspect of the present invention is to propose the application of the RNP complex described in the third aspect in mammalian cell gene editing.

[0013] Preferably, the mammalian cells are human cells, including but not limited to hematopoietic stem cells, immune cells, etc., more preferably CD4 + T cells.

[0014] The sixth aspect of the present invention is to provide an efficient CD34 + The precise editing method of the hematopoietic stem cell CCR5△32 / △32 gene is to use the RNP complex described in the third aspect to electroporate the wild-type CCR5 gene to CD34 + In hematopoietic stem cells, the CD34 +Hematopoietic stem cells were electroporated and then cultured to obtain a large number of CD34 cells with CCR5△32 / △32 genotype that can be used for clinical transplantation. + Hematopoietic stem cells.

[0015] The seventh aspect of the present invention is that the CD34 of CCR5△32 / △32 genotype + Application of hematopoietic stem cells in the preparation of HIV-1 therapeutic drugs, the CCR5△32 / △32 genotype CD34 + The hematopoietic stem cells are obtained by the method described in the sixth aspect.

[0016] Compared with the prior art, the present invention has the following beneficial effects: The chimeric reverse transcription primer of the present invention can bind to Cas9 but will not cut the exogenous chimera sequence by adding a 20nt recognition sequence of Cas9 protein containing 4 nucleotide mutations at the 5' end and a Cas9 CTS with a PAM structure at both ends of ssHDR, which is beneficial to improving the accuracy of targeted gene cutting and repair in stem cell gene editing.

[0017] The RNP complex described in this invention combines Cas9 with a nuclear localization sequence, a homologous recombination template, and sgRNA in an appropriate ratio with the assistance of PGA to form a compact nanocomplex. This encapsulates the Cas9 protein, sgRNA, or ribonucleoprotein complex (RNP), preventing degradation by serum nucleases and prolonging circulation in vivo. PGA nanoparticles enhance cell membrane penetration through surface charge modification, particularly in difficult-to-transfect primary cells or stem cells, thereby improving the accuracy of targeted gene cutting and repair and the activity of the final hematopoietic stem cell product.

[0018] The gene editing method of the present invention utilizes an exogenously introduced RNP complex containing Cas9 protein and guide RNA and a CCR5△32-deficient CCR5 sequence as a homologous repair template (HDR) to obtain precise and efficient CCR5△32 gene-edited CD34 + Hematopoietic stem cells. Homologous repair templates contain the Cas9 protein target sequence and the PAM sequence recognized by Cas9 at both ends. Adding Cas9 recognition sequences to both ends of the HDR can enhance the binding of the Cas9 protein, thereby enhancing the formation of stable RNP complex nanoparticles with the help of PGA. This improves electroporation efficiency, cell viability, and RNP nuclear entry, ultimately achieving precise and efficient deletion of the 32bp CCR5 mutation. This has significant application value in increasing the editing rate of hematopoietic stem cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1Schematic diagram of the in vitro assembled guide RNA (sgRNA) and the single-stranded (ssHDR) homologous recombination template chimera containing Cas9 recognition sequences at both ends described in Example 1 of the present invention.

[0020] Figure 2 Schematic diagram of the double-stranded (dsHDR) homologous recombination template and dual-target mediated CCR5 gene editing described in Example 1 of the present invention.

[0021] Figure 3 This is a gel electrophoresis diagram of the double-stranded (dHDR) homologous recombination template and sgRNA:ssHDR chimera in Example 1 of the present invention.

[0022] Figure 4 This is the mixed sequencing map of the chimera gene modification efficiency in Example 1 of the present invention.

[0023] Figure 5 This is the CCR5△32 gene map of the monoclonal sequencing in Example 1 of the present invention.

[0024] Figure 6 This is the sequencing map after gene editing in Example 2 of the present invention.

[0025] Figure 7 This is the sequencing map after gene editing in Example 3 of the present invention. DETAILED DESCRIPTION

[0026] The technical solutions of the present invention will be clearly and completely described below in conjunction with preferred embodiments. Obviously, the embodiments described are only some embodiments of the present invention, not all embodiments. All other embodiments obtained by ordinary technicians in this field based on the embodiments of the present invention without making any creative efforts shall fall within the scope of protection of the present invention.

[0027] Explanation of terms

[0028] Cas protein: an effector protein with nuclease activity (such as Cas9, Cas12a) that is responsible for cutting DNA.

[0029] sgRNA: single guide RNA, a key component of the CRISPR-Cas9 gene editing system, achieves precise gene editing by guiding the Cas9 protein to target specific DNA sequences.

[0030] HDR: Homology directed repair, homology-mediated double-stranded DNA repair sequence.

[0031] ssHDR: single strand homology directed repair, single strand homology repair sequence.

[0032] sgRNA:ssHDR: The sequence formed by the end-to-end fusion of the 3' end of sgRNA and the 5' end of ssHDR.

[0033] CTS: Cas9 target sequence, Cas9 target sequence.

[0034] PAM: Protospacer Adjacent Motif, a sequence adjacent to the original spacer, is 3-4 nucleotides long and is used by Cas9 protein to recognize complementary exogenous DNA and form an RNP complex.

[0035] PGA: Poly-L-glutamic acid.

[0036] MCTS, mutant Cas9 target sequence, the target sequence of the Cas9 protein in the CRISPR / Cas9 system that has undergone mutation modification.

[0037] RNP: Ribonucleoprotein complex, a complex formed by specific proteins and specific RNA.

[0038] In one embodiment, the CD34 expression of hematopoietic stem cells is increased by optimizing the delivery system. + To improve cellular gene editing rates, an RNA:DNA chimera fragment containing sgRNA, crRNA, and a 20-nt ssHDR sequence was chemically synthesized. This fragment was used as a primer for reverse transcription, and a single round of reverse transcription was performed using in vitro-transcribed HDR3 and HDR7 RNAs as templates. After the reaction, the bound RNA was digested with RNase H to produce a single-stranded RNA:DNA chimera. MCTS sequences containing nucleotide mutations and a PAM sequence recognized by Cas9 were added to both ends of the ssHDR, and the ssHDR was linked to the sgRNA in vitro. The MCTS sequence binds to the Cas9 protein, enhancing the formation of a stable RNP complex nanoparticle with the help of PGA, and its efficient nuclear entry. This improves electroporation efficiency, cell viability, and precise and efficient deletion of the 32-bp CCR5 mutation.

[0039] In another embodiment, a method for efficiently producing CCR5Δ32 is provided, comprising the following steps: The ssHDR construct, containing an RNP complex containing Cas9 protein and sgRNA, along with a single-stranded CCR5 sequence that represents the CCR5△32 deletion, is used to precisely and efficiently generate cells with the CCR5△32 / △32 genotype. The ssHDR construct contains the Cas9 protein target sequence and the PAM sequence recognized by Cas9 at both ends. The addition of the Cas9 recognition sequence to the HDR enhances the formation of stable RNP complexes with the help of poly-PGA by binding to the Cas9 protein without cleaving the template. This improves the efficiency of electroporation into nuclei and ultimately achieves precise and efficient CCR5 32bp deletion.

[0040] The cells based on the above method specifically refer to a type of cells that have been precisely and efficiently transformed with the CCR5△32 / △32 genotype by exogenously transferring the RNP complex containing Cas9 protein and sgRNA and ssHDR, such as CD34 + Hematopoietic stem cells; in the above embodiment, the hematopoietic stem cells of the CCR5△32 / △32 genotype and their RNP complexes or nanoparticles can be used to prepare AIDS therapeutic drugs.

[0041] Example 1

[0042] In this example, a single-stranded DNA template containing a Cas9 recognition sequence and a PAM sequence and an sgRNA chimera were assembled in vitro, and then fully incubated with Cas9 with the help of PGA to form a nanocomplex. After electroporation, the template efficiently enters the nucleus under the guidance of the nuclear localization sequence (NLS), thereby improving the efficiency of gene editing and cell viability.

[0043] like Figure 1 As shown, we designed two guide RNAs, namely sgRNA3 and sgRNA7, on the negative strand of the sequence to be deleted. Two sgRNAs targeting the CCR5 gene and chimeric primers containing MCTS with four mutant bases at the N-terminus and ssDNA with PAM sequences, namely primer 3 and primer 7, were synthesized by chemical synthesis. Using the in vitro transcribed RNA of HDR3 and HDR7 as a template, one round of reverse transcription reaction was performed using primer 3 and primer 7. After the reaction, the bound RNA was digested with RNase H to obtain sgRNA3:ssHDR3 and sgRNA7:ssHDR7 chimeras at a concentration of 80mM. The schematic diagram of the above double-stranded (dsHDR) homologous recombination template and dual-target mediated CCR5 gene editing is shown in Figure 2. Figure 2 shown.

[0044] The target or template sequences involved are as follows: Target 3 (sgRNA3 targeting sequence): (SEQ ID NO.1) CAGAATTGATACTGACTGTATGG Target 7 (sgRNA7 targeting sequence): (SEQ ID NO. 2) AAGATGACTATCTTTAATGTCTGG sgRNA3 (SEQ ID NO. 3): CAGAAUUGAUACUGACUGUAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC sgRNA7 (SEQ ID NO. 4): AGAUGACUAUCUUUAAGUCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC ssHDR3 (SEQ ID NO.5): AGTGATTGATACTGACTGTA ssHDR7 (SEQ ID NO.6): GTGCGACTATCTTTAATGTC HDR3 (SEQ ID NO. 7): CAGAATTGATACTGACTGTATGG CCATACAGTCAGTATC AATTCTG HDR7(SEQ ID NO.8) CAGAGACTATCTTTAATGTCTGG CCAGACATTAAAGATA GTCTCTG The underlined parts in the above HDR3 and HDR7 are CTS and PAM, and the PAM sequence is TGG.

[0045] The method for assembling an sgRNA:ssHDR chimera in vitro comprises the following steps: 1. Based on the above targets, two sequences containing sgRNA and ssHDR were synthesized by chemical synthesis. ssHDR is an ssDNA with MCTS and PAM sequences mutated at the N-terminus for 4 bases, resulting in sgRNA3:ssHDR3 (Primer 3) and sgRNA7:ssHDR7 (Primer 7).

[0046] Their sequence is as follows: Primer of sgRNA-DNA chimera sequence: sgRNA3:ssHDR3 (Primer 3): CAGAAUUGAUACUGACUGUAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAA CUUGAAAAGUGGCACCGAGUCCGGUGCUUUUUU AGTGATTGATACTGACTGTA primer of sgRNA7:ssHDR7 (Primer 7): AGAUGACUAUCUUUAAUGUCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAA CUUGAAAAGUGGCACCGAGUCCGGUGCUUUUUU GTGCGACTATCTTTAATGTC The underlined portion is the sgRNA sequence, followed by a partial ssHDR sequence containing 20 nt MCTS and PAM.

[0047] 2. Using HDR3 and HDR7 containing CTS and PAM as templates, synthesize T7 in vitro transcription templates through one round of PCR. Transcribe the synthesized product into RNA using a T7 in vitro transcription kit.

[0048] 1) In vitro transcription template synthesis

[0049] a. Configure the PCR reaction system:

[0050] b. Perform PCR according to the following settings:

