Application of LOX5 gene in tobacco variety improvement
By overexpressing the LOX5 gene in tobacco and activating downstream gene expression, the problem of insufficient cis-3-hexenal and cis-3-hexenol content in tobacco was solved, and the aroma and quality of tobacco leaves were improved.
Patent Information
- Application Number
- CN202510835492.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-20
- Publication Date
- 2025-09-23
AI Technical Summary
In the existing technology, there is little research on the regulation of cis-3-hexenal and cis-3-hexenol in tobacco, which affects the production of tobacco aroma substances and quality improvement.
The LOX5 gene was obtained from tobacco through homologous cloning technology, an overexpression vector was constructed and transformed into tobacco plants to activate downstream gene expression and increase the content of cis-3-hexenal and cis-3-hexenol.
The content of cis-3-hexenal and cis-3-hexenol in transgenic plants was significantly increased, the aroma quality of tobacco leaves was improved, and the foundation was laid for the creation of high-quality tobacco varieties through genetic engineering.
Smart Images

Figure CN120683160A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to application of LOX5 gene in tobacco variety improvement, belonging to the technical field of plant genetic engineering. Background Art
[0002] Tobacco is a leaf-based cash crop, and its quality determines the usability of tobacco leaves. Tobacco aroma substances are key components of the unique flavor of tobacco and its products (such as cigarettes). These aroma substances not only affect the sensory experience of tobacco, but also have an important impact on consumer preferences and acceptance. Tobacco aroma substances mainly come from the chemical components of the tobacco plant itself, as well as by-products generated during tobacco processing and combustion. The chemical components in tobacco and smoke are very diverse, including a variety of aroma substances. According to literature reports, the total number of chemical components in tobacco and smoke can reach thousands. The formation and accumulation of tobacco aroma substances are regulated by multiple genes. These genes are involved in multiple pathways such as sugar metabolism and terpenoid metabolism in tobacco, and play a key role in the production of tobacco aroma substances.
[0003] The lipoxygenase pathway (LOX pathway) is one of the important pathways of fatty acid metabolism. In higher plants, lipoxygenase (LOX) uses the polyunsaturated fatty acids linoleic acid (18:2) and linolenic acid (18:3) as substrates, adding oxygen at the carbon 13 or 9 position of the fatty acids to form 9- or 13-hydroperoxides. 9-LOXs and 13-LOXs catalyze the production of their respective hydroperoxides. These hydroperoxides then serve as substrates for other biosynthetic pathways, including the hydroperoxide lyase (HPL) pathway, the allene oxygenase (AOS) pathway, the divinyl ether synthase (DES) pathway, and the hydroperoxide isomerase (POX) pathway, generating approximately 150 known lipoxygenates. For example, the HPL pathway can catalyze two different hydroperoxides to produce C6, C12 and C9 compounds. Among them, the C6 green leaf volatiles (GLVs) formed by the C6 compounds are not only an important source of plant aroma, but also play a key role in plant damage response, while C9 compounds are important components of plant fruits and vegetables; in the AOS pathway, after a series of catalysis and three β-oxidations, jasmonic acid (JA) is finally generated. Like GLV, jasmonic acid has important physiological functions.
[0004] Research on lipoxygenase (LOX) is ongoing. Studies have found significant differences in LOX gene expression between different varieties of the same plant. In cantaloupe (Cucumis melo), the highly aromatic "Yu Mei Ren" variety exhibits significantly higher LOX gene expression than the less aromatic "Cai Gua" variety. Furthermore, LOX gene expression varies across plant growth stages, influencing the production of aroma compounds. In kiwifruit, LOX gene expression gradually decreases during fruit ripening, and aldehyde content also shows a downward trend. In pear, LOX gene expression is very low in early development but peaks in mid-development, consistent with changes in volatile compounds. In apple, LOX expression increases several-fold during ripening, and volatile compound concentrations also increase several-fold, with a positive correlation between the two. In passion fruit, LOX responds significantly to abiotic stresses such as drought, salt, low temperature, and high temperature. These studies demonstrate that LOX expression is closely linked to plant growth and development, volatile compound production, and stress response. Other studies have shown that higher lipoxygenase activity is associated with greater carotenoid degradation. Because the production of tobacco aroma compounds is closely linked to the degradation of plastid pigments, tobacco lipoxygenase activity can directly or indirectly influence tobacco aroma and quality. Studying the substrates and expression patterns of LOX genes holds important biological significance for understanding the mechanisms that influence fruit and flower color and volatile compound production.
[0005] The content of cis-3-hexenal and cis-3-hexenol is one of the key indicators for evaluating tobacco leaf quality. Their unique aroma adds a richness to the tobacco leaf. Therefore, studying the metabolic pathways of cis-3-hexenal and cis-3-hexenol in tobacco and identifying the genes that regulate them are important for creating tobacco varieties with increased cis-3-hexenal and cis-3-hexenol content through genetic engineering, thereby improving tobacco leaf quality. Although research on lipoxygenases is ongoing in some plants, limited research is currently underway on the role of lipoxygenases in regulating cis-3-hexenal and cis-3-hexenol in tobacco. Summary of the Invention
[0006] The purpose of the present invention is to provide an application of the LOX5 gene in tobacco variety improvement, and to provide a gene resource that can effectively regulate the content of cis-3-hexenal and cis-3-hexenol in tobacco.
[0007] In order to achieve the above-mentioned purpose, the technical solution adopted by the present invention for the application of LOX5 gene in tobacco variety improvement is as follows:
[0008] A use of the LOX5 gene in tobacco variety improvement, wherein the nucleotide sequence of the LOX5 gene is shown in SEQ ID NO. 1; the variety improvement is to obtain a tobacco variety with increased cis-3-hexenal and cis-3-hexenol content.
[0009] The beneficial effect of the above technical solution is that the application of the LOX5 gene in tobacco variety improvement is a pioneering invention. The present invention uses homologous cloning technology to obtain a tobacco lipoxygenase 5 (LOX5) encoding gene from tobacco, constructs an overexpression vector for the gene, and transforms it into tobacco plants to obtain tobacco plants that overexpress the LOX5 gene. Through testing of tobacco plants overexpressing the LOX5 gene, it was found that the expression levels of the HPL, ADH, and AAT genes in the transgenic plants were significantly higher than those in the control plants. In addition, the cis-3-hexenal content was increased by 36.19% compared with the control, and the cis-3-hexenol content was increased by 31.95% compared with the control. This fully demonstrates that the LOX5 gene is involved in regulating the content of cis-3-hexenal and cis-3-hexenol in tobacco, laying the foundation for creating tobacco varieties with increased cis-3-hexenal and cis-3-hexenol content through genetic engineering, which is conducive to the improvement and innovation of tobacco quality.
[0010] Specifically, the method of preparing new transgenic plant varieties using the LOX5 gene can obtain new transformed plant varieties with changed cis-3-hexenal and cis-3-hexenol contents by interfering, silencing, knocking out or overexpressing the LOX5 gene through transgenic technology, transient expression technology or genome editing technology.
[0011] As a further improvement, the method for obtaining a tobacco variety with increased cis-3-hexenal and cis-3-hexenol content includes the following steps: constructing a LOX5 gene overexpression vector, introducing the vector into tobacco, screening and identifying the vector, and obtaining the tobacco variety.
[0012] As a further improvement, the overexpression vector is constructed by a method comprising the following steps: obtaining a LOX5 gene fragment by PCR amplification, inserting the fragment into a starting vector, and then screening and identifying the fragment.
[0013] As a further improvement, the primers for the PCR amplification are as follows:
[0014] LOX5-F: ATGGAACATTCAAGGATAATTGA (shown in SEQ ID NO. 2);
[0015] LOX5-R: CATGGATATGCTATTAGGTA (shown in SEQ ID NO. 3).
[0016] As a further improvement, the starting vector is pCAMBIA sup1300.
[0017] As a further improvement, the tobacco is K326. BRIEF DESCRIPTION OF THE DRAWINGS
[0018] Figure 1 The relative expression of the LOX5 gene in the middle leaves of the T1 generation of transgenic tobacco lines in Example 3 of the present invention (wherein, CT is the control tobacco K326, OE#LOX5 is the transgenic tobacco K326 overexpressing the LOX5 gene, each material has three biological replicates, and * indicates a significant difference from the control at the 0.05 level);
[0019] Figure 2 The relative expression of the HPL gene in the middle tobacco leaves of the T1 generation of transgenic tobacco lines in Example 3 of the present invention (wherein, CT is the control tobacco K326, OE#LOX5 is the transgenic tobacco K326 overexpressing the LOX5 gene, each material has three biological replicates, and * indicates a significant difference from the control at the 0.05 level);
[0020] Figure 3 The relative expression of the ADH gene in the middle leaves of the T1 generation of transgenic tobacco lines in Example 3 of the present invention (wherein, CT is the control tobacco K326, OE#LOX5 is the transgenic tobacco K326 overexpressing the LOX5 gene, each material has three biological replicates, and * indicates a significant difference from the control at the 0.05 level);
[0021] Figure 4 The relative expression of the AAT gene in the middle leaves of the T1 generation of transgenic tobacco lines in Example 3 of the present invention (wherein, CT is the control tobacco K326, OE#LOX5 is the transgenic tobacco K326 overexpressing the LOX5 gene, each material has three biological replicates, and * indicates a significant difference from the control at the 0.05 level);
[0022] Figure 5 The relative content of cis-3-hexenal in the middle leaves of the T1 generation of transgenic tobacco lines in Example 4 of the present invention (wherein, CT is the control tobacco K326, OE#LOX5 is the transgenic tobacco K326 overexpressing the LOX5 gene, each material has three biological replicates, and * indicates a significant difference from the control at the 0.05 level);
[0023] Figure 6 The relative content of cis-3-hexenol in the middle leaves of the T1 generation of transgenic tobacco lines in Example 4 of the present invention (wherein, CT is the control tobacco K326, OE#LOX5 is the transgenic tobacco K326 overexpressing the LOX5 gene, each material has 3 biological replicates, and * indicates a significant difference from the control at the 0.05 level). DETAILED DESCRIPTION
[0024] Cis-3-hexenal imparts a fresh, grassy, grape-leaf, or strawberry-like scent to tobacco leaves, with an extremely low olfactory threshold (0.25 ppb), allowing even trace amounts to significantly impact the senses. Cis-3-hexenol, on the other hand, provides a strong green leaf aroma and fresh tea-leaf flavor, and is widely used in blending melon, fruit, and mint-type flavors to enhance the complexity of tobacco leaves' natural aroma. Since increasing the content of cis-3-hexenal and cis-3-hexenol in tobacco leaves can improve tobacco quality, the content of these two substances has become one of the important indicators for evaluating tobacco quality. Although cis-3-hexenal and cis-3-hexenol are often used as tobacco additives to enhance the aromatic characteristics of products, thereby attracting consumers who prefer such flavors, the potential health effects of spices must still be carefully considered when introducing them into tobacco products. Therefore, direct regulation of the content of cis-3-hexenal and cis-3-hexenol in tobacco through genetic and genetic engineering methods to create tobacco varieties that meet market demand has gradually attracted attention. Based on this, the present invention provides an application of the LOX5 gene in tobacco variety improvement.
[0025] The present invention is further described in detail below with reference to specific examples. Unless otherwise specified, the equipment and reagents used in each embodiment, experimental example and comparative example can be obtained from commercial sources.
[0026] In the following examples, unless otherwise specified, all experiments were performed according to conventional experimental conditions, such as Sambrook et al. Molecular cloning: a laboratory manual (Sambrook J & Russell DW, Molecular cloning: a laboratory manual, 2001), or according to the conditions recommended by the manufacturer's instructions.
[0027] A specific example of the application of the LOX5 gene in tobacco variety improvement according to the present invention:
[0028] Example 1 Obtaining the LOX5 gene
[0029] In this example, RNA was extracted from tobacco tissue, converted into cDNA, and used as a template to amplify the LOX5 gene (nucleotide sequence shown in SEQ ID NO. 1) by PCR. The specific implementation steps are as follows:
[0030] 1. Determination of the LOX5 gene sequence
[0031] Based on the gene sequence of Arabidopsis thaliana AtLOX5 gene, the NCBI database was searched to obtain the homologous gene LOX5 sequence in tobacco, and the gene cloning primers were designed using this sequence:
[0032] Forward primer: LOX5-F: ATGGAACATTCAAGGATAATTGA (shown in SEQ ID NO. 2);
[0033] Reverse primer: LOX5-R: CATGGATATGCTATTAGGTA (shown in SEQ ID NO. 3).
[0034] 2. PCR amplification
[0035] RNA was extracted from tobacco K326 leaf tissue and reverse transcribed to obtain the first-strand cDNA, which was used as a template for PCR amplification using primers LOX5-F / LOX5-R. The PCR product was recovered and purified.
[0036] The PCR amplification reaction system used was the Phusion high-fidelity amplification enzyme reaction system, and the reaction system was as follows: 200 ng cDNA, 10 μL of 5× Phusion HF reaction buffer, 1 μL of 10 mM dNTP, 2 U of Phusion High-Fidelity DNA Polymerase, 1 μL each of 10 μM forward and reverse primers, add water to 50 μL.
[0037] PCR amplification reactions were performed in a Mastercycler The reaction was carried out on a pro thermal cycler with the following program: 98°C for 5 minutes; 98°C for 30 seconds, 55°C for 30 seconds, 72°C for 3 minutes, 35 cycles; and extension at 72°C for 10 minutes.
[0038] 3. Ligation of purified PCR product with vector
[0039] The PCR product purified in step 2 was connected to the vector. The connection system and specific process are as follows:
[0040] 4 μL purified product, 1 μL salt solution, 1 μL PCR Mix well with Blunt II-TOPO (Invitrogen) and incubate in a water bath at 25°C for 30 min. Transform the ligated vector into Escherichia coli DH5a by heat shock, incubate with LB liquid medium, and then plate onto LB plates containing 100 mg / L kanamycin for overnight culture. Select colonies for culture, plasmid extraction, and PCR analysis. Positive clones are screened and sequenced. Correctly sequenced plasmids are saved for subsequent manipulations.
[0041] Example 2 Obtaining tobacco plants overexpressing the LOX5 gene
[0042] In this example, PCR -BluntII-TOPO vector was used as an intermediate vector and pCAMBIA sup1300 as an expression vector backbone to construct a LOX5 gene overexpression vector. After transformation into Agrobacterium, the vector was infected with tobacco plants, and LOX5 gene overexpression tobacco plants were screened and identified. The specific implementation steps are as follows:
[0043] 1. Construction of LOX5 gene overexpression vector
[0044] (1) Acquisition of LOX5 gene fragments
[0045] The primers for construction are:
[0046] LOX5-PstⅠ-F: 5'-agaaagcttctgcagATGGAACATTCAAGGATAATTGA-3' (shown in SEQ ID NO.4);
[0047] LOX5-KpnⅠ-R: 5'-gctcaccatggtaccCATGGATATGCTATTAGGTA-3' (shown in SEQ ID NO. 5).
[0048] The ctgcag in LOX5-PstⅠ-F is the PstⅠ restriction site, and the ggtacc in LOX5-KpnⅠ-R is the KpnⅠ restriction site.
[0049] PCR amplification was performed using TOPO plasmid DNA containing a positive clone of the LOX5 gene as a template. The PCR reaction volume was 50 μL, specifically: 200 ng DNA, 10 μL 5× Phusion HF reaction buffer, 1 μL 10 mM dNTP, 2 U Phusion High-Fidelity DNA Polymerase, 1 μL each of 10 μM LOX5-PstⅠ-F primer and LOX5-KpnⅠ-R primer, add water to 50 μL.
[0050] PCR reaction in Mastercycler The reaction was carried out on a pro thermal cycler with the following program: 98°C for 5 minutes; 98°C for 30 seconds, 55°C for 30 seconds, 72°C for 3 minutes, 35 cycles; and extension at 72°C for 10 minutes.
[0051] (2) Recover the target fragment and connect it to the TOPO vector
[0052] The PCR product was recovered and purified, and then ligated to a TOPO vector using a kit reaction. The specific ligation process was as described in Example 1.
[0053] (3) Construction of overexpression vector pCAMBIA sup1300-LOX5
[0054] The plasmid that was sequenced correctly was double-digested with PstⅠ / KpnