Polygonatum cyrtonema PcMAPK3 gene and application thereof

Abstract

The invention provides a polygonatum cyrtonema PcMAPK3 gene and application thereof, and belongs to the technical field of gene engineering. The nucleotide sequence of the gene PcMAPK3 is as shown in SEQ ID NO: 1. The disease resistance of polygonatum cyrtonema can be enhanced by overexpressing the PcMAPK3 gene, and candidate genes and a theoretical basis are provided for disease-resistant breeding of polygonatum cyrtonema.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and particularly relates to a Polygonatum cyrtonema PcMAPK3 gene and application thereof in resistance to Fusarium oxysporum. Background Art

[0002] Polygonatum cyrtonema is a traditional Chinese medicinal plant rich in active ingredients such as polysaccharides and saponins, which exhibit immunomodulatory, antioxidant, and antitumor effects. However, during cultivation, Polygonatum cyrtonema is often infected by the fungus Fusarium oxysporum, leading to root rot, which seriously threatens its yield and quality, and limits the sustainable development of the industry. Currently, the prevention and control of root rot mainly relies on chemical fungicides, but these can easily lead to pathogen resistance and environmental pollution. Therefore, identifying the disease-resistance genes inherent in Polygonatum cyrtonema is crucial for molecular breeding of disease-resistant plants.

[0003] The MAPK (MAP Kinase) cascade pathway is highly conserved across eukaryotes (including plants, animals, and fungi) and is a core mechanism for transmitting environmental stimuli and intracellular signals. MAPK3 homologous genes are among the most prevalent and best-studied members of the MAPK cascade. However, the research, cloning, and application of disease-resistance-related genes in Polygonatum cyrtonema are currently limited. Summary of the Invention

[0004] In order to improve the disease resistance of Polygonatum sibiricum, the present invention cloned a PcMAPK3 gene in Polygonatum sibiricum for the first time, and innovatively found that overexpressing the PcMAPK3 gene can enhance the disease resistance of Polygonatum sibiricum to Fusarium oxysporum.

[0005] To achieve the above objectives, the inventors provide the following technical solutions:

[0006] A Polygonatum cyrtonema PcMAPK3 gene, the nucleotide sequence of the gene PcMAPK3 is shown as SEQ ID NO: 1.

[0007] A primer pair for obtaining the PcMAPK3 gene of Polygonatum cyrtonema, the primer pair comprising:

[0008] PcMAPK3-F: ATGGACGGCGCAGCTCCTCC (SEQ ID NO: 2);

[0009] PcMAPK3-R:TTAATGGCGGTAGTGTGGAT (SEQ ID NO: 3).

[0010] A recombinant expression vector contains the Polygonatum cyrtonema PcMAPK3 gene with the nucleotide sequence of SEQ ID NO: 1.

[0011] A recombinant strain containing the recombinant expression vector.

[0012] A method for improving plant disease resistance, wherein the method comprises overexpressing the Polygonatum cyrtonema PcMAPK3 gene of claim 1 with the nucleotide sequence of SEQ ID NO: 1 in the plant.

[0013] Furthermore, the method uses the recombinant strain to infect Polygonatum cyrtonema explants to obtain positively transformed Polygonatum cyrtonema tubers.

[0014] Furthermore, a PcMAPK3 gene of Polygonatum sibiricum is used in resistance to Fusarium oxysporum.

[0015] Compared with the prior art, the present invention has the following beneficial effects:

[0016] (1) The present invention provides candidate genes and a theoretical basis for the disease-resistant breeding of Polygonatum cyrtonema.

[0017] (2) Overexpression of the PcMAPK3 gene can not only enhance the disease resistance of Polygonatum cyrtonema to Fusarium oxysporum, but also enhance the disease resistance of Nicotiana benthamiana leaves to Fusarium oxysporum. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 The results of colony PCR identification of the PcMAPK3-BGV007 recombinant vector described in the specific embodiment are shown in FIG. In the figure, lanes 1 to 6 are the PCR results of 6 randomly selected colonies.

[0019] Figure 2 The PCR verification results of the positively transformed tubers described in the specific embodiment are shown in FIG. In the figure, Y represents the negative control; WT represents the wild type; and M1 to M3 represent the numbers of the verification samples.

[0020] Figure 3 The specific implementation method is to infect the wild type and PcMAPK3 overexpressing tubers of Polygonatum cyrtonema with the bacterial liquid of Fusarium oxysporum.

[0021] Figure 4 The tubers inoculated with bacterial liquid were observed under a living imaging instrument as described in the specific embodiment.

[0022] Figure 5 The specific implementation method is to infect the wild type and PcMAPK3 overexpressing tubers of Polygonatum cyrtonema with the Fusarium oxysporum cake.

