Programmable multivalent nucleic acid aptamer as well as preparation method and application thereof
By introducing an extended chain on the nucleic acid aptamer and connecting it to the central support to construct a programmable multivalent nucleic acid aptamer, the problem of poor flexibility in the design of existing multivalent nucleic acid aptamers is solved, and an efficient and stable tumor targeted therapy effect is achieved.
Patent Information
- Application Number
- CN202411296985.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-18
- Publication Date
- 2025-09-23
AI Technical Summary
Existing multivalent nucleic acid aptamers have problems in design and drug conjugation, such as poor flexibility, insufficient stability, cumbersome construction process and high cost, making it difficult to achieve precise targeted treatment of malignant tumors.
A programmable multivalent nucleic acid aptamer is designed. By introducing an extended chain on the nucleic acid aptamer and connecting it to the central support, a multivalent nucleic acid aptamer structure is formed that radiates evenly from the center to the surrounding areas. It is constructed using base complementary connection to achieve flexible selection and stable connection between nucleic acid aptamers and drugs.
It achieves high affinity and high specific targeting of multivalent nucleic acid aptamers, improves the targeting and stability in tumor treatment, provides precise chemotherapy induction and immune activation effects, and enhances the multi-drug precise targeting capability of tumor treatment.
Smart Images

Figure CN120683115A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biotechnology, and in particular relates to a programmable multivalent nucleic acid aptamer and a preparation method and application thereof. Background Art
[0002] Malignant tumors, one of the world's major diseases that pose a serious threat to human health, present significant challenges to clinical treatment due to their complexity and diversity. The heterogeneity of malignant tumors is reflected not only in genotypic and phenotypic differences between patients, but also in the dynamic changes in tumor cells within the same patient over time and with therapeutic intervention. This high degree of heterogeneity makes it difficult for traditional therapies to effectively and precisely target all tumor cells, thereby limiting treatment efficacy and often leading to problems such as treatment escape, drug resistance, metastasis, and recurrence.
[0003] Currently, although small molecule targeted drugs such as imatinib have shown good therapeutic effects on specific targets (such as wild-type BCR-ABL protein), their efficacy is significantly reduced when faced with target mutations or expression differences, highlighting the limitations of single-target therapy. To overcome this problem, antibody-drug conjugates (ADCs) have emerged, which achieve precise attacks on tumor cells by coupling highly specific monoclonal antibodies with highly effective cytotoxic drugs. However, the application of ADCs also faces challenges such as limited targets, poor penetration into solid tumors, and complex pharmacokinetics, which limit their widespread application in the treatment of complex tumors.
[0004] Against this backdrop, aptamers, as an emerging molecular recognition tool, are gradually entering the scientific and clinical arena due to their advantages, including rapid screening, wide target range, ease of synthesis and modification, and low immunogenicity. Aptamers achieve precise target recognition through their specific three-dimensional structure, offering new possibilities for tumor diagnosis and treatment. However, traditional monovalent aptamers have limited their potential for clinical application due to their poor in vivo stability, short blood circulation time, and difficulty in effectively aggregating in tumor tissue.
[0005] To overcome these limitations of monovalent aptamers, scientists have begun exploring strategies for the design and synthesis of multivalent aptamers. By increasing the number of binding sites for their targets, multivalent aptamers can significantly enhance their binding strength and stability, while also prolonging their circulation time in the body and enhancing their targeting to tumor tissues. Furthermore, through rational drug conjugation design, multivalent aptamers can be transformed into highly efficient drug delivery systems, achieving precise killing of tumor cells.
[0006] CN118291475A provides a multivalent nucleic acid, but its aptamers are connected in parallel in series through click chemistry and enzyme linkage. As the number of aptamers increases, the length becomes longer and longer, and the connection between the aptamers is not compact enough, and the stability is not high. When used for different aptamers, it is also necessary to choose whether the aptamer is more suitable at both ends or in the middle. When used for drug coupling, the drug is coupled in the series of aptamers. When connected to the two ends or to a certain aptamer in the middle, there are differences in position and stability, resulting in differences in drug efficacy, making it difficult to uniformly control. Therefore, it is necessary to find the right position and design the right connection method for different aptamers and different drugs.
[0007] This research team applied for a related patent for circular nucleic acid in 2024 (application number 2024108835794). Although circular nucleic acid can also be linked to multivalent nucleic acid aptamers or drugs on the periphery, so that the position of the nucleic acid aptamer or drug can be arbitrarily selected, it is necessary to first construct the circular nucleic acid through a specific sequence, and then select the nucleic acid aptamer that can be connected based on the sequence of the circular nucleic acid, and then select the coupled drug based on the nucleic acid aptamer. The process is relatively cumbersome.
[0008] Furthermore, existing multivalent aptamers require the construction of multiple aptamers with different connection methods before the drug is conjugated to them. This results in the selection of drugs and the conjugation method being limited by the constructed multivalent aptamer, preventing free selection. When the aptamer or drug needs to be replaced, it is usually necessary to redesign from scratch and select a more appropriate construction method for the aptamer and drug. Therefore, existing multivalent aptamers and their drug conjugates are difficult to program and freely select, and the preparation process is quite inconvenient.
[0009] In summary, there is an urgent need to develop a multivalent nucleic acid aptamer and its drug conjugate that can be freely programmed for design, in which the types and connection positions of nucleic acid aptamers and drugs can be arbitrarily selected, the construction process is convenient, the stability is better, the construction cost is lower, and the construction method is more efficient, so as to provide more effective and precise treatment methods for diseases such as malignant tumors. Summary of the Invention
[0010] To solve the above problems, the present invention provides a programmable multivalent nucleic acid aptamer and its preparation method and application. By designing an extension chain on the nucleic acid aptamer and designing a central support, the nucleic acid aptamer is connected to the central support through the extension chain, and a multivalent nucleic acid aptamer is constructed that radiates uniformly from the center to the surrounding area. The size, type, valence of the nucleic acid aptamer, as well as the type and position of the coupled drug, can be flexibly controlled, and can be truly programmable. The multivalent nucleic acid aptamer can recognize and bind to specific target molecules with high affinity and high specificity. By carrying chemotherapy drugs and immune agonists, a multivalent nucleic acid aptamer-drug conjugate is formed. Compared with the multivalent nucleic acid aptamer constructed by circular nucleic acid, it has better targeting effect and acts as a cell linker, improving the targeting, stability and long-term circulation ability in tumor treatment, achieving the synergistic therapeutic effect of "precision targeting, chemotherapy induction, and immune activation", and providing an innovative solution for the multi-drug precision targeted treatment of tumors. It has significant clinical application potential and social value.
[0011] The programmable method mentioned in the present invention means that the size, type, valence of the nucleic acid aptamer and the type and position of the coupled drug in the multivalent nucleic acid aptamer can be flexibly selected and designed according to needs, and then the multivalent nucleic acid aptamer or multivalent nucleic acid aptamer drug complex that meets the requirements can be synthesized.
[0012] In one aspect, the present invention provides a multivalent nucleic acid aptamer based on uniformly diverging from the center to the surroundings, wherein the multivalent nucleic acid aptamer comprises at least two interconnected nucleic acid aptamer units, each of which contains a nucleic acid aptamer;
[0013] When there are two nucleic acid aptamer units, the two nucleic acid aptamer units are complementary and connected;
[0014] When there are at least three nucleic acid aptamer units, a central support is further included, and the nucleic acid aptamer units are respectively connected to the central support.
[0015] The present invention opens up a new approach for the construction of multivalent nucleic acid aptamers, constructing a multivalent nucleic acid aptamer that radiates evenly from the center to the surrounding area and is spherical as a whole. Each nucleic acid aptamer is evenly distributed based on the center, so there is no positional difference between them, the performance is more stable and controllable, and it has a more stable targeting effect.
[0016] At the same time, the multivalent nucleic acid aptamer constructed by the present invention is mainly connected through base complementarity. Compared with other connection methods through modified groups, the multivalent nucleic acid aptamer constructed by base complementary connection has a more stable structure and better multiple targeting effect.
[0017] In some embodiments, the aptamer unit is a aptamer with an extension chain at one end, the extension chain is a single-stranded DNA, and the aptamer is complementarily connected to the central support through the extension chain, or is complementarily connected to the extension chain of another aptamer through the extension chain.
[0018] Furthermore, the nucleic acid aptamer unit includes a nucleic acid aptamer and an X chain, one end of the nucleic acid aptamer is connected to the X chain; the X chain is a single nucleotide chain;
[0019] When there are two nucleic acid aptamer units, the two nucleic acid aptamer units are respectively connected by X strand complementarity;
[0020] When there are at least three nucleic acid aptamer units, the nucleic acid aptamer units are complementarily connected to the central scaffold through respective X chains.
[0021] It can be understood that the X chain here is equivalent to an extended chain of the nucleic acid aptamer. The multivalent nucleic acid aptamer constructed in the present invention is constructed by adding an extended chain at one end of the nucleic acid aptamer during the synthesis of the nucleic acid aptamer, and the extended chain is connected to other nucleic acid aptamers through base complementarity.
[0022] In some methods, since the X chain is located at only one end of the nucleic acid aptamer, the other end of the nucleic acid aptamer can be modified with a phosphate group and then ligated by T4 ligase to form a closed loop.
[0023] Furthermore, the central scaffold is composed of at least three Y chains connected in a complementary manner; the Y chain is composed of a first single chain, a second single chain and a third single chain connected in series, wherein the first single chain and the second single chain of any Y chain can be complementary connected with the second single chain and the first single chain of one of the other Y chains, and the third single chain of any Y chain can be complementary connected with the X chain of the nucleic acid aptamer unit.
[0024] The central support is composed of at least three Y chains connected in a complementary manner, forming a shape that radiates evenly from the center to the surroundings. The structure is stable. The construction process of the central support is as follows: Figure 1 shown.
[0025] In some embodiments, the central scaffold for constructing a trivalent nucleic acid aptamer is composed of three Y chains, forming a Figure 1 (1) The shape structure of the "Y"-shaped bracket shown.
[0026] In some embodiments, the central scaffold for constructing a tetravalent nucleic acid aptamer is composed of four Y chains, forming a Figure 1 (2) The shape structure of the "X"-shaped bracket shown.
[0027] In some embodiments, the central scaffold for constructing a pentavalent nucleic acid aptamer is composed of five Y chains, forming a Figure 1 (3) The shape structure of the "five-pointed star" type bracket shown.
[0028] In some embodiments, the central scaffold for constructing a hexavalent nucleic acid aptamer is composed of five Y chains, forming a Figure 1 (4) The shape structure of the “*”-shaped bracket shown.
[0029] Furthermore, the central support has a third single strand that radiates uniformly from the center outward, and the X strand is complementary to the third single strand of the central support.
[0030] The structure radiating from the central support contains a third single strand that has not yet been complementary. The third single strand can complement the X strand of the nucleic acid aptamer unit, thereby forming a stable multivalent nucleic acid aptamer structure as a whole.
[0031] Furthermore, the 5' end of the nucleic acid aptamer is connected to the X chain.
[0032] The 5' end of the nucleic acid aptamer is connected to the X chain to form a nucleic acid aptamer monomer.
[0033] In some methods, during the preparation of the aptamer monomer, the aptamer and the X chain are simultaneously synthesized through solid phase synthesis to obtain a single chain of the aptamer monomer.
[0034] Furthermore, the 5' ends of the X and Y chains are modified with a first group, so that the 3' end of the nucleic acid aptamer unit and the 5' end of the Y chain, as well as the 5' end of the X chain and the 3' end of the Y chain are connected or chemically linked by DNA ligase to form a closed ring, wherein the first group includes any one or more of a phosphate group, a click chemistry reaction of an azide group and a diphenylcyclooctyne group, a click chemistry reaction of an azide group and a cyclooctyne group, a click chemistry reaction of an azide group and an alkynyl group, an addition reaction of a maleimide group and a furan group, an addition reaction of a maleimide group and a sulfhydryl group, a substitution reaction of an NHS ester group and an amino group, an SN2 reaction of a thiophosphate group and a chloroacetyl group, and a condensation reaction of an amino group and a carboxyl group; and the DNA ligase includes at least one of T4 DNA ligase, T7 DNA ligase, and T4 RNA ligase.
[0035] The process of connecting the X chain of the aptamer unit to the central scaffold to form a multivalent aptamer is as follows Figure 2 shown.
[0036] In some embodiments, the process of forming a trivalent nucleic acid aptamer by combining three nucleic acid aptamer monomers with a central scaffold composed of three gamma chains is as follows: Figure 2 (1) shown.
[0037] In some embodiments, the process of forming a tetravalent nucleic acid aptamer by combining four nucleic acid aptamer monomers with a central scaffold composed of four gamma chains is as follows: Figure 2 (2) shown.
[0038] In some embodiments, the process of forming a pentavalent nucleic acid aptamer by combining five nucleic acid aptamer monomers with a central scaffold composed of five gamma chains is as follows: Figure 2 (3) shown.
[0039] In some embodiments, the process of forming a hexavalent nucleic acid aptamer by combining six nucleic acid aptamer monomers with a central scaffold composed of six Y chains is as follows: Figure 2 (4) shown.
[0040] In some methods, the 5' ends of strand X and strand Y are modified with a phosphate group. After strand X and the third single strand of strand Y are complementary ligated, phosphorylation reactions are catalyzed by T4 ligase between the 3' end of the aptamer unit and the 5' end of strand Y, and between the 5' end of strand X and the 3' end of strand Y. This ligates the 5'P group to the adjacent 3'OH group, connecting all gaps to form a closed loop.
[0041] Furthermore, the number of Y chains in the central scaffold is consistent with the valence of the multivalent nucleic acid aptamer.
[0042] Furthermore, the number of bases in the complementary connection is any one or more of 13nt, 20nt, and 26nt.
[0043] Studies have shown that the length of the complementary region directly affects the construction stability and targeting effect of the multivalent nucleic acid aptamer, among which the most preferred complementary region length is 13nt.
[0044] In some embodiments, each nucleic acid aptamer in the multivalent nucleic acid aptamer can be selected according to needs, and can be all the same nucleic acid aptamer, or can be completely different or partially different nucleic acid aptamers.
[0045] Furthermore, the X chain is modified with a second group, which includes any one or more of a dibenzocyclooctyne group modification, a click chemistry reaction between an azide group and a diphenylcyclooctyne group, a click chemistry reaction between an azide group and a cyclooctyne group, a click chemistry reaction between an azide group and an alkynyl group, an addition reaction between a maleimide group and a furan group, an addition reaction between a maleimide group and a sulfhydryl group, a substitution reaction between an NHS ester group and an amino group, an SN2 reaction between a thiophosphate group and a chloroacetyl group, and a condensation reaction between an amino group and a carboxyl group; the second group is used to couple drugs or make the multivalent nucleic acid aptamer fluorescent.
[0046] In some embodiments, in the multivalent nucleic acid aptamer, the drugs coupled to the nucleic acid aptamer can be selected as needed, and can be all the same drugs, or completely different or partially different drugs.
[0047] Therefore, the multivalent nucleic acid aptamer provided by the present invention is a programmable nucleic acid aptamer, and the type, size, quantity, drug type, position, etc. of the nucleic acid aptamer can be selected as needed, and then directly synthesized using the nucleic acid aptamer synthesis method provided by the present invention.
[0048] In some embodiments, the programmable multivalent nucleic acid aptamer Mv-SL1 provided by the present invention includes an X chain and a Y chain, and the nucleic acid aptamer Mv-SL1 has the following sequence: X-ATCAGGCTGGATGGTAGCTCGGTCGGGGTGGGTGGGTTGGCAAGTCTGAT, wherein X is ACTTGAGTGACGG (SEQ ID NO: 1, 13nt), CCGTCACTCAAGT (SEQ ID NO: 2, 13nt), AGTCTGGTCAGAG (SEQ ID NO: 3, 13nt), TACAGTGAAGGAC (SEQ ID NO: 4, 13nt), CAAGGAACGGAGA (SEQ ID NO: 5, 13nt), GGACCTCAGCAAA (SEQ ID NO: 6, 13nt), TGATAGGACCATA (SEQ ID NO: 7, 13nt), ACTTGAGTGACGGTGCTGAG (SEQ ID NO: 8, 20nt), CTCAGCACCGTCACTCAAGT (SEQ ID NO: 9, 20nt), NO: 9, 20nt), AGTCTGGTCAGAGATGAACG (SEQ ID NO: 10, 20nt), TACAGTGAAGGACCACATCT (SEQ ID NO: 11, 20nt), CAAGGAACGGAGAGAGGTCT (SEQ ID NO: 12, 20nt), GGACCTCAGCAAAGGACCAT (SEQ ID NO: 13, 20nt), TGATAGGACCATACTAAGCC (SEQ ID NO: 13, 20nt) ID20 NO: 14, 20nt), ACTTGAGTGACGGTGCTGAGCTAGCA (SEQ ID NO: 15, 26nt), TGCTAGCTCAGCACCGTCACTCAAGT SEQID NO: 16, 26nt), AGTCTGGTCAGAGATGAACGCTAATT (SEQ ID NO: 17, 26nt), TACAGTGAAGGACCACATCTGGAATA (SEQ ID NO: 18, 26nt), CAAGGAACGGAGAGGTCTTATCAC (SEQ ID NO: 19, 26nt), GTGTCCCCTATATCAACAGTCGCTCA (SEQ ID NO: 20, 26nt), TGATAGGACCATACTAAGCCGATCGT (SEQ ID NO: 21, 26nt).
[0049] The Y strand has three lengths of 13 nt, 20 nt, and 26 nt, which are reverse complementary to the X strand. Finally, the X strand and the Y strand complement each other to form a double strand. The Y strand has the following sequence: CCGTCACTCAAGTCACGCGTTTTCTCGCTTGCAGTCTGC (SEQ ID NO: 22).
[0050] CTCTGACCAGACTGGCTCCTTGGTGCGAGAAAACGCGTG (SEQ ID NO: 23),
[0051] GTCCTTCACTGTAGCAGACTGCAAGCGCACCAAGGAGCC (SEQ ID NO: 24),
[0052] CTCTGACCAGACTGGCTCCTTGGTGCGTTGCGATCTTGA (SEQ ID NO: 25),
[0053] TCTCCGTTCCTTGTCAAGATCGCAACGAGAAAACGCGTG (SEQ ID NO: 26),
[0054] GTCCTTCACTGTAGCAGACTGCAAGCTAAGGACTCTGAA (SEQ ID NO: 27),
[0055] TTTGCTGAGGTCCTTCAGAGTCCTTAGCACCAAGGAGCC (SEQ ID NO: 28),
[0056] GTCCTTCACTGTAGCAGACTGCAAGCCTAATTACTACTT (SEQ ID NO: 29),
[0057] TATGGTCCTATCAAAGTAGTAATTAGTAAGGACTCTGAA (SEQ ID NO: 30),
[0058] The first, second, and third single strands of the y chain are all 13 nt in length;
[0059] CTCAGCACCGTCACTCAAGTCACGCGTTTTCTCTCAGAGTGCTTGCAGTCTGCGTCTCAA(SE Q IDNO:31),
[0060] CGTTCATCTCTGACCAGACTGGCTCCTTGGTGCCTTTGCTACTCTGAGAGAAAACGCGTG(SE Q IDNO:32),
[0061] AGATGTGGTCCTTCACTGTATTGAGACGCAGACTGCAAGCAGCAAAGGCACCAAGGAGCC(SEQ IDNO:33),
[0062] CGTTCATCTCTGACCAGACTGGCTCCTTGGTGCCTTTGCTGTTGCGATCTTGAAATGACC(SEQ IDNO:34),
[0063] AGACCTCTCTCCGTTCCTTGGGTCATTTCAAGATCGCAACACTCTGAGAGAAAACGCGTG(SE Q IDNO:35),
[0064] AGATGTGGTCCTTCACTGTATTGAGACGCAGACTGCAAGCTAAGGACTCTGAAGGCACAT(SEQ IDNO:36),
[0065] ATGGTCCTTTGCTGAGGTCCATGTGCCTTCAGAGTCCTTAAGCAAAGGCACCAAGGAGCC(SE Q IDNO:37),
[0066] AGATGTGGTCCTTCACTGTATTGAGACGCAGACTGCAAGCCTAATTACTACTTCAGGACC(SE Q IDNO:38),
[0067] GGCTTAGTATGGTCCTATCAGGTCCTGAAGTAGTATTAAGGACTCTGAAGGCACAT(SE Q IDNO:39),
[0068] 20nt;
[0069] TGCTAGCTCAGCACCGTCACTCAAGTGATGCTCACGCGTTTTCTCTCAGAGTCCCGAAGCTTGCAGTCTGCGTCTCAA(SEQ ID NO:40),
[0070] AATTAGCGTTCATCTCTGACCAGACTTTGATCGGCTCCTTGGTGCCTTTGCTACTCTGAGAGAAAACGCGTGAGCATC(SEQ ID NO:41),
[0071] TATTCCAGATGTGGTCCTTCACTGTATTGAGACGCAGACTGCAAGCTTCGGGAGCAAAGGCACCAAGGAGCCGATCAA(SEQ ID NO:42),
[0072] AATTAGCGTTCATCTCTGACCAGACTTTGATCGGCTCCTTGGTGCCTTTGCTACCTAAGTTGCGATCTTGAAATGACC(SEQ ID NO:43),
[0073] GTGATAAGACCTCTCTCCGTTCCTTGGGTCATTTCAAGATCGCAACTTAGGTACTCTGAGAGAAAACGCGTGAGCATC(SEQ ID NO:44),
[0074] TATTCCAGATGTGGTCCTTCACTGTATTGAGACGCAGACTGCAAGCTTCGGGTAAGGACTCTGAAGGCACATTGAAGT(SEQ ID NO:45),
[0075] TGAGCGACTGTTGATATAGGGGACACACTTCAATGTGCCTTCAGAGTCCTTAAGCAAAGGCACCAAGGAGCCGATCAA(SEQ ID NO:46),
[0076] TATTCCAGATGTGGTCCTTCACTGTATTGAGACGCAGACTGCAAGCTTCGGGTAAGGACTCTGAAGGCACATATTAGC(SEQ ID NO:47),
[0077] ACGATCGGCTTAGTATGGTCCTATCAGCTAATATGTGCCTTCAGAGTCCTTATTGAGACGCAGACTGCAAGCTTCGGG(SEQ ID NO:48)。
[0078] The first single strand, the second single strand and the third single strand of the above y-chain all have a length of 26 nt.
[0079] In some approaches, the bases of the X chains are modified, with each X chain being modified with a phosphate group at the 5' end and a Cy5 in the middle. The 5' end of the chain is modified with a phosphate group, and a phosphorylation reaction is catalyzed by T4 ligase between the 5' end of the X chain and the 3' end of the Y chain, thereby connecting the 5' P group to the adjacent 3' OH group, connecting the gaps to form a closed loop. The Cy5 modified in the middle of the X chain can be combined with the corresponding Y chain to form a fluorescent multivalent nucleic acid aptamer.
[0080] In some embodiments, the Y chain bases are modified, and each Y chain is modified with a phosphate group at the 5' end, so that the 5' end of the Y chain and the 3' end of the nucleic acid aptamer unit are phosphorylated by T4 ligase, and the 5'P group is connected to the adjacent 3'OH group, so that the gap is connected to form a closed loop.
[0081] In some embodiments, the X chain bases are modified, and each X chain is modified with a phosphate group at the 5' end and a dibenzocyclooctyne group in the middle, which can be combined with the corresponding Y chain to form a multivalent nucleic acid aptamer drug conjugate.
[0082] Among them, (SEQ ID NO: 1) and (SEQ ID NO: 2) in the X chain can form a 13 nt complementary bivalent nucleic acid aptamer or a bivalent nucleic acid aptamer drug conjugate through base complementarity; (SEQ ID NO: 1), (SEQ ID NO: 3), (SEQ ID NO: 4) in the X chain and (SEQ ID NO: 22), (SEQ ID NO: 23), (SEQ ID NO: 24) in the Y chain can form a 13 nt complementary trivalent nucleic acid aptamer or a trivalent nucleic acid aptamer drug conjugate through base complementarity; (SEQ ID NO: 1), (SEQ ID NO: 3), (SEQ ID NO: 4), (SEQ ID NO: 5) in the X chain and (SEQ ID NO: 22), (SEQ ID NO: 25), (SEQ ID NO: 24), (SEQ ID NO: 26) in the Y chain can form a 13 nt complementary tetravalent nucleic acid aptamer or a tetravalent nucleic acid aptamer drug conjugate through base complementarity; (SEQ ID NO: 1), (SEQ ID NO: 3), (SEQ ID NO: 4) in the X chain and (SEQ ID NO: 22), (SEQ ID NO: 25), (SEQ ID NO: 24), (SEQ ID NO: 26) in the Y chain can form a 13 nt complementary tetravalent nucleic acid aptamer or a tetravalent nucleic acid aptamer drug conjugate; (SEQ ID NO: 1), (SEQ ID NO: 3), (SEQ ID NO: 4) in the X chain NO:4), (SEQ ID NO:5), (SEQ ID NO:6) and (SEQ ID NO:22), (SEQ ID NO:25), (SEQ ID NO:27), (SEQ ID NO:26), (SEQ ID NO:28) in the Y chain can form a 13nt complementary pentavalent nucleic acid aptamer or a 5-valent nucleic acid aptamer drug conjugate through base complementarity; (SEQ ID NO:1), (SEQ ID NO:3), (SEQ ID NO:4), (SEQ ID NO:5), (SEQ ID NO:6), (SEQ ID NO:7) in the X chain and (SEQ ID NO:22), (SEQ ID NO:25), (SEQ ID NO:29), (SEQ ID NO:26), (SEQ ID NO:28), (SEQ ID NO:30) in the Y chain can form a 13nt complementary hexavalent nucleic acid aptamer or a hexavalent nucleic acid aptamer drug conjugate through base complementarity.
[0083] Among them, (SEQ ID NO: 8) and (SEQ ID NO: 9) in the X chain can form a 20nt complementary bivalent nucleic acid aptamer or a bivalent nucleic acid aptamer drug conjugate through base complementarity; (SEQ ID NO: 8), (SEQ ID NO: 10), (SEQ ID NO: 11) in the X chain and (SEQ ID NO: 31), (SEQ ID NO: 32), (SEQ ID NO: 33) in the Y chain can form a 20nt complementary trivalent nucleic acid aptamer or a trivalent nucleic acid aptamer drug conjugate through base complementarity; (SEQ ID NO: 8), (SEQ ID NO: 10), (SEQ ID NO: 11), (SEQ ID NO: 12) in the X chain and (SEQ ID NO: 31), (SEQ ID NO: 34), (SEQ ID NO: 33), (SEQ ID NO: 35) in the Y chain can form a 20nt complementary tetravalent nucleic acid aptamer or a tetravalent nucleic acid aptamer drug conjugate through base complementarity; (SEQ ID NO: 8), (SEQ ID NO: 10), (SEQ ID NO: 11) in the X chain and (SEQ ID NO: 31), (SEQ ID NO: 34), (SEQ ID NO: 33) in the Y chain can form a 20nt complementary tetravalent nucleic acid aptamer or a tetravalent nucleic acid aptamer drug conjugate; (SEQ ID NO: 8), (SEQ ID NO: 10), (SEQ ID NO: 11) in the X chain and (SEQ ID NO: 31), (SEQ ID NO: 34), (SEQ ID NO: 33) in the Y chain (SEQ ID NO: 11), (SEQ ID NO: 12), (SEQ ID NO: 13) and (SEQ ID NO: 31), (SEQ ID NO: 34), (SEQ ID NO: 36), (SEQ ID NO: 35), (SEQ ID NO: 37) in the Y chain can form a 20nt complementary pentavalent nucleic acid aptamer or a 5-valent nucleic acid aptamer drug conjugate through base complementarity; (SEQ ID NO: 8), (SEQ ID NO: 10), (SEQ ID NO: 11), (SEQ ID NO: 12), (SEQ ID NO: 13), (SEQ ID NO: 14) in the X chain and (SEQ ID NO: 31), (SEQ ID NO: 34), (SEQ ID NO: 38), (SEQ ID NO: 35), (SEQ ID NO: 37), (SEQ ID NO: 39) in the Y chain can form a 20nt complementary hexavalent nucleic acid aptamer or a hexavalent nucleic acid aptamer drug conjugate through base complementarity.
[0084] Among them, (SEQ ID NO: 15) and (SEQ ID NO: 16) in the X chain can form a 26 nt complementary bivalent nucleic acid aptamer or a bivalent nucleic acid aptamer drug conjugate through base complementarity; (SEQ ID NO: 15), (SEQ ID NO: 17), (SEQ ID NO: 18) in the X chain and (SEQ ID NO: 40), (SEQ ID NO: 41), (SEQ ID NO: 42) in the Y chain can form a 26 nt complementary trivalent nucleic acid aptamer or a trivalent nucleic acid aptamer drug conjugate through base complementarity; (SEQ ID NO: 15), (SEQ ID NO: 17), (SEQ ID NO: 18), (SEQ ID NO: 19) in the X chain and (SEQ ID NO: 40), (SEQ ID NO: 43), (SEQ ID NO: 42), (SEQ ID NO: 44) in the Y chain can form a 26 nt complementary tetravalent nucleic acid aptamer or a tetravalent nucleic acid aptamer drug conjugate through base complementarity; (SEQ ID NO: 15), (SEQ ID NO: 17), (SEQ ID NO: 18), (SEQ ID NO: 19) in the X chain and (SEQ ID NO: 40), (SEQ ID NO: 43), (SEQ ID NO: 42), (SEQ ID NO: 44) in the Y chain can form a 26 nt complementary tetravalent nucleic acid aptamer or a tetravalent nucleic acid aptamer drug conjugate; (SEQ ID NO: 15), (SEQ ID NO: 17), (SEQ ID NO: 18), (SEQ ID NO: 19) in the X chain and (SEQ ID NO: 40), (SEQ ID NO: 43), (SEQ ID NO: 42), (SEQ ID NO: 44) in the Y chain NO: 17), (SEQ ID NO: 18), (SEQ ID NO: 19), (SEQ ID NO: 20) and (SEQ ID NO: 40), (SEQ ID NO: 43), (SEQ ID NO: 45), (SEQ ID NO: 44), (SEQ ID NO: 46) in the Y chain can form a 26nt complementary pentavalent nucleic acid aptamer or a pentavalent nucleic acid aptamer drug conjugate through base complementarity; (SEQ ID NO: 15), (SEQ ID NO: 17), (SEQ ID NO: 18), (SEQ ID NO: 19), (SEQ ID NO: 20), (SEQ ID NO: 21) in the X chain and (SEQ ID NO: 40), (SEQ ID NO: 43), (SEQ ID NO: 47), (SEQ ID NO: 44), (SEQ ID NO: 46), (SEQ ID NO: 48) in the Y chain can form a 26nt complementary hexavalent nucleic acid aptamer or a hexavalent nucleic acid aptamer drug conjugate through base complementarity.
[0085] In another aspect, the present invention provides a multivalent nucleic acid aptamer-drug conjugate, comprising the multivalent nucleic acid aptamer as described above and at least one drug.
[0086] Furthermore, the drug includes any one or more of cytotoxic drugs, immune agonists, small molecule targeted drugs, immune checkpoint inhibitors, and hormone drugs, including but not limited to any one or more of MMAE, T785, di-ABZI, SR07, Crizotinb, Palbociclib, MK1775, MK2206, AZD7762, Ceritinib, Navitoclax, Dasatinib and Exatecan.
[0087] In another aspect, the present invention provides a method for preparing a programmable multivalent nucleic acid aptamer based on uniform outward divergence from the center, the method comprising the following steps:
[0088] (1) constructing a nucleic acid aptamer unit with an X chain connected to the 5' end;
[0089] (2) constructing a Y chain and constructing a central scaffold through the Y chain; the X chain can be complementary to at least a portion of the sequence in the Y chain;
[0090] (3) Reaction-linking the nucleic acid aptamer unit with the central scaffold to construct a multivalent nucleic acid aptamer.
[0091] In some embodiments, step (3) comprises the following steps:
[0092] 1) Dilute the aptamer and its scaffold to 2 μM, add 10× T4 DNA Ligase Buffer (Tris-HCl (pH 7.6) containing MgCl2, DTT, ATP, and [32P]-Na4P2O7 in T4 ligase buffer to a final concentration of 1×), and finally add an appropriate amount of ddH2O to a final DNA concentration of 1 μM. After the required system is configured, preheat on a PCR instrument for 5 minutes to fully denature the DNA and completely open the secondary structure. Then enter pairing, maintain the annealing program at 0.1°C / s, and finally maintain at 4°C for 5 minutes.
[0093] 2) Add 5 U / μl of T4 DNA ligase to the reaction mixture in step 1) and incubate at 16°C for 4 h to allow the DNA gaps to fully connect.
[0094] 3) Add 10× Exonuclease I buffer and 10× Exonuclease II buffer to the T4 ligation reaction system in step 2) to dilute it to 1×, add Exonuclease I and Exonuclease II, and incubate at 37°C for 1 hour to cleave the remaining unligated nucleic acid aptamer, unligated DNA scaffold, and multivalent nucleic acid aptamer that has not formed a closed structure.
[0095] In some embodiments, the method further comprises step (4) of purifying the multivalent nucleic acid aptamer, comprising the following steps:
[0096] 1) Add 2 volumes of DNA extract to the final cut DNA system, vortex thoroughly, centrifuge at 10,000 rpm for 10 minutes, aspirate the supernatant aqueous phase, and discard the middle protein layer and the lower organic phase;
[0097] 2) Repeat step 1) to fully remove various enzymes and other protein impurities in the system. Add 1 / 10 volume of 3M sodium acetate (pH 5.6) and 2.5 volumes of anhydrous ethanol to the supernatant, and let it stand at -40°C to fully precipitate for more than 1 hour;
[0098] 3) Balance the fully precipitated DNA system and centrifuge at 4°C, 13,300 rpm for 30 min to allow the DNA precipitate to accumulate at the bottom of the tube. Discard the supernatant.
[0099] 4) Rinse thoroughly with 70% ethanol to dissolve and remove salt and other impurities in the DNA, allowing the DNA precipitate to accumulate at the bottom of the tube and discard the supernatant;
[0100] 5) Repeat step 4), discard the supernatant, let it stand at room temperature for 15 minutes, dry the DNA precipitate, and add an appropriate amount of ddH2O to fully dissolve it to obtain a preliminarily purified DNA solution;
[0101] 6) Select an ultrafiltration tube with a corresponding molecular weight according to the molecular weight of the multivalent nucleic acid aptamer and perform ultrafiltration at 6000 rpm for 20 min / time. Repeat the ultrafiltration three times to obtain the final purified multivalent nucleic acid aptamer solution.
[0102] In another aspect, the present invention provides a method for preparing a multivalent nucleic acid aptamer-drug conjugate, comprising the following steps:
[0103] (a) constructing a drug modified with a third group, wherein the third group is capable of coupling with the second group;
[0104] (b) constructing a nucleic acid aptamer unit with an X chain connected to the 5' end, wherein the X chain is modified with a second group;
[0105] (c) a coupling reaction between the drug modified with the third group and the aptamer unit modified with the second group to produce an aptamer unit-drug conjugate;
[0106] (d) Reaction-linking the aptamer-drug conjugate with the central scaffold to construct a multivalent aptamer-drug conjugate.
[0107] In some embodiments, the method comprises the following steps:
[0108] (a) Val-Cit-PAB modification of drugs: 1 g (1 eq) of boc-val-cit was dissolved in 60 mL of a 2:1 solution of DCM:MeOH (dichloromethane:methanol). 1.2 eq of p-aminobenzyl alcohol and 2 eq of EEDQ (2-ethoxy-1-ethoxycarbonyl-1,2-dihydroquinoline) were added. The mixture was stirred overnight at room temperature in the dark. The mixture was spin-dried and passed through a column. 100 mg of boc-val-cit-pab was dissolved in 10 mL of DCM. 1 mL of TFA was added. The mixture was stirred for 1 h, plated, and then spin-dried. 100 mg of val-cit-pab was dissolved in 9 mL of a 2:1 solution of DCM:MeOH. 1.2 eq of azidopentanoic acid and 2 eq of EEDQ were added. The mixture was stirred overnight at room temperature in the dark. The mixture was spin-dried and passed through a column. Dissolve 100mg of Val-cit-pab-N3 (2eq) in 10ml of ultra-dry DMF, add 2ml of triethylamine, dissolve NPC1 in 1ml of ultra-dry DCM, and add the reaction mixture under ice. Stir overnight at room temperature. Plate using a 9:1 DCM:MEOH ratio. After the reaction is complete, dissolve 1eq of the drug in 1ml of ultra-dry DMF, add 0.5ml of DIPEA, and sonicate. Once dissolved, add the mixture to the reaction mixture and let it sit overnight at room temperature.
[0109] (b) Adding the Val-Cit-PAB-modified drug to the DBCO-modified aptamer (amount: 2:1) and rotating overnight to form a monovalent DNA drug conjugate complex;
[0110] (c) The desired monovalent DNA drug conjugate complex and its scaffold were diluted to 2 μM, and 10× T4 DNA Ligase Buffer (Tris-HCl (pH 7.6) containing MgCl2, DTT, ATP, and [32P]-Na4P2O7) was added to give a final concentration of 1×. Finally, an appropriate amount of ddH2O was added to give a final DNA concentration of 1 μM. After the desired system was configured, it was preheated on a PCR instrument for 5 minutes to fully denature the DNA and completely open the secondary structure. Then, the pairing was initiated, and the annealing program was maintained at 0.1°C / s. Finally, the reaction was maintained at 4°C for 5 minutes.
[0111] (d) Add 5 U / μl of T4 DNA ligase to the reaction mixture in step 1) and incubate at 16°C for 4 h to allow for full ligation of the DNA gaps.
[0112] (e) Add 10× Exonuclease I buffer and 10× Exonuclease II buffer to the T4 ligation reaction system in step 2) to dilute it to 1×, add Exonuclease I and Exonuclease II, and incubate at 37°C for 1 hour to cleave the remaining unligated aptamers, unligated DNA scaffolds, and multivalent aptamer-drug conjugates that have not formed a closed structure;
[0113] (f) incubating the obtained multivalent nucleic acid aptamer-drug conjugate at 95° C. for 5 min to inactivate enzymes and other proteins in the system;
[0114] (g) Ultrafiltration was performed using an ultrafiltration tube with a corresponding molecular weight according to the molecular weight of the multivalent nucleic acid aptamer drug conjugate. The ultrafiltration was repeated three times at 6000 rpm for 20 min / time to obtain the final purified multivalent nucleic acid aptamer drug conjugate solution.
[0115] In another aspect, the present invention provides a method for preparing a programmable multivalent nucleic acid aptamer-drug conjugate, wherein the method is prepared by conjugating the multivalent nucleic acid aptamer and the drug as described above, and comprises the following steps:
[0116] (A) selecting a drug and constructing a drug modified with a third group that can be coupled to the second group;
[0117] (B) selecting a nucleic acid aptamer and constructing a nucleic acid aptamer unit having an X chain connected to the 5' end, wherein the X chain is modified with a second group;
[0118] (C) a coupling reaction between the drug modified with the third group and the aptamer unit modified with the second group to produce an aptamer unit-drug conjugate;
[0119] (D) reacting and linking the aptamer-drug conjugate with the central scaffold to construct a multivalent aptamer-drug conjugate;
[0120] The programmable includes any one or more of the type of nucleic acid aptamer, the type of drug, and the connection position between the drug and the nucleic acid aptamer, which can be freely selected.
[0121] The multivalent nucleic acid aptamer or multivalent nucleic acid aptamer drug conjugate provided by the present invention can pre-program the type of nucleic acid aptamer, the type of drug, the connection position between the drug and the nucleic acid aptamer, etc. as needed. In the process of preparing the nucleic acid aptamer unit, the required nucleic acid aptamer can be selected first, the drugs to be coupled can be coupled first, and then together with the Y chain, the synthesis of the central scaffold and the construction of the multivalent nucleic acid aptamer or multivalent nucleic acid aptamer drug conjugate can be completed in one go. Therefore, the present invention proposes the concept of programmable multivalent nucleic acid aptamer and programmable multivalent nucleic acid aptamer drug conjugate, which is a brand-new concept in the field and is difficult to achieve with existing multivalent nucleic acid aptamers.
[0122] The multivalent aptamers provided by the present invention are freely programmable, primarily due to their structure radiating uniformly from a center. Consequently, each aptamer is positioned uniformly, without specific distinctions, eliminating the need to consider the placement of different aptamers. Furthermore, the method provided by the present invention allows both the aptamers and drugs to be pre-programmed and then synthesized in one go, making the programming process more convenient, simple, and controllable.
[0123] In another aspect, the present invention provides use of the multivalent nucleic acid aptamer or the multivalent nucleic acid aptamer-drug conjugate as described above in preparing anti-tumor drugs.
[0124] In another aspect, the present invention provides a use of a central scaffold for preparing a programmable multivalent nucleic acid aptamer and / or a multivalent nucleic acid aptamer-drug conjugate, wherein the programmability includes any one or more of the type of nucleic acid aptamer, the type of drug, and the connection position between the drug and the nucleic acid aptamer, which can be freely selected; the central scaffold is connected to a nucleic acid aptamer unit to prepare a multivalent nucleic acid aptamer, wherein the nucleic acid aptamer unit contains one nucleic acid aptamer; the central scaffold is connected to a nucleic acid aptamer unit-drug conjugate to prepare a multivalent nucleic acid aptamer-drug conjugate, wherein the nucleic acid aptamer unit-drug conjugate contains one nucleic acid aptamer and is conjugated to a drug.
[0125] In another aspect, the present invention provides use of the multivalent nucleic acid aptamer as described above for preparing a reagent for improving the stability of multivalent nucleic acid aptamer-drug conjugates and enhancing the anti-tumor effect.
[0126] The programmable multivalent nucleic acid aptamer, preparation method, and application provided by the present invention have the following beneficial effects:
[0127] (1) A novel preparation method for multivalent nucleic acid aptamers based on uniformly diverging from the center to the surrounding area is provided. The construction method is simple and has better stability, affinity and targeting. By carrying chemotherapy drugs and immune agonists, multivalent nucleic acid aptamer-drug conjugates are formed, which can improve the targeting, stability and long-term circulation ability in tumor treatment, providing an innovative solution for multi-drug precision targeted therapy of tumors.
[0128] (2) There is no positional difference between each nucleic acid aptamer in the multivalent nucleic acid aptamer, the performance is more stable and controllable, and it has a more stable targeting effect; it is mainly connected by base complementary connection. Compared with other connection methods through modified groups, the multivalent nucleic acid aptamer structure constructed by base complementary connection is more stable and has better multiple targeting effects;
[0129] (2) The concept of programmable multivalent aptamers and their drug conjugates was proposed for the first time. During the construction of multivalent aptamers or multivalent aptamer-drug conjugates, the type, valence, size, type of drug, connection position of drug and aptamer, etc. of the aptamers can be pre-edited as needed, and then combined with the central scaffold to prepare multivalent aptamers or multivalent aptamer-drug conjugates. The combination and ratio of aptamers and their drug complexes can be precisely controlled to achieve multiple targeting and drug synergy.
[0130] (3) Compared with tandem multivalent nucleic acid aptamers or multivalent nucleic acid aptamers prepared with circular nucleic acids, it has better affinity and targeting for various tumor cells that highly express c-Met protein, and can achieve the effect of precise tumor targeting;
[0131] (4) Based on the uniformly diverging shape from the center to the surroundings, the position of each nucleic acid aptamer is evenly distributed. Compared with tandem multivalent nucleic acid aptamers or multivalent nucleic acid aptamers prepared with circular nucleic acids, they have better stability, can effectively resist the degradation of ribozymes in serum, achieve long-term circulation in the blood, and stabilize the targeting effect. BRIEF DESCRIPTION OF THE DRAWINGS
[0132] Figure 1 The schematic diagram of the construction principle of the central scaffold, wherein (1) is the central scaffold of a trivalent nucleic acid aptamer; (2) is the central scaffold of a tetravalent nucleic acid aptamer; (3) is the central scaffold of a pentavalent nucleic acid aptamer; (4) is the central scaffold of a hexavalent nucleic acid aptamer;
[0133] Figure 2 The schematic diagram of the construction principle of multivalent nucleic acid aptamers, wherein (1) is a trivalent nucleic acid aptamer; (2) is a tetravalent nucleic acid aptamer; (3) is a pentavalent nucleic acid aptamer; (4) is a hexavalent nucleic acid aptamer;
[0134] Figure 3 This is a schematic diagram of the design principle of the multivalent nucleic acid aptamer in Example 1;
[0135] Figure 4 This is a schematic diagram of the design principle of the multivalent nucleic acid aptamer drug conjugate in Example 2;
[0136] Figure 5 This is the electrophoresis analysis result of the multivalent nucleic acid aptamer and its drug conjugate in Example 3;
[0137] Figure 6 This is a graph showing the particle size measurement analysis results of the multivalent nucleic acid aptamer and its drug conjugate in Example 3;
[0138] Figure 7 This is a diagram showing the circular dichroism spectrometer analysis results of the multivalent nucleic acid aptamer and its drug conjugate in Example 3;
[0139] Figure 8This is a cryo-electron microscopy analysis result of the multivalent nucleic acid aptamer drug conjugate in Example 3, wherein Figure 8 (1) The left side shows the shape of the bivalent nucleic acid aptamer drug conjugate. Figure 8 (1) The right side shows the shape of the trivalent nucleic acid aptamer drug conjugate. Figure 8 (2) The left side shows the shape of the tetravalent nucleic acid aptamer drug conjugate. Figure 8 (2) The right side shows the shape of the pentavalent nucleic acid aptamer drug conjugate. Figure 8 (3) is the shape of the hexavalent nucleic acid aptamer drug conjugate;
[0140] Figure 9 This is a graph showing the stability analysis results of the multivalent nucleic acid aptamer and its drug conjugate in serum in Example 3;
[0141] Figure 10 This is a graph showing the results of flow cytometry studies on the binding ability and specificity of multivalent nucleic acid aptamers to target cells in Example 4;
[0142] Figure 11 This is a graph showing the results of confocal imaging analysis of the endocytosis of multivalent nucleic acid aptamers in target cells in Example 5;
[0143] Figure 12 This is a schematic diagram of the in vivo imaging results of the multivalent nucleic acid aptamer in Example 6;
[0144] Figure 13 Schematic diagram of the in vivo imaging results of the multivalent nucleic acid aptamer in Example 6 in various organs of a living body;
[0145] Figure 14 Schematic diagram of the cytotoxicity analysis results of the multivalent nucleic acid aptamer drug complex in Example 7. DETAILED DESCRIPTION
[0146] The present invention will be described in further detail below with reference to the accompanying drawings and examples. It should be noted that the following examples are intended to facilitate understanding of the present invention and do not limit it in any way. The experimental reagents, consumables, and experimental instruments used in the following examples are all commercially available products unless their sources are stated.
[0147] Example 1: Preparation of multivalent nucleic acid aptamers
[0148] The DNA chains used in this example were purchased from Sangon Biotech (Shanghai) Co., Ltd., wherein the design principle of multivalent nucleic acid aptamers is as follows: Figure 3 shown.
[0149] The preparation process of the multivalent nucleic acid aptamer provided in this embodiment is as follows:
[0150] 1. Preparation of bivalent nucleic acid aptamers
[0151] (1) constructing a nucleic acid aptamer unit with an X chain connected to the 5' end;
[0152] A nucleic acid aptamer unit with an X1 chain (SEQ ID NO: 1) connected to the 5' end was constructed, and the sequence was as follows:
[0153] ACTTGAGTGACGGATCAGGCTGGATGGTAGCTCGGTCGGGGTGGGTGGGTTGGCAAGTCTG
[0154] Constructing a nucleic acid aptamer unit with an X2 chain (SEQ ID NO: 2) connected to the 5' end:
[0155] CCGTCACTCAAGT ATCAGGCTGGATGGTAGCTCGGTCGGGGTGGGTGGGTTGGCAAGTCTG AT
[0156] The above is the case where the complementary X chain length is 13 nt. In this example, nucleic acid aptamer units with X chain lengths of 20 nt and 26 nt were also prepared.
[0157] The nucleic acid aptamer unit with a length of 20 nt of X chain was constructed by using (SEQ ID NO: 8) and (SEQ ID NO: 9) in X chain, respectively, and the nucleic acid aptamer unit with X chain connected to the 5' end was constructed.
[0158] The nucleic acid aptamer unit with a length of 20 nt of X chain was constructed by using (SEQ ID NO: 15) and (SEQ ID NO: 16) in X chain, respectively, and the nucleic acid aptamer unit with X chain connected to the 5' end was constructed.
[0159] (2) Dilute the two nucleic acid aptamer units of 13nt, 20nt and 26nt to 2μM respectively (the mass ratio of the two nucleic acid aptamer units is 1:1), add 10×T4 DNA Ligase Buffer, T4 ligase buffer contains MgCl2, DTT, ATP and [32P]-Na4P2O7 Tris-HCl (pH7.6), so that the final concentration is 1× (1 times concentration), and finally add appropriate amount of ddH2O to form a final DNA concentration of 1μM. After the required system is configured, preheat it on the PCR instrument for 5 minutes to fully denature the DNA and open all the secondary structures, and then enter the pairing process, so that the annealing program is maintained at 0.1℃ / s, and finally maintained at 4℃ for 5 minutes. Add T4 DNA ligase was added to the reaction system at a rate of 5 U / μl, and incubated at 16°C for 4 hours to fully connect the DNA gaps; 10× exonuclease I buffer and 10× exonuclease II buffer were added to the T4 ligation reaction system to dilute it to 1×, exonuclease I and exonuclease II were added, and the reaction was incubated at 37°C for 1 hour to cut the remaining unconnected nucleic acid aptamers, unconnected DNA scaffolds and multivalent nucleic acid aptamers that did not form a closed structure; 2 volumes of DNA extract were added to the final cut DNA system, vortexed thoroughly, centrifuged at 10,000 rpm for 10 minutes, the supernatant aqueous phase was aspirated, and the middle protein layer and the lower organic phase were discarded; various enzymes and other protein impurities in the system were fully removed, and 1 / After adding 10 volumes of 3M sodium acetate (pH 5.6) and 2.5 volumes of anhydrous ethanol, the mixture was allowed to stand at -40°C for sufficient precipitation for more than 1 hour; the fully precipitated DNA system was balanced, centrifuged at 4°C, 13300 rpm, for 30 minutes, so that the DNA precipitate accumulated at the bottom of the tube, and the supernatant was discarded; the mixture was fully rinsed with 70% ethanol to dissolve and remove salts and other impurities in the DNA, so that the DNA precipitate accumulated at the bottom of the tube, and the supernatant was discarded; the mixture was allowed to stand at room temperature for 15 minutes, the DNA precipitate was dried, and an appropriate amount of ddH2O was added to fully dissolve it to obtain a preliminarily purified DNA solution; an ultrafiltration tube with a corresponding molecular weight was selected according to the molecular weight of the multivalent nucleic acid aptamer for ultrafiltration, at 6000 rpm, 20 minutes / time, and the ultrafiltration was repeated three times to obtain the final purified divalent nucleic acid aptamer solution.
[0160] 2. Preparation of trivalent to hexavalent aptamers
[0161] In this embodiment, 13 nt, 20 nt, and 26 nt are used for complementary connection. The schematic diagram of the construction process is shown in FIG. Figures 1 to 3 shown.
[0162] 2.1, 13nt complementary connection
[0163] (1) Construction of trivalent nucleic acid aptamers
[0164] (SEQ ID NO: 1), (SEQ ID NO: 3), and (SEQ ID NO: 4) in the X chain were connected to the 5' end of the nucleic acid aptamer ATCAGGCTGGATGGTAGCTCGGTCGGGGTGGGTGGGTTGGCAAGTCTGAT, respectively, to obtain three nucleic acid aptamer units for constructing a trivalent nucleic acid aptamer;
[0165] The central scaffold can be prepared by base complementation using (SEQ ID NO: 22), (SEQ ID NO: 23), and (SEQ ID NO: 24) in the Y chain, respectively. The synthetic flow chart is shown in FIG. Figure 1 .
[0166] (1) Preparation of trivalent nucleic acid aptamers: dilute the three nucleic acid aptamer units and the central scaffold to 2 μM respectively (three nucleic acid aptamers: central scaffold = 1:1:1:(1-4)), add 10×T4 DNA Ligase Buffer, T4 ligase buffer contains MgCl2, DTT, ATP and [32P]-Na4P2O7 Tris-HCl (pH7.6) to make the final concentration 1×, finally add appropriate amount of ddH2O to make the final DNA concentration 1 μM, after the required system is configured, preheat on the PCR instrument for 5 minutes to make the DNA fully denatured and the secondary structure fully opened, then enter the pairing, keep the annealing program at 0.1℃ / s, and finally keep it at 4℃ for 5 minutes. Add T4 DNA ligase was added to the reaction system at a rate of 5 U / μl, and incubated at 16°C for 4 hours to fully connect the DNA gaps; 10× exonuclease I buffer and 10× exonuclease II buffer were added to the T4 ligation reaction system to dilute it to 1×, exonuclease I and exonuclease II were added, and the reaction was incubated at 37°C for 1 hour to cut the remaining unconnected nucleic acid aptamers, unconnected DNA scaffolds and multivalent nucleic acid aptamers that did not form a closed structure; 2 volumes of DNA extract were added to the final cut DNA system, vortexed thoroughly, centrifuged at 10,000 rpm for 10 minutes, the supernatant aqueous phase was aspirated, and the middle protein layer and the lower organic phase were discarded; various enzymes and other protein impurities in the system were fully removed, and 1 / After adding 10 volumes of 3M sodium acetate (pH 5.6) and 2.5 volumes of anhydrous ethanol, the mixture was allowed to stand at -40°C for more than 1 hour to fully precipitate. The fully precipitated DNA system was balanced, centrifuged at 4°C, 13300 rpm, and 30 minutes to allow the DNA precipitate to accumulate at the bottom of the tube, and the supernatant was discarded. The mixture was fully rinsed with 70% ethanol to dissolve and remove salts and other impurities in the DNA, allowing the DNA precipitate to accumulate at the bottom of the tube, and the supernatant was discarded. The mixture was allowed to stand at room temperature for 15 minutes, the DNA precipitate was dried, and an appropriate amount of ddH2O was added to fully dissolve it to obtain a preliminarily purified DNA solution. According to the molecular weight of the multivalent nucleic acid aptamer, an ultrafiltration tube with a corresponding molecular weight was selected for ultrafiltration, and the ultrafiltration was repeated 3 times at 6000 rpm for 20 minutes per time to obtain the final purified trivalent nucleic acid aptamer solution.
[0167] (2) Construction of tetravalent nucleic acid aptamers
[0168] (SEQ ID NO: 1), (SEQ ID NO: 3), (SEQ ID NO: 4), and (SEQ ID NO: 5) in the X chain were connected to the 5' end of the nucleic acid aptamer ATCAGGCTGGATGGTAGCTCGGTCGGGGTGGGTGGGTTGGCAAGTCTGAT, respectively, to construct four nucleic acid aptamer units for constructing a tetravalent nucleic acid aptamer;
[0169] The central scaffold can be prepared by base complementation using (SEQ ID NO: 22), (SEQ ID NO: 25), (SEQ ID NO: 24), and (SEQ ID NO: 26) in the Y chain, respectively. The synthetic flow chart is shown in FIG. Figure 1 .
[0170] Preparation of tetravalent nucleic acid aptamers: The preparation method is consistent with the above-mentioned trivalent nucleic acid aptamer preparation method, wherein the four nucleic acid aptamer units and the central scaffold are diluted to 2 μM respectively (four nucleic acid aptamers: central scaffold = 1:1:1:(1-4)).
[0171] (3) Construction of pentavalent nucleic acid aptamers
[0172] (SEQ ID NO: 1), (SEQ ID NO: 3), (SEQ ID NO: 4), (SEQ ID NO: 5), and (SEQ ID NO: 6) in the X chain were connected to the 5' end of the nucleic acid aptamer ATCAGGCTGGATGGTAGCTCGGTCGGGGTGGGTGGGTTGGCAAGTCTGAT, respectively, to construct five nucleic acid aptamer units for constructing a pentavalent nucleic acid aptamer;
[0173] The central scaffold can be prepared by base complementation using (SEQ ID NO: 22), (SEQ ID NO: 25), (SEQ ID NO: 27), (SEQ ID NO: 26), and (SEQ ID NO: 28) in the Y chain, respectively. The synthetic flow chart is shown in FIG. Figure 1 .
[0174] Preparation of pentavalent nucleic acid aptamers: The preparation method is consistent with the above-mentioned trivalent nucleic acid aptamer preparation method, wherein the five nucleic acid aptamer units and the central scaffold are diluted to 2 μM respectively (five nucleic acid aptamers: central scaffold = 1:1:1:1:1:(1-4)).
[0175] (4) Construction of hexavalent nucleic acid aptamers
[0176] (SEQ ID NO: 1), (SEQ ID NO: 3), (SEQ ID NO: 4), (SEQ ID NO: 5), (SEQ ID NO: 6), and (SEQ ID NO: 7) in the X chain were connected to the 5' end of the nucleic acid aptamer ATCAGGCTGGATGGTAGCTCGGTCGGGGTGGGTGGGTTGGCAAGTCTGAT, respectively, to obtain six nucleic acid aptamer units for constructing a hexavalent nucleic acid aptamer;
[0177] The central scaffold can be prepared by base complementation using (SEQ ID NO: 22), (SEQ ID NO: 25), (SEQ ID NO: 29), (SEQ ID NO: 26), (SEQ ID NO: 28), and (SEQ ID NO: 30) in the Y chain, respectively. The synthetic flow chart is shown in FIG. Figure 1 .
[0178] Preparation of hexavalent nucleic acid aptamers: The preparation method is consistent with the above-mentioned trivalent nucleic acid aptamer preparation method, wherein the six nucleic acid aptamer units and the central scaffold are diluted to 2 μM respectively (six nucleic acid aptamer units: central scaffold = 1:1:1:1:1:1:(1-4)).
[0179] 2.2, 20nt complementary ligation
[0180] (1) Construction of trivalent nucleic acid aptamers
[0181] (SEQ ID NO: 8), (SEQ ID NO: 10), and (SEQ ID NO: 11) in the X chain were connected to the 5' end of the nucleic acid aptamer ATCAGGCTGGATGGTAGCTCGGTCGGGGTGGGTGGGTTGGCAAGTCTGAT, respectively, to construct three nucleic acid aptamer units for constructing a trivalent nucleic acid aptamer;
[0182] The central scaffold can be prepared by base complementation using (SEQ ID NO: 31), (SEQ ID NO: 32), and (SEQ ID NO: 33) in the Y chain, respectively. The synthetic flow chart is shown in FIG. Figure 1 .
[0183] Preparation of trivalent nucleic acid aptamers: The preparation method is consistent with the above-mentioned trivalent nucleic acid aptamer preparation method, wherein the three nucleic acid aptamer units and the central scaffold are diluted to 2 μM respectively (three nucleic acid aptamers: central scaffold = 1:1:1:(1-4)).
[0184] (2) Construction of tetravalent nucleic acid aptamers
[0185] (SEQ ID NO: 8), (SEQ ID NO: 10), (SEQ ID NO: 11), and (SEQ ID NO: 12) in the X chain were connected to the 5' end of the nucleic acid aptamer ATCAGGCTGGATGGTAGCTCGGTCGGGGTGGGTGGGTTGGCAAGTCTGAT, respectively, to obtain four nucleic acid aptamer units for constructing a tetravalent nucleic acid aptamer;
[0186] The central scaffold can be prepared by base complementation using (SEQ ID NO: 31), (SEQ ID NO: 34), (SEQ ID NO: 33), and (SEQ ID NO: 35) in the Y chain, respectively. The synthetic flow chart is shown in FIG. Figure 1 .
[0187] Preparation of tetravalent nucleic acid aptamers: The preparation method is consistent with the above-mentioned trivalent nucleic acid aptamer preparation method, wherein the four nucleic acid aptamer units and the central scaffold are diluted to 2 μM respectively (four nucleic acid aptamers: central scaffold = 1:1:1:(1-4)).
[0188] (3) Construction of pentavalent nucleic acid aptamers
[0189] (SEQ ID NO: 8), (SEQ ID NO: 10), (SEQ ID NO: 11), (SEQ ID NO: 12), and (SEQ ID NO: 13) in the X chain were connected to the 5' end of the nucleic acid aptamer ATCAGGCTGGATGGTAGCTCGGTCGGGGTGGGTGGGTTGGCAAGTCTGAT, respectively, to obtain five nucleic acid aptamer units for constructing a pentavalent nucleic acid aptamer;
[0190] The central scaffold can be prepared by base complementation using (SEQ ID NO: 31), (SEQ ID NO: 34), (SEQ ID NO: 36), (SEQ ID NO: 35), and (SEQ ID NO: 37) in the Y chain, respectively. The synthetic flow chart is shown in FIG. Figure 1 .
[0191] Preparation of pentavalent nucleic acid aptamers: The preparation method is consistent with the above-mentioned trivalent nucleic acid aptamer preparation method, wherein the five nucleic acid aptamer units and the central scaffold are diluted to 2 μM respectively (five nucleic acid aptamers: central scaffold = 1:1:1:1:1:(1-4)).
[0192] (3) Construction of hexavalent nucleic acid aptamers
[0193] (SEQ ID NO: 8), (SEQ ID NO: 10), (SEQ ID NO: 11), (SEQ ID NO: 12), (SEQ ID NO: 13), and (SEQ ID NO: 14) in the X chain were connected to the 5' end of the nucleic acid aptamer ATCAGGCTGGATGGTAGCTCGGTCGGGGTGGGTGGGTTGGCAAGTCTGAT, respectively, to obtain six nucleic acid aptamer units for constructing a hexavalent nucleic acid aptamer;
[0194] The central scaffold can be prepared by base complementation using (SEQ ID NO: 31), (SEQ ID NO: 34), (SEQ ID NO: 38), (SEQ ID NO: 35), (SEQ ID NO: 37), and (SEQ ID NO: 39) in the Y chain, respectively. The synthetic flow chart is shown in FIG. Figure 1 .
[0195] Preparation of hexavalent nucleic acid aptamers: The preparation method is consistent with the above-mentioned trivalent nucleic acid aptamer preparation method, wherein the six nucleic acid aptamer units and the central scaffold are diluted to 2 μM respectively (six nucleic acid aptamer units: central scaffold = 1:1:1:1:1:1:(1-4)).
[0196] 2.3, 26nt complementary connection
[0197] (1) Construction of trivalent nucleic acid aptamers
[0198] (SEQ ID NO: 15), (SEQ ID NO: 17), and (SEQ ID NO: 18) in the X chain were connected to the 5' end of the nucleic acid aptamer ATCAGGCTGGATGGTAGCTCGGTCGGGGTGGGTGGGTTGGCAAGTCTGAT, respectively, to obtain three nucleic acid aptamer units for constructing a trivalent nucleic acid aptamer;
[0199] The central scaffold can be prepared by base complementation using (SEQ ID NO: 40), (SEQ ID NO: 41), and (SEQ ID NO: 42) in the Y chain, respectively. The synthetic flow chart is shown in FIG. Figure 1 .
[0200] Preparation of trivalent nucleic acid aptamers: The preparation method is consistent with the above-mentioned trivalent nucleic acid aptamer preparation method, wherein the three nucleic acid aptamer units and the central scaffold are diluted to 2 μM respectively (three nucleic acid aptamers: central scaffold = 1:1:1:(1-4)).
[0201] (2) Construction of tetravalent nucleic acid aptamers
[0202] (SEQ ID NO: 15), (SEQ ID NO: 17), (SEQ ID NO: 18), and (SEQ ID NO: 19) in the X chain were connected to the 5' end of the nucleic acid aptamer ATCAGGCTGGATGGTAGCTCGGTCGGGGTGGGTGGGTTGGCAAGTCTGAT, respectively, to construct four nucleic acid aptamer units for constructing a tetravalent nucleic acid aptamer;
[0203] The central scaffold can be prepared by base complementation using (SEQ ID NO: 40), (SEQ ID NO: 43), (SEQ ID NO: 42), and (SEQ ID NO: 44) in the Y chain, respectively. The synthetic flow chart is shown in FIG. Figure 1 .
[0204] Preparation of tetravalent nucleic acid aptamers: The preparation method is consistent with the above-mentioned trivalent nucleic acid aptamer preparation method, wherein the four nucleic acid aptamer units and the central scaffold are diluted to 2 μM respectively (four nucleic acid aptamers: central scaffold = 1:1:1:(1-4)).
[0205] (3) Construction of pentavalent nucleic acid aptamers
[0206] (SEQ ID NO: 15), (SEQ ID NO: 17), (SEQ ID NO: 18), (SEQ ID NO: 19), and (SEQ ID NO: 20) in the X chain were connected to the 5' end of the nucleic acid aptamer ATCAGGCTGGATGGTAGCTCGGTCGGGGTGGGTGGGTTGGCAAGTCTGAT, respectively, to obtain five nucleic acid aptamer units for constructing a pentavalent nucleic acid aptamer;
[0207] The central scaffold can be prepared by base complementation using (SEQ ID NO: 40), (SEQ ID NO: 43), (SEQ ID NO: 45), (SEQ ID NO: 44), and (SEQ ID NO: 46) in the Y chain, respectively. The synthetic flow chart is shown in FIG. Figure 1 .
[0208] Preparation of pentavalent nucleic acid aptamers: The preparation method is consistent with the above-mentioned trivalent nucleic acid aptamer preparation method, wherein the five nucleic acid aptamer units and the central scaffold are diluted to 2 μM respectively (five nucleic acid aptamers: central scaffold = 1:1:1:1:1:(1-4)).
[0209] (3) Construction of hexavalent nucleic acid aptamers
[0210] (SEQ ID NO: 15), (SEQ ID NO: 17), (SEQ ID NO: 18), (SEQ ID NO: 19), (SEQ ID NO: 20), and (SEQ ID NO: 21) in the X chain were connected to the 5' end of the nucleic acid aptamer ATCAGGCTGGATGGTAGCTCGGTCGGGGTGGGTGGGTTGGCAAGTCTGAT, respectively, to construct six nucleic acid aptamer units for constructing a hexavalent nucleic acid aptamer;
[0211] The central scaffold can be prepared by base complementation using (SEQ ID NO: 40), (SEQ ID NO: 43), (SEQ ID NO: 47), (SEQ ID NO: 44), (SEQ ID NO: 46), and (SEQ ID NO: 48) in the Y chain, respectively. The synthetic flow chart is shown in FIG. Figure 1 .
[0212] Preparation of hexavalent nucleic acid aptamers: The preparation method is consistent with the above-mentioned trivalent nucleic acid aptamer preparation method, wherein the six nucleic acid aptamer units and the central scaffold are diluted to 2 μM respectively (six nucleic acid aptamer units: central scaffold = 1:1:1:1:1:1:(1-4)).
[0213] Example 2: Construction of multivalent nucleic acid aptamer conjugates
[0214] The DNA chains used in this example were purchased from Sangon Biotech (Shanghai) Co., Ltd. The design principle of multivalent nucleic acid aptamer drug conjugates is as follows: Figure 4 The specific method is as follows:
[0215] 1. Val-Cit-PAB modification of drugs
[0216] Dissolve 1g (1 eq) of boc-val-cit in 60ml of a 2:1 solution of dichloromethane:methanol (DCM), add 1.2eq of p-aminobenzyl alcohol and 2eq of EEDQ, and stir overnight at room temperature in the dark. Spin dry and pass through a column. Dissolve 100mg of boc-val-cit-pab in 10ml of DCM, add 1ml of TFA, stir for 1h, plate, and spin dry to purify val-cit-pab.
[0217] 100 mg of val-cit-pab was dissolved in 9 ml of a 2:1 DCM:MeOH solution. 1.2 eq of azidopentanoic acid and 2.0 eq of EEDQ were added, and the mixture was stirred at room temperature in the dark overnight. The mixture was then spin-dried and purified to obtain Val-cit-pab-N3. 100 mg of Val-cit-pab-N3 (2 eq) was dissolved in 10 ml of ultra-dry DMF (dimethylformamide), 2 ml of triethylamine was added, and NPCl (p-nitrophenyl chloroformate) was dissolved in 1 ml of ultra-dry DCM. The reaction mixture was added under ice-cooling. Stirred overnight at room temperature. A DCM:MEOH solution was plated in a 9:1 ratio. After the reaction was complete, 1 eq of the drug was dissolved in 1 ml of ultra-dry DMF, 0.5 ml of DIPEA was added, and the mixture was sonicated. Once dissolved, the mixture was added to the reaction mixture and allowed to stand at room temperature overnight. After the reaction was complete, the drug was spin-dried and purified to obtain the Val-Cit-PAB-modified drug.
[0218] 2. A nucleic acid aptamer unit with an X chain connected to the 5' end prepared according to the method provided in Example 1, wherein the X chain is modified with DBCO (dibenzocyclooctyne) in the middle.
[0219] 3. Add the Val-Cit-PAB-modified drug to the DBCO-modified aptamer prepared in step 2 (amount of substance: 2:1), rotate and shake overnight to form a monovalent aptamer-drug conjugate.
[0220] 4. The desired aptamer unit drug conjugate and its required central scaffold (prepared in Example 1, with central scaffolds and aptamer units of different valencies selected as needed) were diluted to 2 uM, and 10× T4 DNA Ligase Buffer was added. The T4 ligase buffer contained MgCl2, DTT, ATP, and [32P]-Na4P2O7 in Tris-HCl (pH 7.6) to a final concentration of 1×. Finally, an appropriate amount of ddH2O was added to form a final DNA concentration of 1 uM. After the desired system was configured, it was preheated on a PCR instrument for 5 min to fully denature the DNA and completely open the secondary structure. Then, pairing was performed, and the annealing program was maintained at 0.1°C / s, and finally maintained at 4°C for 5 min.
[0221] 5. Add 5U / ul of T4 DNA ligase to the reaction system after step 1 and incubate at 16°C for 4 hours to fully connect the DNA gaps.
[0222] 6. Add 10× exonuclease I buffer and 10× exonuclease II buffer to the system with sufficient T4 ligation reaction in step 2) to dilute it to 1×, add exonuclease I and exonuclease II, and incubate at 37°C for 1 hour to cut the remaining unligated nucleic acid aptamer, unligated DNA scaffold, and multivalent nucleic acid aptamer drug conjugate that has not formed a closed structure.
[0223] 7. Incubate the obtained multivalent nucleic acid aptamer-drug conjugate at 95°C for 5 minutes to inactivate enzymes and other proteins in the system;
[0224] 8. According to the molecular weight of the multivalent nucleic acid aptamer drug conjugate, select an ultrafiltration tube with the corresponding molecular weight for ultrafiltration at 6000 rpm, 20 min / time, and repeat the ultrafiltration three times to obtain the final purified multivalent nucleic acid aptamer drug conjugate solution.
[0225] Example 3: Characterization of multivalent nucleic acid aptamers and their drug conjugates
[0226] This example characterizes the multivalent nucleic acid aptamer prepared in Example 1 and the multivalent nucleic acid aptamer drug conjugate prepared in Example 2:
[0227] After mixing 2 μl of the prepared sample with 2 μl of 2×TBE Sample Buffer, perform electrophoresis analysis using a 5% polyacrylamide nucleic acid denaturing gel and collect the corresponding fluorescence signal using a gel imager. Figure 5 As shown, multivalent nucleic acid aptamers and drug conjugates of different lengths, sizes and types were successfully synthesized and purified.
[0228] In order to characterize the obtained multivalent nucleic acid aptamers and their drug conjugates of different sizes, the prepared samples were measured by using a nanometer particle size analyzer (DLS). The results are as follows: Figure 6 , showing that the particle size of multivalent nucleic acid aptamers and their drug conjugates increases with the increase of length and valence.
[0229] In order to verify whether the multivalent nucleic acid aptamer and its drug conjugate have an effect on the structure of the nucleic acid aptamer, a circular dichroism spectrometer was used to analyze the prepared samples. The results are as follows: Figure 7 , indicating that the multivalent nucleic acid aptamer and its drug conjugates have no significant effect on the secondary structure of the nucleic acid aptamer. It can also be seen that when the complementary sequence is 13nti, the constructed multivalent nucleic acid aptamer and its drug conjugates have the least effect on the secondary structure of the nucleic acid aptamer.
[0230] In order to observe the shape and morphology of the multivalent nucleic acid aptamer drug conjugates intuitively and clearly, cryo-electron microscopy was used to analyze and observe the prepared samples. The results are as follows: Figure 8 ,in Figure 8 (1) The left side shows the shape of the bivalent nucleic acid aptamer drug conjugate. Figure 8 (1) The right side shows the shape of the trivalent nucleic acid aptamer drug conjugate. Figure 8 (2) The left side shows the shape of the tetravalent nucleic acid aptamer drug conjugate. Figure 8 (2) The right side shows the shape of the pentavalent nucleic acid aptamer drug conjugate. Figure 8 (3) is the shape of the hexavalent nucleic acid aptamer drug conjugate. Figure 8 The morphology of the constructed multivalent nucleic acid aptamer drug conjugate can be clearly seen in the figure.
[0231] In order to verify the stability of multivalent nucleic acid aptamers and their drug conjugates in serum, the prepared samples were incubated in 1640 medium containing 10% fetal bovine serum at 37°C for 1 h, 3 h, 6 h, 12 h and 24 h. Figure 9, indicating that multivalent aptamers and their drug conjugates exhibit superior stability in serum compared to monovalent aptamers, remaining stable even after 24 hours of incubation. Furthermore, this example also found that multivalent aptamers prepared with complementary sequences of 13nt, 20nt, and 26nt exhibited significantly better stability than monovalent aptamers. Although 13nt has the fewest complementary bases, the resulting multivalent aptamer structure is more conducive to improved stability.
[0232] Example 4: Flow cytometry study of the binding ability and specificity of multivalent nucleic acid aptamers to target cells
[0233] (1) Cell culture: All cells were cultured in a constant temperature incubator containing 5% carbon dioxide at 37°C. MKN45, HCT116, and THP1 cells were cultured in 1640 medium supplemented with 10% fetal bovine serum and 1% double antibody.
[0234] (2) Cell binding and specificity experiments: The binding ability of multivalent nucleic acid aptamers to gastric cancer cells MKN45 was determined by flow cytometry. 200,000 cells were dispersed in 200ul binding buffer (4.5g / L glucose, 5mM magnesium chloride, 1mg / ml BSA, 0.1mg / ml herring sperm DNA dissolved in DPBS), and a multivalent nucleic acid aptamer (prepared in Example 1, 13nt) with Cy5 fluorescence modification (X chain middle modification Cy5) was added to make the final concentration 200nM. Incubate in the dark at 4°C for 1h. Wash with washing buffer (4.5g / L glucose, 5mM magnesium chloride dissolved in DPBS), centrifuge at 1000rpm for 5min, and repeat 3 times. The cells were dispersed in 200ul washing buffer and analyzed by flow cytometry using a flow cytometer CytoFLEX LX. Random chain and monovalent nucleic acid aptamers were used as negative controls, and HCT116 was used as negative cells. The nucleic acid aptamer equivalents contained in nucleic acid aptamers of different valences are the same, and the final concentration is 200 nM.
[0235] The results are as follows Figure 10 , indicating that the multivalent nucleic acid aptamer of the present invention has a more significant fluorescence intensity in MKN45 cells than the control sequence, specifically binding to MKN45 cells that highly express c-Met protein. In contrast, almost no fluorescence intensity is produced in the control HCT116 cells, with no significant difference. This demonstrates that the multivalent nucleic acid aptamer of the present invention can specifically bind to MKN45 cells, while showing no significant binding to the control HCT116 cells.
[0236] At the same time, according to Figure 10It can also be seen that nucleic acid aptamers with different valencies have different binding abilities to MKN45 cells when containing the same equivalent amount of nucleic acid aptamers. The trivalent nucleic acid aptamer has the strongest binding ability to target cells, followed by the tetravalent nucleic acid aptamer and the pentavalent nucleic acid aptamer.
[0237] This example further compares trivalent aptamers with complementary chains of 13 nt, 20 nt, and 26 nt, respectively. The multivalent aptamers prepared with the three complementary chain lengths have significantly better binding abilities to target cells than the control and monovalent aptamers, among which the 13 nt trivalent aptamer has the best binding ability to target cells.
[0238] Example 5: Confocal imaging analysis of endocytosis of multivalent nucleic acid aptamers in target cells
[0239] In this example, to visualize the endocytosis of multivalent aptamers in MKN45 cells, 100,000 MKN45 cells were seeded in a confocal dish and pre-cultured for 24 hours. The multivalent aptamers were then incubated with the cells in the dark at 37°C for 1 hour and 12 hours. The aptamer equivalents in the aptamers of different valencies were consistent, and the final concentration was 200 nM. Confocal laser scanning microscopy was used for imaging analysis. The results are shown in Figure 2. Figure 11 , indicating that the multivalent nucleic acid aptamer structure can be significantly internalized by cells, and whether incubated for 1h or 12h, the trivalent nucleic acid aptamer is the most significant and has the highest fluorescence intensity in the cells.
[0240] Example 6: Tumor Targeting Ability of Multivalent Aptamers in Vivo
[0241] In vivo fluorescence imaging analysis of multivalent aptamers: To evaluate the in vivo biostability and targeting ability of multivalent aptamers, in vivo small animal imaging experiments were performed using monovalent and trivalent aptamers (13 nt) labeled with the fluorescent small molecule Cy5. The samples were dissolved in DPBS to prepare a 100 μl 2.5 nmol Cy5-labeled solution. The prepared samples were injected into the tail vein of a nude mouse tumor model established with MKN45 gastric cancer cells. Under anesthesia, the mice were imaged and analyzed using an IVIS Spectrum CT in vivo 3D imaging system to observe and analyze their in vivo distribution at different time points.
[0242] In vivo imaging results Figure 12 It can be seen that the monovalent nucleic acid aptamer has a short circulation time in mice and is quickly metabolized by the body, while the trivalent nucleic acid aptamer is more enriched in the tumor than the monovalent one and has a longer retention time, indicating that the multivalent nucleic acid aptamer has good tumor targeting ability and longer circulation ability in the body.
[0243] The results of organ imaging are as follows Figure 13, where T represents tumor, H represents heart, LI represents liver, SP represents spleen, LU represents lung, and K represents kidney, indicating that the monovalent nucleic acid aptamer is quickly metabolized by the body through the kidney and has limited tumor targeting ability, while the trivalent nucleic acid aptamer is mainly metabolized through the liver and kidney, and has obvious enrichment and retention time at the tumor site.
[0244] Example 7: Cytotoxicity Analysis of Multivalent Aptamer-Drug Complexes
[0245] After proving that multivalent nucleic acid aptamers can be specifically internalized by MKN45 cells (Example 6), this example determines the proliferation inhibitory effect of trivalent nucleic acid aptamer drug complexes on MKN45 cells. 5000 MKN45 cells were plated in a 96-well plate and pre-cultured for 24 hours. 5 different concentration gradients of trivalent nucleic acid aptamer MMAE drug complexes (13nt, 3M, 3 nucleic acid aptamers connected to the same drug MMAE) and trivalent nucleic acid aptamer MMAE, T785 and diAZBI drug complexes (13nt, SMT, 3 nucleic acid aptamers connected to different drugs) were used to incubate MKN45 cells for 72 hours. CCK8 was used to determine cell viability and investigate the inhibitory effect. The results are as follows: Figure 14 The left figure shows cell viability after incubation with 3M, and the right figure shows cell viability after incubation with SMT. The IC50 values of the trivalent aptamer MMAE drug complex (3M) are comparable to those of the trivalent aptamer MMAE, T785, and diAZBI drug complex (SMT). The IC50 values of the trivalent aptamer MMAE drug complex (3M) are 7.234 nM, while the IC50 values of the trivalent aptamer MMAE, T785, and diAZBI drug complex (SMT) are 5.649 nM. Both exhibit significant inhibitory effects on the proliferation of MKN45 cells.
[0246] Although the present invention is disclosed as above, the present invention is not limited thereto. Any person skilled in the art can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the scope defined by the claims.
Claims
1. A multivalent nucleic acid aptamer based on uniformly diverging from the center to the surroundings, characterized in that: It comprises at least two interconnected nucleic acid aptamer units, wherein the nucleic acid aptamer unit contains one nucleic acid aptamer; When there are two nucleic acid aptamer units, the two nucleic acid aptamer units are complementary and connected; When there are at least three nucleic acid aptamer units, a central support is further included, and the nucleic acid aptamer units are respectively connected to the central support.
2. The multivalent nucleic acid aptamer according to claim 1, wherein The nucleic acid aptamer unit includes a nucleic acid aptamer and an X chain, one end of the nucleic acid aptamer is connected to the X chain; the X chain is a single nucleotide chain; When there are two nucleic acid aptamer units, the two nucleic acid aptamer units are respectively connected by X strand complementarity; When there are at least three nucleic acid aptamer units, the nucleic acid aptamer units are complementarily connected to the central scaffold through respective X chains.
3. The multivalent nucleic acid aptamer according to claim 2, wherein The central scaffold is composed of at least three Y chains connected in a complementary manner; the Y chain is composed of a first single chain, a second single chain and a third single chain connected in series, wherein the first single chain and the second single chain of any Y chain can be complementary connected to the second single chain and the first single chain of one of the other Y chains, and the third single chain of any Y chain can be complementary connected to the X chain of the nucleic acid aptamer unit.
4. The multivalent nucleic acid aptamer according to claim 3, wherein The 5' end of the nucleic acid aptamer is connected to the X chain; the central support has a third single chain that evenly diverges from the center outward, and the X chain is complementary to the third single chain of the central support.
5. The multivalent nucleic acid aptamer according to claim 4, wherein The 5' ends of the X and Y chains are modified with a first group, so that the 3' end of the nucleic acid aptamer unit and the 5' end of the Y chain, as well as the 5' end of the X chain and the 3' end of the Y chain, are connected or chemically linked to form a closed ring through DNA ligase catalysis, wherein the first group includes any one or more of a phosphate group, a click chemistry reaction between an azide group and a diphenylcyclooctyne group, a click chemistry reaction between an azide group and a cyclooctyne group, a click chemistry reaction between an azide group and an alkynyl group, an addition reaction between a maleimide group and a furan group, an addition reaction between a maleimide group and a sulfhydryl group, a substitution reaction between an NHS ester group and an amino group, an SN2 reaction between a thiophosphate group and a chloroacetyl group, and a condensation reaction between an amino group and a carboxyl group; and the DNA ligase includes at least one of T4 DNA ligase, T7 DNA ligase, and T4 RNA ligase.
6. The multivalent nucleic acid aptamer according to claim 5, wherein The number of bases of the complementary connection is any one or more of 13nt, 20nt, and 26nt.
7. The multivalent nucleic acid aptamer according to claim 6, wherein The X chain is modified with a second group, which includes any one or more of a dibenzocyclooctyne group modification, a click chemistry reaction between an azide group and a diphenylcyclooctyne group, a click chemistry reaction between an azide group and a cyclooctyne group, a click chemistry reaction between an azide group and an alkynyl group, an addition reaction between a maleimide group and a furan group, an addition reaction between a maleimide group and a sulfhydryl group, a substitution reaction between an NHS ester group and an amino group, an SN2 reaction between a thiophosphate group and a chloroacetyl group, and a condensation reaction between an amino group and a carboxyl group; the second group is used to couple drugs or make the multivalent nucleic acid aptamer fluorescent.
8. A multivalent nucleic acid aptamer drug conjugate, characterized in that: The invention comprises the multivalent nucleic acid aptamer according to any one of claims 1 to 7 and at least one drug, wherein the drug comprises any one or more of cytotoxic drugs, immune agonists, small molecule targeted drugs, immune checkpoint inhibitors, and hormone drugs.
9. A method for preparing a multivalent nucleic acid aptamer, characterized in that: The following steps are involved: (1) constructing a nucleic acid aptamer unit with an X chain connected to the 5' end; (2) constructing a Y chain and constructing a central scaffold through the Y chain; the X chain can be complementary to at least a portion of the sequence in the Y chain; (3) Reaction-linking the nucleic acid aptamer unit with the central scaffold to construct a multivalent nucleic acid aptamer.
10. A method for preparing a multivalent nucleic acid aptamer drug conjugate, characterized in that: The following steps are involved: (a) constructing a drug modified with a third group, wherein the third group is capable of coupling with the second group; (b) constructing a nucleic acid aptamer unit with an X chain connected to the 5' end, wherein the X chain is modified with a second group; (c) a coupling reaction between the drug modified with the third group and the aptamer unit modified with the second group to produce an aptamer unit-drug conjugate; (d) Reaction-linking the aptamer-drug conjugate with the central scaffold to construct a multivalent aptamer-drug conjugate.
11. A method for preparing a programmable multivalent nucleic acid aptamer drug conjugate, characterized in that: The following steps are involved: (A) selecting a drug and constructing a drug modified with a third group that can be coupled to the second group; (B) selecting a nucleic acid aptamer and constructing a nucleic acid aptamer unit having an X chain connected to the 5' end, wherein the X chain is modified with a second group; (C) a coupling reaction between the drug modified with the third group and the aptamer unit modified with the second group to produce an aptamer unit-drug conjugate; (D) reacting and linking the aptamer-drug conjugate with the central scaffold to construct a multivalent aptamer-drug conjugate; The programmable includes any one or more of the type of nucleic acid aptamer, the type of drug, and the connection position between the drug and the nucleic acid aptamer, which can be freely selected.
12. Use of the multivalent nucleic acid aptamer according to any one of claims 1 to 7 or the multivalent nucleic acid aptamer-drug conjugate according to claim 8 in the preparation of anti-tumor drugs.
13. Use of the multivalent nucleic acid aptamer according to any one of claims 1 to 7 for preparing an agent for improving the stability of a multivalent nucleic acid aptamer-drug conjugate and enhancing the anti-tumor effect.
Citation Information
Patent Citations
Multivalent nucleic acid as well as preparation method and application thereof
CN118291475A