[0051] c. Add 10 μL of 6x loading buffer to the PCR product, mix thoroughly, and then load onto an agarose gel. After electrophoresis at 180V for 20 minutes, excise a 900 bp band using a blue light gel exciter. Add an appropriate amount of Binding Buffer (1 ml per 1 g of gel) and heat in a 55-60°C water bath for 7-10 minutes until the gel is completely dissolved, gently shaking every 2-3 minutes. Observe the color of the solution. If it turns purple or red, adjust the pH by adding 5 μL of 5M NaAc (pH 5.2). Transfer the dissolved DNA / gel mixture to a HiBind DNA column and centrifuge at 10,000xg for 1 minute. Discard the filtrate, add 300 μL of Binding Buffer, centrifuge again for 1 minute, then add 700 μL of SPW Wash Buffer diluted in anhydrous ethanol, centrifuge for 1 minute, and repeat this wash step once more. Finally, spin the column for 2 minutes to dry the matrix. Transfer the column to a clean 1.5 ml centrifuge tube and add 30-50 µl of Elution Buffer preheated to 65°C. After standing for 2 minutes, centrifuge at 13,000 x g for 2 minutes to collect the eluted DNA and measure its concentration.

[0052] 2) In vitro transcription

[0053] a. Configure the in vitro transcription reaction system:

[0054] b. Mix the in vitro transcription system thoroughly and incubate at 37°C for 4 hours (the incubation time can be extended to maximize RNA yield). c. After incubation, add 1 μL of TURBO DNase to the system, mix thoroughly, and incubate at 37°C for 30 minutes. d. Add 42 μL (2 times the volume) of RNA Binding Buffer to the digested in vitro transcription mixture. Mix thoroughly and add an equal volume of anhydrous ethanol (3 times the volume of the in vitro transcription mixture). Add the mixture to a CR purification column, centrifuge, and remove the filtrate. Wash once with RNA pre-wash solution and twice with RNA wash solution. After evacuation, air dry for five minutes to ensure that no ethanol residue is present. Add an appropriate amount of enzyme-free water, incubate at room temperature for five minutes, then centrifuge and elute. Measure the concentration.

[0055] 3. Use primers primer3 and primer7 in step 1 to perform a round of reverse transcription reaction on the HDR3 and HDR7 RNA templates generated in step 2. After the reaction, use RNase H to digest the bound RNA to obtain RNA:DNA chimera.

[0056] 1) Prepare reverse transcription mixture

[0057] The above system was mixed and heated at 65°C for 5 minutes, and then placed in an ice bath for 2 minutes.

[0058] 2) Add the following reagents to the mixture after ice bath

[0059] 3) Set up a temperature gradient for reverse transcription

[0060] 4) RNase H digestion

[0061] The reverse transcription product was denatured at 98°C for 5 minutes and then annealed to 25°C at 0.1°C / s. 3 μL RNaseH Reaction Buffer and 2 μL RNaseH were added to the annealed product and the volume was filled up to 30 μL with water. The mixture was mixed and incubated at 37°C for 1 hour.

[0062] 5) sgRNA:ssHDR chimera recovery

[0063] a. Add 90 μL (1:3 volume ratio) of RNA Cleanup XP magnetic beads to the digested reaction solution and let it stand for 30 minutes to allow the beads to fully absorb the single-stranded DNA template. b. Place the centrifuge tube on a magnetic separation rack and let it sit for 5 minutes until the solution is clear. Carefully remove and discard the supernatant, taking care not to disturb the magnetic beads. c. While the tube is still on the magnetic separation rack, add 1 mL of freshly prepared 75% anhydrous ethanol to the beads. Mix gently and let stand for another minute. Carefully remove and discard the wash buffer. Repeat this step two more times. d. After removing the wash solution, open the tube cap and air-dry the magnetic beads on a magnetic separation rack for 2-5 minutes. Be careful not to over-dry, as this may affect the recovery rate. e. Add an appropriate volume of enzyme-free water to the magnetic beads. Gently mix, remove the tube from the magnetic separation rack, and let it sit at room temperature for 5 minutes to maximize the elution of single-stranded DNA. Return the tube to the magnetic separation rack and let it sit for 5 minutes. Carefully remove the supernatant, which is the purified single-stranded HDR template.

[0064] A pair of identification primers for identifying genomic modification is designed, wherein the sequence of the upstream primer or downstream primer is located downstream of the genomic location of the HDR3' end we selected, so that one end of the primer falls on the chromosome, which can eliminate the interference of amplification of our exogenous HDR template. The double-stranded HDR and sgRNA:sDNA chimera used in the present invention are shown in the gel electrophoresis diagram. Figure 3 The chimera gene modification efficiency mixed sample sequencing map is shown as Figure 4 shown.