[0023] Figure 6 The tubers inoculated with the bacterial cake were observed under the in vivo imaging instrument described in the specific embodiment.

[0024] Figure 7Wild-type and PcMAPK3-overexpressing Nicotiana benthamiana plants described in the specific embodiments were inoculated with Fusarium oxysporum. DETAILED DESCRIPTION

[0025] In order to explain the technical content, achieved objectives and effects of the technical solution in detail, the following is a detailed description in conjunction with specific embodiments and accompanying drawings.

[0026] Unless otherwise specified, the technical means and terms used in the following examples are understood according to the conventional usage of ordinary technicians in the relevant fields. The materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained from commercial channels.

[0027] Example 1

[0028] 1. Cloning of the PcMAPK3 gene from Polygonatum cyrtonema

[0029] Using the three-generation transcriptome data of Polygonatum multiflorum obtained earlier by the research team as a reference, PCR primers were designed to amplify the PcMAPK3 gene sequence. The PCR amplification program was: 95°C for 5 minutes, 32 cycles of (95°C for 30 seconds, 55°C for 30 seconds, 68°C for 1 minute), and 68°C for 10 minutes. The PCR amplification system in 50 μL contained 25 μL of 10× KOD-Plus-Neo Buffer, 5 μL of 2 mM dNTPs, 2 μL of 25 mM MgSO4, 1.5 μL of PcMAPK3-F (10 μM), 1.5 μL of PcMAPK3-R (10 μM), 2 μL of Polygonatum multiflorum cDNA, 1 μL of KOD-Plus-Neo enzyme, and 32 μL of sterile water. The PCR primer sequences were:

[0030] PcMAPK3-F: ATGGACGGCGCAGCTCCTCC (SEQ ID NO: 2);

[0031] PcMAPK3-R:TTAATGGCGGTAGTGTGGAT (SEQ ID NO: 3).

[0032] The nucleotide sequence of the PcMAPK3 gene is as follows:

[0033] ATGGACGGCGCAGCTCCTCCGATGACGGACTTCCCCGTCGCGTTGA

[0034] CCCACAACGGCCGCTTCCTCCAGTACAACATCTTCGGCAACCTCTTCGA

[0035] GATCACCGCCAAGTACCAGCCCCCATCATGCCATCGGGCCGTGGCGCC

[0036] TACGGCATCGTCTGCTCGGTGATGAATTCGGAGACGAAGGAGATGGTTG

[0037] CGATAAAGAAGATCGCGAACGCGTTCGATAATCATATGGATGCCAAGAG

[0038] GACGCTGAGGGAGATCAAGCTGCTCAGGCATTTGGATCACGAGAACGT

[0039] CATCGGAATAAGAGACGTTACCCCGCCTCCGATACCTGAACAATTCAAC

[0040] GATGTCTACATTGCGACCGAGCTCATGGACACCGACCTGAACAATATCAT

[0041] CCGATCCCATCAGGATTTGTCTGAGGAGCATTGTCAGTACTTTCTGTATC

[0042] AAATACTTCGAGGGATGAAATACATACATTCGGCAAATGTGATTCATAGA

[0043] GATCTGAAGCCGAGCAATCTCCTGCTGAATGCCAATTGCGACCTCAAGA

[0044] TATGCGATTTTGGCCTTGCACGGCCGACATCAGAGAATGATATTATGACT

[0045] GAGTATGTGGTGACCAGATGGTACAGAGCGCCAGAACTGCTGCTGAACT

[0046] CGACAGATTACACTGCGGCCATCGATGTCTGGTCCGTTGGATGCATATTT

[0047] ATGGAGCTTATGAACAGGCAGCCGTTGTTTCCTGGAAGAGATCATATGAA

[0048] TCAGATGCGCTTGATAACCGAGCGCATTGGCACGCCTACTGATGCTGATC

[0049] TTGGATTCGTACGGAATGATGATGCGAGAAGGTATATCAGGCATCTCCCT

[0050] TTCTTTCCCCGCCGGCCATTTGCAAGTCTATTTCCTCATGTTCATCCGGTT

[0051] GCTCTCGATCTTGTGGAGAAAATGCTGACATTTGATCCGACAAAAAGAA

[0052] TTTCAGTTGAAGATGCACTTGCACATCCATACCTTGAAAGATTACATGAC

[0053] ACTGCGGATGAACCAATTTGCATGGAACCTTTCTCCTTCGAGTTCGAGC

[0054] AGCATGCCCTGACTGAAGACCAGATGAAAGAGTTGATATACAACGAAGC

[0055] CATTTCGTTCAATCCACACTACCGCCATTAA (SEQ ID NO: 1).

