Dendrobium chinense bibenzyl synthetase DsBBS2 promoter and application thereof

Abstract

The invention discloses a promoter of dendrobium huoshanense bibenzyl synthetase DsBBS2. The nucleotide sequence of the DsBBS2 promoter is as shown in any one of SEQ ID NO: 1 to SEQ ID NO: 6. The DsBBS2 promoter is a promoter sequence of dendrobium huoshanense bibenzyl synthetase and can effectively drive expression of an exogenous gene in plant leaves, the invention further provides a method for driving expression of the exogenous gene in a transgenic plant on the basis of the DsBBS2 promoter, the transgenic plant is constructed by using a biological material containing the promoter DsBBS2, and the transgenic plant is constructed by using a biological material containing the promoter DsBBS2. And then DsBBS is used for driving the expression of an exogenous gene.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and in particular to a Dendrobium sinensis bibenzyl synthase DsBBS2 promoter and application thereof. Background Art

[0002] With approximately 30,000 species, the Orchidaceae family is the most species-rich group of flowering plants, possessing both high ornamental and medicinal value. Among the Orchidaceae, Dendrobium plants are an important group of traditional Chinese medicinal plants, with a long history of medicinal use and significant pharmacological activity in China and Southeast Asia. Dendrobium plants are rich in a variety of bioactive ingredients, primarily phenolic compounds, polysaccharides, alkaloids, bibenzyl derivatives, and flavonoids. These active ingredients exhibit multiple pharmacological effects, including anti-aging, antibacterial, antioxidant, and anti-tumor activities.

[0003] Dendrobium sinense, a species of the genus Dendrobium, is endemic to Hainan, growing exclusively in tropical mountain rainforests and alpine dwarf forests above 1,000 meters above sea level in central and western Hainan, including Baoting, Ledong, Baisha, and Qiongzhong. As a traditional Li medicine, Dendrobium sinense possesses significant medicinal value due to its unique secondary metabolites.

[0004] Promoters are crucial components in regulating gene expression in plants. They contain binding sites for various transcription factors and regulate the efficiency and specificity of transcription. Based on their source, promoters can be categorized as exogenous or endogenous. Exogenous promoters can heterologously regulate gene expression, but they often raise safety concerns when producing transgenic materials, particularly with commonly used viral promoters, such as the tobacco mosaic virus 35S promoter. Furthermore, using the same promoter within the same transgenic event can lead to transgene silencing. Therefore, endogenous promoters are preferred for producing transgenic materials. Based on their expression characteristics, promoters are categorized as constitutive, tissue-specific, and inducible. Constitutive promoters regulate expression unaffected by tissue specificity, temporal or spatial variations, and so on. In the production of some transgenic materials, gene expression driven by constitutive promoters can be more stable.

[0005] Currently, research on promoters of Dendrobium sinensis is in its preliminary stages, especially on the promoters of key genes related to the synthesis of secondary metabolites. Summary of the Invention

[0006] The purpose of the present invention is to overcome the above-mentioned deficiencies in the prior art and to provide a Dendrobium sphenanthellum bibenzyl synthase DsBBS2 promoter and its application.

[0007] The first object of the present invention is to provide a Dendrobium sphenanthellum bibenzyl synthase DsBBS2 promoter.

[0008] The second object of the present invention is to provide the use of the above-mentioned Dendrobium sphenanthenicum bibenzyl synthase DsBBS2 promoter in preparing a recombinant vector for expressing an exogenous gene.

[0009] The third object of the present invention is to provide a recombinant vector for expressing foreign genes.

[0010] The fourth object of the present invention is to provide a recombinant strain expressing exogenous genes.

[0011] The fifth object of the present invention is to provide the use of the above-mentioned Dendrobium sinensis bibenzyl synthase DsBBS2 promoter, the above-mentioned recombinant vector and / or the above-mentioned recombinant strain in constructing transgenic plants.

[0012] The sixth object of the present invention is to provide a method for driving the expression of exogenous genes in transgenic plants.

[0013] In order to achieve the above object, the present invention is implemented through the following scheme:

[0014] A promoter of Dendrobium sinensis bibenzyl synthase DsBBS2 is provided, wherein the nucleotide sequence of the promoter of Dendrobium sinensis bibenzyl synthase DsBBS2 is shown in any one of SEQ ID NO: 1 to SEQ ID NO: 6.

[0015] Preferably, the nucleotide sequence of the Dendrobium sinensis bibenzyl synthase DsBBS2 promoter is shown in SEQ ID NO: 5.

[0016] The present invention also seeks to protect the use of the above-mentioned Dendrobium sphenanthenicum bibenzyl synthase DsBBS2 promoter in preparing a recombinant vector for expressing an exogenous gene.

[0017] Preferably, the exogenous gene is the Gus gene.

[0018] The present invention also claims protection for a recombinant vector for expressing an exogenous gene, wherein the recombinant vector contains the above-mentioned Dendrobium sphenanthenum bibenzyl synthase DsBBS2 promoter.

[0019] Preferably, the recombinant vector further contains a foreign gene.

[0020] More preferably, the exogenous gene is the Gus gene.

[0021] The present invention also claims protection for a recombinant strain expressing an exogenous gene, wherein the recombinant strain contains the above-mentioned recombinant vector.

[0022] Preferably, the recombinant strain is Agrobacterium.

[0023] More preferably, the Agrobacterium is Agrobacterium strain GV3101.

[0024] The present invention also seeks to protect the use of the above-mentioned Dendrobium sinensis bibenzyl synthase DsBBS2 promoter, the above-mentioned recombinant vector and / or the above-mentioned recombinant strain in constructing transgenic plants.

[0025] Preferably, the plant is a dicotyledonous plant.

[0026] More preferably, the dicotyledonous plant is tobacco.

[0027] After the recombinant vector containing the above-mentioned Dendrobium sinensis bibenzyl synthase DsBBS2 promoter and the exogenous gene is transformed into plants through Agrobacterium infection, the Dendrobium sinensis bibenzyl synthase DsBBS2 promoter can effectively drive the expression of the exogenous gene in the transgenic daughter plants.

[0028] Therefore, the present invention also claims a method for driving exogenous gene expression in transgenic plants, using biological materials containing the above-mentioned Dendrobium sinensis bibenzyl synthase DsBBS2 promoter to construct transgenic plants, and then using the Dendrobium sinensis bibenzyl synthase DsBBS2 promoter to drive exogenous gene expression.

[0029] Preferably, the biological material is the above-mentioned recombinant vector and / or the above-mentioned recombinant strain.

[0030] Preferably, the transgenic plant is constructed by transferring the biological material containing the above-mentioned Dendrobium sphenanthenicum bibenzyl synthase DsBBS2 promoter into the plant through Agrobacterium transformation.

[0031] Preferably, the exogenous gene is the Gus gene.

[0032] Preferably, the plant is a dicotyledonous plant.

[0033] More preferably, the dicotyledonous plant is tobacco.

[0034] Compared with the prior art, the present invention has the following beneficial effects:

[0035] The present invention provides a promoter for the Dendrobium sinensis bibenzyl synthase DsBBS2. The nucleotide sequence of the promoter is shown in any one of SEQ ID NOs: 1 to 6. The promoter is a sequence of the Dendrobium sinensis bibenzyl synthase DsBBS2, which can effectively drive the expression of exogenous genes in plant leaves. Based on this, the present invention also provides a method for driving exogenous gene expression in transgenic plants. The method comprises constructing a transgenic plant using a biological material containing the Dendrobium sinensis bibenzyl synthase DsBBS2 promoter, and then using the Dendrobium sinensis bibenzyl synthase DsBBS2 promoter to drive exogenous gene expression. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 This is a graph showing the agarose gel electrophoresis results of the genomic DNA of Dendrobium sinensis in Example 1;

[0037] Figure 2 1 is a graph showing the agarose gel electrophoresis results of the PCR amplification products in Example 1;

[0038] Figure 3 This is a graph showing the gel electrophoresis results of PCR products 1 to 5 in Example 3;

[0039] Figure 4 This is a diagram showing the staining observation results of leaves injected with the Agrobacterium-infected solution in Example 4. DETAILED DESCRIPTION

[0040] The present invention is further described in detail below with reference to the accompanying drawings and specific examples. The examples are intended only to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods used in the following examples are conventional methods unless otherwise specified; the materials and reagents used are commercially available unless otherwise specified.