[0065] 4.CD4 + T cell electroporation process

[0066] 1x10 6 CD4 + Taking the T cell electroporation system as an example, the materials and specific steps required are as follows: 10 μg / ul of Cas9 protein (#632678, Takara), 100 mg / ml of PGA (#P4761, Sigma Aldrich) with a molecular weight of 15,000-50,000. Electroporation was performed using a Celetrix (CTX-1500A LE+) electroporation system and Celetrix electroporation buffer (#13-01095).

[0067] 1) PGA, sgRNA3:ssHDR3+mCTS chimera, sgRNA7:ssHDR7+mCTS chimera and Cas9 were mixed at a ratio of 0.8:1:1:1 and placed in a 37°C water bath for 15 minutes. 6 CD4 in logarithmic growth phase + T cells were washed once with PBS, centrifuged at 1000g for 3 minutes, and resuspended in 18 μL of electroporation buffer (9 μL A + 9 μL B) and placed in an incubator until ready to use. After 15 minutes, the PGA:sgRNA:ssHDR:Cas9 mixture was removed. Immediately after the water bath, the cells, which had been pre-existing in electroporation buffer, were transferred to the RNP complex. After gentle mixing, the cells were immediately added to a 20 μL electroporation cuvette and electroporated at 1350 V using the PBMC mode. After electroporation, the cells were quickly resuspended in DMEM containing 15% FBS and no dual antibody (P+S) and cultured overnight. The next day, the cell culture medium was replaced with DMEM containing 1% P+S dual antibody and 15% FBS, and cultured for another 24 hours.

[0068] 2) The amplified fragment is connected to a T vector and transformed into E. coli to obtain a single clone. This chimera is used to obtain gene-modified cells with high cell viability and a relatively single modified genotype. The CCR5△32 gene map is obtained by single clone sequencing. Figure 5 shown.

[0069] Table 1: Chimera gene modification efficiency and cell viability

[0070] Example 2

[0071] By assembling a chimera of single-stranded DNA and sgRNA in vitro and fully incubating it with Cas9 with the help of PGA to form a nanocomplex, the chimera is introduced into the nucleus under the guidance of the nuclear localization sequence (NLS) after electroporation, thereby improving the efficiency of gene editing and cell viability. The specific steps are as follows: Two chimeric primers for sgRNA targeting the CCR5 gene and ssDNA of the homologous recombination template are synthesized, respectively, as in Example 1, and named target 3-1 (sgRNA3:ssHDR3) and target 7-1 (sgRNA7:ssHDR7). These primers are used as primers for reverse transcription to obtain sgRNA3:ssHDR3-1 and sgRNA7:ssHDR7-1 chimeras at a concentration of 80mM.

[0072] The assembled chimeras sgRNA3:ssHDR3-1 and sgRNA7:ssHDR7-1 were combined with PGA and Cas9 in the ratios described in Example 1 to form nanoparticles in vitro and electroporated onto CD4 + In T cells, these steps are the same as in Example 1. Finally, the gene editing efficiency of the target cells is tested as shown in Table 2. The sequencing map after gene editing containing only sgRNA without HDR is as follows Figure 6 shown.

[0073] Table 2: Dual-target gene modification efficiency and cell viability

[0074] Example 3

[0075] In this example, HDR was adjusted to a double-stranded DNA template (dsHDR), and the 5' end of the dsHDR also contained a cas9 recognition sequence with four nucleotide mutations, namely MCTS (the dsHDR sequence was the same as in Example 1, but it was double-stranded). Two sgRNAs were commercially synthesized separately, and the sequences of the sgRNAs were the same as in Example 1. PGA was incubated with the two sgRNAs and Cas9 proteins in a 37°C water bath in proportion for 15 minutes, and then dsHDR was added and electroporated at a high-frequency voltage of 1350V. Immediately after completion, the cells were cultured in culture medium. The mixed sample efficiency obtained by sequencing a portion of the cells after electrotransfection is shown in Table 3, and the sequencing map after gene editing is shown in Table 3. Figure 7 shown.