[0056] 2. Construction of PcMAPK3-BGV007 overexpression vector

[0057] The PcMAPK3 gene was connected to the plant expression vector BGV007 by homologous recombination and transformed into competent Escherichia coli. Single clones were picked and verified by PCR amplification to obtain the PcMAPK3-BGV007 recombinant vector ( Figure 1 ).

[0058] 3. PcMAPK3 gene overexpression in Polygonatum cyrtonema tubers

[0059] The PcMAPK3-BGV007 recombinant vector was transformed into competent Agrobacterium using the heat shock method, and positive single clones were verified by PCR amplification (primer sequences are shown in SEQ ID NO: 2 and SEQ ID NO: 3). Positive clones were propagated at 28°C and 180 rpm to an OD of 600 The value is equal to 2. The bacterial liquid was centrifuged at 4500 rpm for 20 min to collect the bacteria, and the bacteria were resuspended in MS liquid medium (5% sucrose, 4.47 g / L MS powder, 5 mg / L AgNO3, 100 μmol / L acetosyringone) to an OD of 600After the value is equal to 1.2, let it stand at room temperature for 2 hours to obtain the infection solution. The tubers of Polygonatum cyrtonema that have been cultured for one month are placed in the infection solution, vacuumed for 5 minutes, and then allowed to stand for infection for 15 minutes. After infection, the tubers are transferred to MS solid culture medium (5% sucrose, MS powder 4.47g / L, 5mg / LAgNO3, 100μmol / L acetosyringone, agar 5g / L, pH adjusted to 5.8-6.2), incubated at 28℃ for 24 hours in the dark, and then transferred to 28℃ and cultured at a light intensity of 2000lx for 3 days. DNA was extracted from the tubers after the co-cultivation, and the DNA samples were amplified using BGV007 vector primers (primer sequences are shown in Table 1). The samples with the correct PCR amplification bands are the overexpression roots of the PcMAPK3 gene ( Figure 2 ).

[0060] Table 1 PCR verification primers and their sequences for positively transformed tubers

[0061]

[0062] 4. Disease resistance analysis of tubers overexpressing PcMAPK3

[0063] Inoculation method: The GFP-tagged Fusarium oxysporum strain [Gao Wenli, Su Hailan, Lin Fengfang, et al. Identification of the pathogen of root rot of Polygonatum cyrtonema in Fujian Province [J]. Journal of Fujian Agricultural Sciences, 2024, 39(5): 600-608.] was cultured in PDA (potato dextrose agar) solid medium in a 28°C incubator for 5 days. A small amount of mycelium was picked and placed in PDA liquid medium. After shaking culture at 28°C and 170 r / min for 5 days, the spore suspension was filtered to obtain the spore suspension, and the concentration of the spore suspension was adjusted to 5×10 6 CFU / mL, ready for inoculation. Select PcMAPK3 overexpressing tubers of the same size and growth, soak and disinfect them in 75% ethanol for 10 minutes, rinse with sterile water 3 times, and use sterile filter paper to absorb the moisture on the surface of the tubers. Set up a control group (wild type) and a treatment group (PcMAPK3 overexpressing tubers) respectively, and soak the tubers in the spore suspension for 30 minutes. After taking them out, place them in a culture dish covered with sterile filter paper, and place them in an artificial climate box at 27±2℃, 60-80% humidity, and 16h light for cultivation. After 8 days, according to Figure 3 The results showed that the tubers in the control group were seriously infected by Fusarium oxysporum, which was manifested by red tubers and even obvious rot, while the tubers in the treatment group had milder symptoms. In addition, since the infecting strain carried a GFP tag, when the inoculated tubers were placed under a living imaging device for observation, the size of the fluorescent area could reflect the scope of the strain infection. Figure 4The results showed that the fluorescent area of ​​the tubers in the control group was significantly larger than that in the treated group, indicating that the control group suffered a more severe infection with the strain, while the infection level in the treated group was relatively mild. Therefore, overexpression of the PcMAPK3 gene can improve the resistance of Polygonatum multiflorum to Fusarium oxysporum.

[0064] Stipe inoculation method: After the GFP-tagged Fusarium oxysporum strain is cultured in a PDA solid culture medium in a 28°C incubator for 5 days, a bacterial cake (3mm×3mm) is prepared for inoculation. PcMAPK3-overexpressing rhizomes of uniform size and growth are selected, and after being disinfected by soaking in 75% ethanol for 10 minutes, they are rinsed 3 times with sterile water, and the surface moisture of the tubers is absorbed with sterile filter paper. A control group (wild type) and a treatment group (PcMAPK3-overexpressing tubers) are set up respectively, and the bacterial cake is picked up with a sterile needle, and the mycelial surface is attached to the surface of the tuber, and placed in an artificial climate box at 27±2°C, 60-80% humidity, and 16h light for culture. After 8 days, according to Figure 5 The results showed that the part of the tuber attached to the stipe of the control group turned red or even rotted, while the part of the tuber attached to the stipe of the treated group showed no signs of disease. In addition, since the infecting strain carries a GFP tag, when the inoculated tuber is placed under a living imaging device for observation, the size of the fluorescent area can reflect the scope of the strain infection. Figure 6 The results showed that the fluorescent area of ​​the tubers in the control group was significantly larger than that in the treated group, indicating that the control group suffered a more severe infection with the strain, while the infection level in the treated group was relatively mild. Therefore, overexpression of the PcMAPK3 gene can improve the resistance of Polygonatum multiflorum to Fusarium oxysporum.