[0041] Example 1 Acquisition of the Dendrobium sphenanthenicum bibenzyl synthase DsBBS2 promoter

[0042] 1. Experimental Methods

[0043] 1. DNA extraction from Dendrobium sinensis

[0044] The whole plant of one-year-old tissue culture seedling of Dendrobium sinensis from the Key Laboratory of Biology of Tropical Specialty Flower and Tree Resources of Hainan University was used as the material. The genomic DNA of Dendrobium sinensis was extracted according to the instructions of the Plant Genomic DNA Extraction Kit (DP3111, Bioteke) to obtain the genomic DNA of Dendrobium sinensis (the extraction was repeated 4 times, numbered 1 to 4). The extracted genomic DNA of Dendrobium sinensis was detected by agarose gel electrophoresis using 1.0% (w / v) agarose gel, and the DNA concentration (A260 / A280) was determined using an ultramicro spectrophotometer.

[0045] 2. Cloning of the DsBBS2 gene from Dendrobium sinensis

[0046] The DsBBS2 gene sequence of Dendrobium candidum (GenBank: OP887150.1) was obtained from the NCBI genome database (https: / / www.ncbi.nlm.nih.gov / genome / gdv / ). Based on the primer design principles in the Takara Genome Walking Kit instructions, DsBBS2-SP1 (SEQ ID NO: 7), DsBBS2-SP2 (SEQ ID NO: 8), and DsBBS2-SP3 (SEQ ID NO: 9) were designed using Premier 5.0 software based on the DsBBS2 gene sequence. DsBBS2-SP1 to DsBBS2-SP3 are shown in Table 1.

[0047] Table 1 DsBBS2-SP1 to DsBBS2-SP3

[0048] Primer name Specific primer sequence (5'-3') DsBBS2-SP1 (SEQ ID NO: 7) GAGGTGAGTGATTTGAGACTTAGGC DsBBS2-SP2 (SEQ ID NO: 8) GGGATTTGCAGTGATTAACTCCTCGT DsBBS2-SP3 (SEQ ID NO: 9) AAGTGCTCGCTGTTGGTGATGC

[0049] Next, the genomic DNA of Dendrobium officinale obtained in step 1 was used as a template and amplified using the GenomeWalking Kit (Cat. No. 6108, Takara) to obtain the promoter DsBBS2. The specific steps are as follows:

[0050] Using the genomic DNA of Dendrobium sinensis obtained in step 1 as a template, using the DsBBS2-SP1 specific primer (SEQ ID NO: 7), a first PCR reaction solution was prepared according to the PCR reaction system shown in Table 2, and a first PCR reaction was performed according to PCR reaction procedure 1 shown in Table 3 to obtain a first PCR amplification product.

[0051] Table 2 PCR reaction system

[0052] Reagents Usage template 1 μL dNTP Mixture (2.5 mM each) 8μL <![CDATA[10×LA PCR Buffer II(Mg 2+ pLus)]]> 5μL TaKaRa LA Taq (5U / μL) 0.5μL AP2 Primer (from the Genome Walking Kit, 100 pmoL / μL) 1 μL DsBBS-SP1 (SEQ ID NO: 7, 10 pmoL / μL) 1 μL sterile water To 50μL

[0053] Table 3 PCR reaction program 1

[0054]

[0055]

[0056] Next, using the first PCR amplification product as a template, the PCR reaction system shown in Table 2 was combined, and DsBBS2-SP1 (SEQ ID NO: 7) was replaced with DsBBS2-SP2 (SEQ ID NO: 8). A second PCR reaction solution was prepared, and a second PCR reaction was performed according to PCR reaction procedure 2 shown in Table 4 to obtain a second PCR amplification product.

[0057] Table 4 PCR reaction program 2

[0058]

[0059] The 2nd PCR amplification product was then diluted 10-fold and used as a template. In combination with the PCR reaction system shown in Table 2, DsBBS2-SP1 (SEQ ID NO: 7) was replaced with DsBBS2-SP3 (SEQ ID NO: 9). A 3rd PCR reaction solution was prepared, and the 3rd PCR reaction was performed according to PCR reaction procedure 2 shown in Table 4 to obtain the 3rd PCR amplification product (promoter DsBBS2).

[0060] After the PCR reaction, the first, second, and third PCR amplification products were each detected by agarose gel electrophoresis using 1.0% (w / v) agarose gel. The target band (approximately 2000 bp) was then excised and DNA fragments were recovered and purified from the target band according to the instructions in the Sangon Gel Extraction Kit (B518131, Sangon Biotechnology) and the PCR Product Purification Kit (B110093, Sangon Biotechnology) to obtain the purified product.

[0061] The purified product was sent to Sangon Biotech Co., Ltd. and Sanger sequenced using DsBBS2-SP3 (SEQ ID NO: 9). The sequence of the purified product (i.e., 3rd PCR amplification product, promoter DsBBS2) was obtained by reverse complementation of the sequencing results.

[0062] 2. Experimental Results

[0063] The results of agarose gel electrophoresis of genomic DNA of Dendrobium sphenanthera are shown in the figure below. Figure 1 As shown in the figure, the results showed that the genomic DNA of the four extracted Dendrobium sinensis had clear bands without tailing in the gel electrophoresis experiment, and the bands all appeared at the same position; the results of the ultramicro spectrophotometer measurement are shown in Table 5, and the results showed that the A260 / A280 results of the extracted genomic DNA of Dendrobium sinensis were normal and could be used for subsequent experiments.

[0064] Table 5 Ultramicrospectrophotometer measurement results

[0065] Genomic DNA of Dendrobium sphenanthera Concentration (ng / μL) A260 / A280 No. 1 40.8 1.962 No. 2 53.3 1.973 No. 3 58.9 1.971 No. 4 88.0 1.913

[0066] The results of agarose gel electrophoresis of PCR amplification products are shown in the figure Figure 2 As shown, lane M is the Marker lane, lane 1 is the electrophoresis result of the 1st PCR amplification product, lane 2 is the electrophoresis result of the 2nd PCR amplification product, and lane 3 is the electrophoresis result of the 3rd PCR amplification product.

[0067] The results showed that bright bands were present in the agarose gel electrophoresis results, indicating that the three PCR amplifications were successful and amplified products were present.

[0068] The nucleotide sequence of the 3rd PCR amplification product (Dendrobium sphenanthellum bibenzyl synthase DsBBS2 promoter) is shown in SEQ ID NO: 1.

[0069] Example 2 Sequence Analysis of the Promoter of Bibenzyl Synthase DsBBS2 from Dendrobium sphenanthenum

[0070] 1. Experimental Methods

[0071] Based on the promoter DsBBS2 (SEQ ID NO: 1) obtained in Example 1, the cis-acting element of the promoter DsBBS2 was predicted using the PlantCARE online website (https: / / bioinformatics.psb.ugent.be / webtools / plantcare / html / ).

[0072] 2. Experimental Results

[0073] The prediction results of the cis-acting elements of the promoter DsBBS2 are shown in Table 5.

[0074] Table 6 Prediction results of cis-acting elements of promoter DsBBS2

[0075]

[0076]

[0077] The results showed that the cis-acting elements of the promoter DsBBS2 (SEQ ID NO: 1) contained the basic cis-acting elements TATAbox and the conserved AT~TATA-box elements. In addition to a large number of light-responsive elements (such as TCT-motif, ATCT-motif, G-Box, I-box and Box4), it also contained multiple elements related to abiotic stress and hormone response {low-temperature response element LTR, drought-induced MYB binding site (MBS), anaerobic inducible response element ARE, wound response element WRE3, dehydration response element DRE1, abscisic acid (ABA) response elements (ABRE, ABRE3a, ABRE4), methyl jasmonate response element CGTCA-motif, auxin response element AuxRR-core, salicylic acid response element TCA-element}.

[0078] The results showed that the promoter structure contained in the DsBBS2 promoter sequence was complete, including core promoter elements, regulatory elements shared by enhancers and promoters, and some other cis-acting elements.

[0079] Example 3 Construction of an expression vector containing the promoter DsBBS2

[0080] 1. Experimental Methods

[0081] The 5'UTR upstream promoter of the promoter DsBBS2 (SEQ ID NO: 1) obtained in Example 1 was constructed into five different length pairs of sequences by the 5' end serial deletion method: DsBBS2-2035 bp (SEQ ID NO: 2), DsBBS2-1510 bp (SEQ ID NO: 3), DsBBS2-1084 bp (SEQ ID NO: 4), DsBBS2-620 bp (SEQ ID NO: 5), and DsBBS2-302 bp (SEQ ID NO: 6); the specific method is as follows:

[0082] Avoiding the various binding sites shown in Table 6, primer sequences with pNC-121-Pro vector (pBI121 framework, Gus reporter gene) vector linkers were designed at -1bp, -302bp, -620bp, -1084bp, -1510bp, and -2035bp of the DsBBS2 promoter; the designed primer sequences are shown in Table 7.

[0083] Table 7 Primer design for 5' end serial deletion expression vector

[0084] Primer name sequence T-R1 (SEQ ID NO: 10) aggtctcagcagaccacaagtGGTTGTCTACAGAGCT T-F302 (SEQ ID NO: 11) agtggtctctgtccagtcctCATCTTGACAGACCTAA T-F620 (SEQ ID NO: 12) agtggtctctgtccagtcctGGATCATGTAATGTACTT T-F1084 (SEQ ID NO: 13) agtggtctctgtccagtcctCATGTCGATTTACTTGATGGG T-F1510 (SEQ ID NO: 14) agtggtctctgtccagtcctGCAACAGGGAATACTGATGACC T-F2035 (SEQ ID NO: 15) agtggtctctgtccagtcctTTTGGTAGCTGGGAGG

[0085] Next, the full-length DsBBS2 promoter (SEQ ID NO: 1) was used as a template to prepare the PCR reaction mixture shown in Table 8, and PCR amplification was performed according to the amplification program shown in Table 9 to obtain PCR products 1 to 5. The reverse primer in the PCR reaction mixture shown in Table 8 was T-R1 (SEQ ID NO: 10), and the forward primers were T-F2035 (SEQ ID NO: 15), T-F1510 (SEQ ID NO: 14), T-F1084 (SEQ ID NO: 13), T-F620 (SEQ ID NO: 12), and T-F302 (SEQ ID NO: 11).

[0086] Table 8 PCR reaction solution

[0087] Component Volume (μL) Forward Primer 1 Reverse Primer 1 Powerpol 2×PCR Mix with Dye 25 template 1 <![CDATA[ddH2O]]> Variable Total volume 50

[0088] Table 9 Amplification procedure

[0089]

[0090] Then, PCR products 1 to PCR products 5 were detected by agarose gel electrophoresis using 1.0% agarose gel, and the target bands detected by gel electrophoresis were recovered and purified according to the instructions of the Sangon Gel Recovery Kit (B518131, Sangon Biotechnology) and the PCR Product Purification Kit (B110093, Sangon Biotechnology). PCR recovered product 1 (DsBBS2-2035 bp), PCR recovered product 2 (DsBBS2-1510 bp), PCR recovered product 3 (DsBBS2-1084 bp), PCR recovered product 4 (DsBBS2-620 bp), and PCR recovered product 5 (DsBBS2-302 bp) were obtained.

[0091] Next, according to the instructions in the Nimble Cloning Kit (NC001, NC Biotech), the PCR product 1 was ligated with the pNC-121-Pro vector (pBI121 framework, Gus reporter gene). Then, 5 μL of Nimble Mix was added and mixed by pipetting. After incubation at 50°C for 60 min, 5 μL of the reaction product was transformed into DH5α competent cells (Shanghai Weidi Biological Co., Ltd.) and transferred to LB solid medium (containing 50 mg / L Kan) and cultured at 37°C for 12 h. After the incubation period, a single clone was picked and incubated in 800 μL of LB liquid (containing 50 mg / L Kan) for PCR identification. After detection by gel electrophoresis, positive clones with the correct band size (approximately 2000 bp) were selected for sequencing. The sequencing results were aligned with the DsBBS2 promoter sequence, and the correct bacterial solution (with the correct band size and correct alignment with the DsBBS2 sequencing results) was selected for inoculation, and the plasmid was extracted to obtain the DsBBS2-2035bp expression vector.

[0092] PCR recovered product 1 was replaced with PCR recovered product 2 to PCR recovered product 5 in sequence, and processed according to the above method to obtain DsBBS2-2035bp expression vector, DsBBS2-1510bp expression vector, DsBBS2-1084bp expression vector, DsBBS2-620bp expression vector and DsBBS2-302bp expression vector.

[0093] 2. Experimental Results

[0094] The gel electrophoresis results of PCR products 1 to 5 are shown in the figure Figure 3As shown, lane M is the Marker lane, lane 1 is the gel electrophoresis result of PCR product 1, lane 2 is the gel electrophoresis result of PCR product 2, lane 3 is the gel electrophoresis result of PCR product 3, lane 4 is the gel electrophoresis result of PCR product 4, and lane 5 is the gel electrophoresis result of PCR product 5.

[0095] The results showed that in the electrophoresis results of PCR products 1 to PCR products 5, there was a clear band without tailing appearing at the target length, indicating that DsBBS2-2035bp (SEQ ID NO: 2), DsBBS2-1510bp (SEQ ID NO: 3), DsBBS2-1084bp (SEQ ID NO: 4), DsBBS2-620bp (SEQ ID NO: 5) and DsBBS2-302bp (SEQ ID NO: 6) were successfully amplified.

[0096] Example 4 Application of expression vector containing promoter DsBBS2

[0097] 1. Experimental Methods

[0098] The DsBBS2-2035bp expression vector, DsBBS2-1510bp expression vector, DsBBS2-1084bp expression vector, DsBBS2-620bp expression vector and DsBBS2-302bp expression vector prepared in Example 3 were transformed into Agrobacterium GV3101 (AC1004S, Shanghai Weidi Biological Co., Ltd.) according to the Shanghai Weidi Biological GV3101 Agrobacterium transformation instructions to obtain GV3101-2035, GV3101-1510, GV3101-1084, GV3101-620 and GV3101-302; and the pNC-121-Pro vector was also transformed into Agrobacterium GV3101 to obtain GV3101-control.

[0099] Then GV3101-2035, GV3101-1510, GV3101-1084, GV3101-620, GV3101-302 and GV3101-control were respectively spread on LB (50 mg / L Kan and 20 mg / L Rif) solid culture medium and cultured at 37°C for 12 hours. After the culture, single colonies were picked from the LB solid culture medium for positive clone screening and agarose gel electrophoresis verification. The selected positive colonies were mixed with sterile glycerol at a volume ratio of 1 ml:1 ml to obtain GV3101-2035 bacterial solution, GV3101-1510 bacterial solution, GV3101-1084 bacterial solution, GV3101-620 bacterial solution, GV3101-302 bacterial solution and GV3101-control bacterial solution.

[0100] Add 200 μL of GV3101-2035 bacterial solution to 10 mL of LB liquid medium containing 50 μg / mL Kan and 20 μg / mL Rif, and shake on a shaker until the OD 600 =0.5, centrifuge and discard the supernatant, collect the precipitate and resuspend it in freshly prepared MMA solution (containing 10 mM MgCl2·6H2O, 10 mM MES and 148 mM AS) to obtain OD 600 =0.3 of GV3101-2035 Agrobacterium inoculation solution.

[0101] Select Nicotiana benthamiana from the Key Laboratory of Biology of Tropical Specialty Flower and Tree Resources of Hainan University, with a culture time of 1 to 2 months and good growth status without any difference. Use a 1 mL disposable sterile syringe to absorb the GV3101-2035 Agrobacterium infection solution, select efficient and thick leaves, pierce the back of the leaves to form a small hole (without piercing the leaves), remove the syringe needle, and inject the GV3101-2035 Agrobacterium infection solution into the lower epidermis of the leaves through the small hole. Then place the tobacco in an incubator and continue to culture for 3 days under the conditions of 8 hours of darkness and 16 hours of light.

[0102] After the incubation, the leaves injected with the GV3101-2035 Agrobacterium infection solution were punched with a hole punch to obtain the leaves to be observed. Then, the GUS staining solution was prepared according to the instructions of the GUS staining kit produced by Zhongke Ruitai (RTU4032, Zhongke Ruitai). The leaves to be observed were stained with the GUS staining solution, wrapped with tin foil to protect from light, and incubated in a 37°C incubator for 24 hours. After the staining was completed, 5 mL of 75% ethanol was used for decolorization three times and photographed for observation.

[0103] The GV3101-2035 bacterial solution was replaced with the GV3101-1510 bacterial solution, GV3101-1084 bacterial solution, GV3101-620 bacterial solution, GV3101-302 bacterial solution and GV3101-control bacterial solution in sequence, and the tobacco leaves were treated and observed according to the above method.

[0104] 2. Experimental Results

[0105] The staining observation results of the leaves injected with Agrobacterium infection solution are shown in the figure below. Figure 4As shown, the results show that the tobacco leaves injected with GV3101-2035 Agrobacterium infusion solution, GV3101-1510 Agrobacterium infusion solution, GV3101-1084 Agrobacterium infusion solution, GV3101-620 Agrobacterium infusion solution and GV3101-302 Agrobacterium infusion solution were all obviously dyed blue, and the Gus reporter gene (exogenous gene) was effectively driven in the tobacco leaves; while the tobacco leaves in the control group appeared white and were not dyed blue, indicating that the Gus reporter gene was not expressed in the tobacco leaves of the control group.

[0106] It shows that DsBBS2-2035bp (SEQ ID NO: 2), DsBBS2-1510bp (SEQ ID NO: 3), DsBBS2-1084bp (SEQ ID NO: 4), DsBBS2-620bp (SEQ ID NO: 5) and DsBBS2-302bp (SEQ ID NO: 6) can effectively drive the expression of exogenous genes in tobacco leaves.

[0107] Therefore, DsBBS2-2035bp, DsBBS2-1510bp, DsBBS2-1084bp, DsBBS2-620bp and DsBBS2-302bp can effectively drive the expression of exogenous genes in plants.

[0108] Finally, it should be noted that the above embodiments are intended only to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Those skilled in the art will readily appreciate that other variations or modifications may be made based on the above descriptions and concepts. It is not necessary and impossible to provide an exhaustive list of all possible implementations. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention shall be included within the scope of protection of the claims of the present invention.

Claims

1. A promoter of bibenzyl synthase DsBBS2 from Dendrobium sinensis, characterized in that: The nucleotide sequence of the Dendrobium sinensis bibenzyl synthase DsBBS2 promoter is shown in any one of SEQ ID NO: 1 to SEQ ID NO:

6.

2. Use of the Dendrobium sinensis bibenzyl synthase DsBBS2 promoter according to claim 1 in preparing a recombinant vector for expressing an exogenous gene.

3. A recombinant vector for expressing an exogenous gene, characterized in that: The recombinant vector contains the Dendrobium sphenanthenicum bibenzyl synthase DsBBS2 promoter according to claim 1.

4. A recombinant strain expressing an exogenous gene, characterized in that: The recombinant strain contains the recombinant vector according to claim 3.

5. The recombinant strain according to claim 4, characterized in that The recombinant strain is Agrobacterium.

6. Use of the Dendrobium sinensis bibenzyl synthase DsBBS2 promoter according to claim 1, the recombinant vector according to claim 3, and / or the recombinant strain according to claim 4 in constructing a transgenic plant.

7. The use according to claim 6, characterized in that The plant is a dicotyledonous plant.

8. The use according to claim 7, characterized in that The dicotyledonous plant is tobacco.

9. A method for driving exogenous gene expression in a transgenic plant, characterized in that: A transgenic plant is constructed using a biological material containing the Dendrobium sinensis bibenzyl synthase DsBBS2 promoter according to claim 1, and then the Dendrobium sinensis bibenzyl synthase DsBBS2 promoter is used to drive the expression of exogenous genes.

10. The method according to claim 9, characterized in that The biological material is the recombinant vector according to claim 3 and / or the recombinant strain according to claim 4.

Images