Application of CsPR5 gene in regulation and control of citrus liberobacter asiaticum resistance
By overexpressing the CsPR5 gene in citrus and constructing a recombinant vector to inhibit the infection and colonization of the citrus Huanglongbing pathogen, the problem of improving citrus Huanglongbing resistance was solved and significant disease resistance effects were achieved.
Patent Information
- Application Number
- CN202510842766.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-23
- Publication Date
- 2025-09-23
AI Technical Summary
Citrus Huanglongbing is caused by Candidatus Liberibacter asiaticus. Existing technologies make it difficult to effectively improve the resistance of citrus, and the infection and colonization of the pathogen are difficult to inhibit.
By overexpressing the CsPR5 gene, constructing a recombinant expression vector and transforming citrus, the early infection and colonization of pathogens can be inhibited, thereby improving the resistance of citrus.
Significantly reduce the infection and colonization of the pathogen CLas, enhance the resistance of citrus to Huanglongbing, and provide a new method for disease-resistant molecular breeding.
Smart Images

Figure CN120683123A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of agricultural biological gene engineering, and in particular to the application of the CsPR5 gene in regulating the resistance to citrus Huanglongbing disease. Background Art
[0002] Citrus Huanglongbing (HLB) is a devastating disease caused by the pathogen Candidatus Liberibacter. Three pathogenic strains are primarily involved: Candidatus Liberibacter africanus (CLaf), Candidatus Liberibacter asiaticus (CLas), and Candidatus Liberibacter americanus (CLam). CLas is the most widespread, primarily transmitted by the Asian citrus psyllid (Diaphorina citri), posing a serious threat to the global citrus industry. Infection with CLas causes characteristic symptoms such as asymmetric leaf yellowing (mottled chlorosis), thickened leaves, dwarfing, and fruit drop, leading to plant death in severe cases. Because the pathogen cannot be cultured in vitro, research is extremely challenging; only its genome has been sequenced. Given the devastating impact of HLB on agricultural production, identifying HLB-resistant germplasm resources is of great economic and social significance.
[0003] Plants employ a two-tiered innate immune system to defend against pathogen invasion, comprising pattern-triggered immunity (PTI) and effector-triggered immunity (ETI). To counteract these defense mechanisms, pathogens secrete effector proteins, which act as virulence factors to suppress or evade host immune responses. Numerous endogenous citrus proteins are targeted by CLas, thereby suppressing citrus immunity. For example, the activity of citrus papain-like cysteine proteases (PLCPs) is inhibited by the effector protein SDE1 (CLIBASIA_05315), thereby promoting CLas proliferation; the CsACD2 protein is targeted by SDE15 (CLIBASIA_04025), suppressing citrus immunity and promoting CLas proliferation; and the citrus glyceraldehyde-3-phosphate dehydrogenase GAPC directly interacts with SDE3 (CLIBASIA_00420), leading to specific inhibition of the ATG8-mediated immune response. Advances in genetic engineering have provided technical tools for citrus disease-resistant breeding, making the search for disease-resistant genes and the development of disease-resistant varieties of great significance.
[0004] Upon pathogen infection, numerous antimicrobial compounds are elicited in host plants as part of their defense mechanisms. These include a group of important antimicrobial proteins, collectively referred to as pathogenesis-associated proteins (PRs). These PRs are both local and systemic and are associated with the development of systemic acquired resistance (SAR) to further infection by pathogens, playing a crucial role in plant defense. Numerous evidence now indicates that PR5 proteins from various plant species possess antifungal activity against several fungi and oomycetes in vitro. The tobacco PR5 protein osmolyte is induced by osmotic stress and pathogens, and its homologs in tomato and potato have been shown to possess in vitro activity against the oomycete Phytophthora infestans. Overexpression of tobacco PR5 in tobacco and potato plants enhances resistance to this pathogen. As an important target protein of pathogen effectors, PR5 positively regulates plant immune responses in plants. However, the role of PR5 in citrus defense against CLas has not been reported. Summary of the Invention
[0005] The purpose of the present invention is to provide an application of the CsPR5 gene in regulating citrus Huanglongbing resistance, by overexpressing the CsPR5 gene, inhibiting the early infection and colonization of the citrus Huanglongbing pathogen, and improving citrus Huanglongbing resistance.
[0006] To achieve the above objectives, the present invention provides an application of the CsPR5 gene in regulating resistance to citrus Huanglongbing disease. The nucleotide sequence of the CsPR5 gene is shown in SEQ ID No. 1.
[0007] Preferably, the regulation of citrus Huanglongbing resistance is achieved by overexpressing the CsPR5 gene, thereby inhibiting the early infection and colonization of the citrus Huanglongbing pathogen and improving citrus Huanglongbing resistance.
[0008] The present invention also provides a recombinant expression vector, which overexpresses the CsPR5 gene.
[0009] The present invention also provides an application of the recombinant expression vector in regulating citrus Huanglongbing resistance, wherein the regulation of citrus Huanglongbing resistance is that the recombinant expression vector overexpresses the CsPR5 gene to inhibit the early infection and colonization of the citrus Huanglongbing pathogen, thereby improving citrus Huanglongbing resistance.
[0010] The present invention also provides a recombinant strain, which includes the recombinant expression vector.
[0011] The present invention also provides an application of the recombinant strain in regulating citrus Huanglongbing resistance, wherein the regulation of citrus Huanglongbing resistance is that the recombinant strain overexpresses the CsPR5 gene to inhibit the early infection and colonization of the citrus Huanglongbing pathogen, thereby improving citrus Huanglongbing resistance.
[0012] The present invention also provides a method for improving the resistance to citrus Huanglongbing, which improves the resistance to citrus Huanglongbing by overexpressing the CsPR5 gene.
[0013] The present invention also provides the use of the CsPR5 gene in preparing a preparation for inhibiting infection by Candidatus Liberibacter asiaticus. The preparation for inhibiting infection by Candidatus Liberibacter asiaticus is applied to citrus to promote overexpression of the CsPR5 gene in citrus, inhibit early infection and colonization of Candidatus Liberibacter asiaticus in citrus, and improve citrus resistance to Huanglongbing disease.
[0014] The present invention also provides a preparation for inhibiting infection by Bacillus asiaticus. The preparation for inhibiting infection by Bacillus asiaticus comprises an effective component that promotes overexpression of the CsPR5 gene in citrus.
[0015] Therefore, the present invention uses the above-mentioned CsPR5 gene in regulating citrus Huanglongbing resistance, and the beneficial technical effects are as follows:
[0016] The present invention improves the resistance of citrus to citrus Huanglongbing based on overexpression of CsPR5, and enhances the resistance of citrus to CLas, the pathogen of citrus Huanglongbing. By cloning the citrus CsPR5 gene, constructing an overexpression vector, and then transforming citrus, the resulting transgenic hairy roots can significantly inhibit the infection and colonization of CLas. Specifically, 12 days after CLas inoculation, the CLas titer in OE-CsPR5 hairy roots was significantly lower than that in WT hairy roots. The present invention provides a method for improving citrus Huanglongbing resistance, which is of great value to the molecular breeding of citrus resistance to Huanglongbing. BRIEF DESCRIPTION OF THE DRAWINGS
[0017] Figure 1 The figure shows the electrophoresis diagram of PCR amplification of CsPR5 gene clone, where Maker represents the DNA molecular weight standard;
[0018] Figure 2 The structure of the CsPR5 gene overexpression vector is shown in Figure 1, where GFP represents green fluorescent protein, CaMV 35S represents a plant constitutive promoter, and nos represents the opine synthase gene terminator.
[0019] Figure 3 This is a flow chart for genetic transformation of citrus hairy roots;
[0020] Figure 4 GFP fluorescence images of transgenic hairy roots, where OE-CsPR5 represents CsPR5 transgenic hairy roots, and pNmGFPer:00 represents empty-transformed hairy roots;
[0021] Figure 5 Figure 1 is the PCR identification diagram of transgenic plants, where P represents plasmid pNM-GFPer-CsPR5;
[0022] Figure 6 The expression level of CsPR5 in transgenic plants was analyzed by t-test compared with pNmGFPer:00, where * indicates p < 0.05, ** indicates p < 0.005, and **** indicates p < 0.0001;
[0023] Figure 7 The number of CLas bacteria detected in transgenic hairy roots 12 days after inoculation. **** indicates p < 0.0001. DETAILED DESCRIPTION
[0024] The technical solution of the present invention is further described below with reference to the accompanying drawings and embodiments.
[0025] Unless otherwise defined, technical or scientific terms used in the present invention shall have the same meaning as commonly understood by one of ordinary skill in the art to which the present invention belongs.
[0026] The Wanjin orange used in the present invention is sourced from the Detoxification Center of the Citrus Research Institute of Southwest University.
[0027] Example 1
[0028] 1. Cloning of the citrus CsPR5 gene.
[0029] 1. RNA extraction and cDNA synthesis:
[0030] Total RNA was extracted from citrus (Wanjincheng) leaves using a plant total RNA extraction kit (Adlai, CAT: RN09). RNA quality was verified by agarose gel electrophoresis and concentration was determined using a concentration meter. cDNA was synthesized using a reverse transcription kit, PrimeScript RTMaster Mix (TaKaRa, CAT: RR036A).
[0031] 2. PCR amplification of CsPR5 coding sequence:
[0032] The CsPR5 gene DNA fragment was amplified from citrus cDNA using primers CsPR5-F (SEQ ID No. 2), CsPR5-R (SEQ ID No. 3) and high-fidelity enzyme PrimeSTARMax DNA Polymerase (TaKaRa, CAT: R045Q). The length of the fragment was 930 bp ( Figure 1The amplified DNA fragment was sequenced and confirmed to be the citrus CsPR5 gene (SEQ ID No. 1). Under ultraviolet light, a clean blade was used to cut out the agarose gel containing the target fragment, and the DNA fragment was recovered using a kit (BioFlux, CAT: BSC02M1).
[0033] PCR amplification program: 94°C, 5 min; 94°C, 30 s, 58°C, 30 s, 72°C, 1 min, 35 cycles; extension at 72°C for 10 min.
[0034] The nucleotide sequence of the citrus CsPR5 gene is shown as SEQ ID No.1, SEQ ID No.1: ATGGCTGACTACACTACTCTGTTTACCCTCAACCTTG CTCTCCTCTTCATTTCAAAAGGTGTAACGGCCGCTACGTTCACATTCGTGAACAAATGCGACTACACAGTCTGGCCTGGAATTCTCGGCTCTCCAAAGCTGGACAGCACCGGCTTTGAACTTCAAAAGGGCGGTTCCCGTTCTTTCCAAGCACCAACCGGCTGGTCAGGTCGCTTCTGGGGCAGAACCGGCTGCAACTTCGACAGCTCAGGCCACGGCTCCTGCGCCACTGCCGACTGCGGCTCCAACCAAGTCGAATGCAACGGAGCCGGCGCAGCCCCGCCTGCCACCTTGGCCGAATTCACCCTCGGCTCCGGTTCACAAGACTTCTACGACGTCAGCCTCGTCGACGGCTATAACATTCCCATAGTTGTTGAAGGGAGTGGAGGATCAGGGGCGTGCGCCCCCACTGGATGTGTAACTGACTTGAACAGAAGCTGCCCCAATGAACTCAGAGTCCAAGGCGGCTGTAGGAGTGCCTGTGAGGCTTTCGGTAACCCCGAGTACTGCTGCAGTGGTTCCTTTAATTCGCCCGCCACCTGTAAGCCCTCCATGTACTCATCCATTTTCAAGAACGCATGTCCCAAATCTTATAGCTATGCCTACGATGATGCCACCAGTACTTTCACTTGTACTGCTGCTGATTACACCATCACATTTTGTCCCAGTTCACCCAGTTTGAAGTCAGCTAGTAATTCTAATTCATCTCCAAATACTGGAGCAGAAACCGGGTCGGATTCGGAGCCAGCTGTACAGGCTGATTCATTAGCTGATAGTTCATGGTTAGCGGAATTGGCCGTCAATGGGGATTCCACAAGAAGCCATCCTTCTTTTGCTATGCAATACGCTCTTGTTCTGGGTTTTTCCCTCTTTCTCGTGTTCTTACAATTGTAG。
[0035] The nucleotide sequence of primer CsPR5-F is shown in SEQ ID No. 2: ATGGCTGACTACACTACTCT.
[0036] The nucleotide sequence of primer CsPR5-R is shown in SEQ ID No. 3: CTACAATTGTAAGAACACGA.
[0037] 2. Construction of CsPR5 gene overexpression vector.
[0038] The CsPR5 coding sequence DNA fragment with the homology arms of the pNM-GFPer vector and the overexpression vector pNM-GFPer were double-digested with restriction endonucleases Kpn I and Bam H1 (Thermo Fisher) and then gel-cleaved using the ClonExpress II One Step Cloning Kit (Novizen, CAT: C112-01). The ligation product was transformed into Escherichia coli DH5α, and the plasmid of the positive clone was extracted using a plasmid extraction kit (Tiangen, CAT: DP103) to obtain the CsPR5 overexpression vector pNM-GFPer-CsPR5 (as shown in Figure 2). Figure 2 shown).
[0039] The nucleotide sequence of the primer pNM-GFPer-CsPR5-F is shown in SEQ ID No. 4: SEQ ID No. 4: TTCATTTGGAGAGGACAGGGTACCATGGC TGACTACACTACTCT.
[0040] The nucleotide sequence of the primer pNM-GFPer-CsPR5-R is shown in SEQ ID No. 5: GTAATCCGATCCTCCTCCGGATCCCTACA ATTGTAAGAACACGA.
[0041] 3. Genetic transformation of citrus with CsPR5 gene overexpression vector.
[0042] according to Figure 3 The citrus genetic transformation was carried out according to the process shown in the figure. The specific operations are as follows:
[0043] 1. Obtaining epicotyls of citrus seedlings:
[0044] Cut the branches of Fructus Aurantii Immaturus in good growth condition and cut them into segments of about 5 cm in length with scissors. Each segment should have a bud point for Agrobacterium tumefaciens-mediated genetic transformation.
[0045] 2. Transformation of Agrobacterium with overexpression vector:
[0046] The constructed overexpression vector pNM-GFPer-CsPR5 was introduced into Agrobacterium tumefaciens K599 (Vidi Biotechnology, CAT#: AC1080) by chemical transformation. The method is as follows: frozen Agrobacterium competent cells K599 (50 μL) were taken in advance and thawed on ice; 2 μL of the overexpression vector plasmid was added to the competent cells, pipetted to mix, and then stood on ice for 5 minutes, liquid nitrogen for 5 minutes, 42°C for 5 minutes, and stood on ice for 5 minutes, and then added 700 μL of antibiotic-free TY liquid medium. The culture was shaken at 28°C for 2-3 hours, and the bacteria were collected by centrifugation at 6000 rpm for 1 minute. 100 μL of supernatant was retained and gently pipetted to resuspend the bacterial block, which was spread on a TY plate containing spectinomycin at a concentration of 100 ug / ml, and inverted in a 28°C incubator for culture for 2-3 days. After plaques grew, single colonies were verified by PCR using primers pNM-GFPer-CsPR5-F (SEQ ID No. 4) and pNM-GFPer-CsPR5-R (SEQ ID No. 5).
[0047] PCR reaction conditions: 94°C for 3 min; 94°C for 30 s, 58°C for 30 s, 72°C for 30 s, 30 cycles; 72°C for 10 min.
[0048] 3. Preparation of Agrobacterium tumefaciens culture solution:
[0049] Before transfection, streak Agrobacterium (containing the pNM-GFPer-CsPR5 vector) for transfection on TY solid medium containing 100 μg / ml spectinomycin. Pick a single colony and inoculate it into 25 mL of TY liquid medium containing the same antibiotics. Cultivate the culture at 28°C with shaking overnight. Dilute the culture to an OD value of 0.1 and continue culturing to an OD value of 0.5. Centrifuge at 5000 / min for 10 min, discard the supernatant, and resuspend the culture in a pH 5.4 resuspension buffer for transfection.
[0050] 4. Transformation of citrus stem segments:
[0051] The citrus stem segments were soaked in Agrobacterium solution and vacuum infiltrated in a vacuum pump for 30 minutes. The stem segments were then cut into vermiculite and cultured at 28°C, 16h light / 8h dark conditions. After rooting, GFP fluorescence was observed using a handheld fluorescent lamp. Positive roots showed green fluorescence, while negative roots showed no fluorescence.
[0052] The culture medium used in this embodiment is as follows:
[0053] TY medium: 5g / L casein trypsin (Tryptone) + 3g / L yeast extract (Yeast Extract) + 0.01M / L calcium chloride (CaCl2) solution, pH 7.0.
[0054] 4. Verification of CsPR5 gene overexpression in hairy roots.
[0055] 1. GFP fluorescence detection of transgenic plants:
[0056] The transgenic hairy roots were tested again using a handheld fluorescent lamp. The positive ones showed green fluorescence, while the negative ones showed no fluorescence (e.g. Figure 4 shown).
[0057] 2. PCR identification of transgenic hairy roots:
[0058] Genomic DNA was extracted from 100 mg of hairy roots of the transgenic plants using a DNA extraction kit (Adlai, Cat: DN15). PCR was then performed to detect the integration of the CsPR5 gene into the citrus genome. The primers used for the detection were ID-pNM-F (SEQ ID No. 6) and pNM-GFPer-CsPR5-R (SEQ ID No. 5).
[0059] The results are as follows Figure 5 As shown, a 1314 bp amplified fragment could be obtained from the positive hairy roots, while no amplification was obtained from the pNmGFPer:00 hairy roots.
[0060] PCR reaction conditions: 94°C for 3 min; 94°C for 30 s, 58°C for 30 s, 72°C for 30 s, 30 cycles; 72°C for 10 min.
[0061] The nucleotide sequence of primer ID-pNM-F is shown in SEQ ID No. 6: TCTCAGAAGACCAAAGGGCAAT.
[0062] Transgenic plants were identified by PCR using the forward primer ID-pNM-F within 35S.
[0063] 3. qRT-PCR Analysis of Transgenic Hairy Roots:
[0064] Total RNA was extracted from transgenic hairy roots (Adlai, CAT No: RN09), and cDNA was synthesized using the reverse transcription kit PrimeScript RT Master Mix (TaKaRa, CAT No: RR036A). The expression level of the target gene was detected by qRT-PCR. The detection primers were RT-CsPR5-F (SEQ ID No. 7) and RT-CsPR5-R (SEQ ID No. 8). -△△Ct The relative expression of CsPR5 gene in transgenic hairy roots was calculated by the following method: hairy root samples transformed with the empty pNM-GFPer vector (pNmGFPer:00) were defined as the reference factor, i.e., the expression level of CsPR5 gene was 1, and then the expression multiple of the gene in transgenic citrus relative to the reference factor was calculated. -△△Ct , which is its relative expression level.
[0065] The results are as follows Figure 6 As shown, the CsPR5 gene was expressed at a higher level in transgenic hairy roots than in wild-type hairy roots.
[0066] qRT-PCR reaction conditions: 95°C for 3 min, 94°C for 10 s; 56°C for 10 s, 72°C for 10 s, 40 cycles; 72°C for 10 min.
[0067] The nucleotide sequence of primer RT-CsPR5-F is shown in SEQ ID No. 7: SEQ ID No. 7: GTTCCTTTAATTCGCCCGCC.
[0068] The nucleotide sequence of primer RT-CsPR5-R is shown in SEQ ID No. 8: SEQ ID No. 8: TGTGGAATCCCCATTGACGG.
[0069] 4. Phenotypic observation of transgenic plants:
[0070] like Figure 4 As shown in the figure, the phenotypes of the two transgenic hairy roots were observed and analyzed, and no obvious abnormalities were found in their appearance and growth. This indicates that overexpression of the CsPR5 gene did not significantly affect the phenotype and development of the hairy roots.
[0071] 5. Resistance evaluation of transgenic plants overexpressing the CsPR5 gene.
[0072] A 3-cm citrus branch segment carrying a CLas toxin source was grafted onto an aerial stem segment of a transgenic hairy root. Twelve days after grafting, DNA was extracted from the hairy root near the transgenic toxin source and tested by qPCR using CLas detection primers.
[0073] The nucleotide sequence of primer RT-18S-F is shown in SEQ ID No. 9: AATTTGTTGGTCTTCAACGAGGAA.
[0074] The nucleotide sequence of primer RT-18S-R is shown in SEQ ID No. 10: SEQ ID No. 10: AAAGGGCAGGGACGTAGTCAA.
[0075] The nucleotide sequence of primer RT-16S-F is shown in SEQ ID No. 11: TGAGTGCTAGCTGTTGGGTG.
[0076] The nucleotide sequence of primer RT-16S-R is shown in SEQ ID No. 12: CTGCGCGTTGCATCGAATTA.
[0077] Quantitative PCR (qPCR) was used to analyze the resistance of transgenic plants to Huanglongbing. Transgenic hairy roots of consistent maturity and growth were harvested on the 12th day after Huanglongbing infection was introduced. DNA was extracted and quantified to 100 ng / μL. qPCR was used to detect the levels of the citrus 18S gene and the CLas 16S gene. The formula was: Las copies ( / μg citrus DNA) = [10 (-0.2718×CtCLas16S+10.624) / 10 (-0.2749×CtCs18S+4.0531) ]×10 3(12.7<CtCLas16S<31.3and8.4<CtCs18S<26.5) The relative content of CLas bacteria (Log10) was calculated. The wild type was used as the control, and the logarithm of the content of Huanglongbing pathogens was used to analyze the resistance level of the transgenic plants. Excel software was used for statistical plotting and SPSS software was used for significance analysis.
[0078] The results are as follows Figure 7 As shown, 12 days after CLas inoculation, the number of CLas in hairy roots of plants overexpressing CsPR5 was significantly lower than that in WT plants. This indicates that overexpression of CsPR5 can significantly inhibit the infection and colonization of CLas, alleviating the severity of HLB in citrus. This gene can be used independently in molecular breeding for disease resistance or in combination with other resistance or susceptibility genes in molecular breeding for HLB resistance in citrus.
[0079] Therefore, the present invention adopts the application of the above-mentioned CsPR5 gene in regulating the resistance to citrus Huanglongbing, and inhibits the early infection and colonization of the citrus Huanglongbing pathogen by overexpressing the CsPR5 gene, thereby improving the resistance to citrus Huanglongbing.
[0080] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit the same. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that they can still modify or replace the technical solutions of the present invention with equivalents, and these modifications or equivalent replacements cannot cause the modified technical solutions to deviate from the spirit and scope of the technical solutions of the present invention.
Claims
1. Application of CsPR5 gene in regulating resistance to citrus Huanglongbing disease, characterized in that: The nucleotide sequence of the CsPR5 gene is shown in SEQ ID No.
1.
2. The use according to claim 1, characterized in that The method for regulating citrus Huanglongbing resistance suppresses early infection and colonization of citrus Huanglongbing pathogens by overexpressing the CsPR5 gene, thereby improving citrus Huanglongbing resistance.
3. A recombinant expression vector, characterized in that: The expression vector overexpresses the CsPR5 gene according to claim 1.
4. Use of the recombinant expression vector according to claim 3 in regulating resistance to citrus Huanglongbing, characterized in that: The regulation of citrus Huanglongbing resistance is that the recombinant expression vector overexpresses the CsPR5 gene to inhibit the early infection and colonization of the citrus Huanglongbing pathogen and improve the citrus Huanglongbing resistance.
5. A recombinant strain, characterized in that The recombinant strain comprises the recombinant expression vector according to claim 3.
6. Use of the recombinant strain according to claim 5 in regulating resistance to citrus Huanglongbing, characterized in that: The regulation of citrus Huanglongbing resistance is that the recombinant strain overexpresses the CsPR5 gene to inhibit the early infection and colonization of the citrus Huanglongbing pathogen, thereby improving the citrus Huanglongbing resistance.
7. A method for improving resistance to citrus Huanglongbing, characterized in that: The resistance of citrus to Huanglongbing is improved by overexpressing the CsPR5 gene described in claim 1.
8. Use of the CsPR5 gene as claimed in claim 1 in preparing a preparation for inhibiting infection by Bacillus asiaticus, characterized in that: The preparation for inhibiting infection of Bacillus asiaticus is applied to citrus to promote overexpression of the citrus CsPR5 gene, inhibit the early infection and colonization of Bacillus asiaticus in citrus, and improve the resistance of citrus to Huanglongbing disease.
9. A preparation for inhibiting infection by Bacillus asiaticus, characterized in that: The preparation for inhibiting infection by Bacillus asiaticus comprises an effective ingredient that promotes overexpression of the CsPR5 gene as claimed in claim 1 in citrus.
Citation Information
Patent Citations
Method for improving citrus liberobacter asiaticum resistance by regulating and controlling citrus ubiquitination pathway through citrus RUB2
CN116410988A
Compositions and methods for reducing pathogen-induced citrus greening
US20170044560A1
Controlling Citrus Huanglongbing (HLB) by Mitigating Cell Death of the Phloem Tissues Caused by Candidatus Liberibacter Asiaticus (CLas) By Suppressing Reactive Oxygen Species (ROS)
US20240417747A1