[0076] Table 3:

[0077] Example 4

[0078] A single-stranded DNA template containing the Cas9 recognition sequence and PAM sequence and sgRNA chimera were assembled in vitro. Except for PGA, the remaining procedures were the same as in Example 1. After electroporation at 1350V, a portion of the cell lysate was collected, the genome was extracted, the target gene was amplified, and the sequencing was performed by the company. Gene modification efficiency and cell viability are shown in Table 4.

[0079] Table 4:

[0080] In addition, we tested the off-target rates of the chimera editing method and double-stranded templates and other RNPs without PGA involved in the present invention, and found that the off-target rate was 0.10% after the ssHDR containing mCTS at both ends and sgRNA formed a complex with the Cas9 protein in the presence of PGA, which was significantly lower than other combinations such as dsHDR (0.13%) and ssHDR without PGA (0.12%).

[0081] The above four examples show that the in vitro assembly of sgRNA and ssHDR containing mCTS chimera and incubation with PGA to form a complex significantly increased the editing rate of target genes and cell viability while maintaining a low off-target rate. + Highly efficient generation of Δ32 CCR5-type mutations in T cells.

[0082] While embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions, and variations may be made to these embodiments without departing from the principles and spirit of the invention, and that the scope of the invention is defined by the appended claims and their equivalents.

Claims

1. A chimeric reverse transcription primer, characterized in that It comprises two primers, sgRNA3:ssHDR3 and sgRNA7:ssHDR7, wherein the sgRNA3 and sgRNA7 target the nucleotide sequences shown in SEQ ID NO.1 and 2, respectively, and the nucleotide sequences corresponding to the ssHDR3 and ssHDR7 are shown in SEQ ID NO.5 and 6, respectively.

2. The chimeric reverse transcription primer according to claim 1, characterized in that The nucleotide sequence of sgRNA3 is shown as SEQ ID NO.3; and / or the nucleotide sequence of sgRNA7 is shown as SEQ ID NO.

4.

3. RNA:DNA chimera, characterized in that The method comprises an sgRNA3:ssHDR3 chimera and an sgRNA7:ssHDR7 chimera, which are respectively reverse transcribed using the chimera reverse transcription primer of claim 1 with HDR3 and HDR7 as templates, and the bound RNA is digested, wherein the HDR3 and HDR7 respectively contain a CTS sequence and a PAM sequence.

4. The RNA:DNA chimera according to claim 3, characterized in that The HDR3 and HDR7 are transcribed from homologous repair templates with nucleotide sequences as shown in SEQ ID NO. 7 and 8, respectively.

5. RNP complex, characterized in that The RNA:DNA chimera according to claim 3 is obtained by incubating the Cas9 protein with PGA.

6. The RNP complex according to claim 5, characterized in that The PGA concentration was 100 mg / ml.

7. A mammalian cell transfected with the RNP complex according to claim 5 or 6.

8. Use of the RNP complex according to claim 5 or 6 in mammalian cell gene editing.

9. A CD34 + A method for precise editing of the CCR5△32 / △32 gene in hematopoietic stem cells, characterized in that: The RNP complex according to claim 5 or 6 is electroporated into CD34 cells expressing wild-type CCR5 gene. + In hematopoietic stem cells, or the CD34 of claim 7 + Hematopoietic stem cells were electroporated and then cultured to obtain CCR5△32 / △32 genotype CD34 cells that can be used for clinical transplantation. + Hematopoietic stem cells. 10.CCR5△32 / △32 genotype CD34 + Application of hematopoietic stem cells in the preparation of HIV-1 therapeutic drugs, the CCR5△32 / △32 genotype CD4 + The hematopoietic cells are obtained by the method according to claim 9.

Images