[0065] Example 2

[0066] 1. Obtaining Nicotiana benthamiana plants expressing heterologous overexpression of PcMAPK3-BGV007

[0067] The PcMAPK3-BGV007 recombinant vector was transformed into competent Agrobacterium using the heat shock method, and positive clones were cultured at 28°C with shaking for 6 hours. The bacterial solution was centrifuged at 5000rpm for 15 minutes, the supernatant was discarded, and then resuspended in 100mL of liquid MS medium. Pre-differentiation cultured Nicotiana benthamiana leaves were soaked in the resuspended bacterial solution for 10 minutes, gently shaking several times during the process. After the bacterial solution on the leaf surface was dried with sterile filter paper, it was evenly spread onto antibiotic-free MS solid medium and cultured in a dark incubator at 25°C for 2-3 days. Rinse the co-cultured leaves three times with sterile water (containing 250mg / L carbenicillin) and then rinse once with MS liquid medium (containing 250mg / L carbenicillin). After blotting the leaves dry with sterile filter paper, spread them evenly onto MS solid selective medium (containing 250 mg / L carbenicillium and 50 mg / L kanamycin) and incubate them in a 25°C light-incubator. The medium was changed every 15 days. When resistant shoots from the leaf callus on the selective medium reached approximately 1 cm in diameter, the seedlings were excised and transferred to rooting medium (containing 250 mg / L carbenicillin and 50 mg / L kanamycin) and continued incubation at 28°C. Root development was observed. Once well-developed, the roots were washed to remove the solid medium, and the plants were carefully transplanted into sterile soil for conventional culture. This resulted in tobacco plants heterologously overexpressing PcMAPK3-BGV007.

[0068] 2. Disease resistance analysis of PcMAPK3 overexpressing Nicotiana benthamiana

[0069] Uniform stipes (3 mm × 3 mm) of Fusarium oxysporum cultured for 5 days were inoculated into PcMAPK3 overexpressing tobacco leaves grown for 6 weeks, and wild-type Nicotiana benthamiana leaves were inoculated as a control. Figure 7 The results showed that 5 days after inoculation, the inoculation site of the wild type had already rotted significantly, while the leaves of the PcMAPK3-overexpressing tobacco showed almost no signs of disease, indicating that overexpression of the PcMAPK3 gene can improve the disease resistance of Nicotiana benthamiana to Fusarium oxysporum.

[0070] It should be noted that although the above embodiments have been described herein, this does not limit the scope of patent protection of the present invention. Therefore, based on the innovative concept of the present invention, changes and modifications to the embodiments described herein, or equivalent structural or equivalent process transformations made using the contents of the present invention's specification and drawings, and direct or indirect application of the above technical solutions to other related technical fields, are all included in the scope of patent protection of the present invention.

Claims

1. A Polygonatum cyrtonema PcMAPK3 gene, characterized in that: The nucleotide sequence of the gene PcMAPK3 is shown in SEQ ID NO:

1.

2. A primer pair for obtaining the PcMAPK3 gene of Polygonatum cyrtonema according to claim 1, characterized in that: The primer pairs are: PcMAPK3-F: ATGGACGGCGCAGCTCCTCC (SEQ ID NO: 2); PcMAPK3-R:TTAATGGCGGTAGTGTGGAT (SEQ ID NO: 3).

3. A recombinant expression vector, characterized in that: The vector contains the Polygonatum cyrtonema PcMAPK3 gene of claim 1 whose nucleotide sequence is SEQ ID NO:

1.

4. A recombinant strain, characterized in that The strain contains the recombinant expression vector according to claim 3.

5. A method for improving plant disease resistance, characterized in that: The method is to overexpress the Polygonatum cyrtonema PcMAPK3 gene with the nucleotide sequence of SEQ ID NO: 1 according to claim 1 in plants.

6. The method for improving disease resistance of Polygonatum cyrtonema according to claim 5, wherein: The method uses the recombinant strain according to claim 4 to infect Polygonatum cyrtonema explants to obtain positively transformed Polygonatum cyrtonema tubers.

7. Use of the Polygonatum cyrtonema PcMAPK3 gene as claimed in claim 1 in resistance to Fusarium oxysporum.

Images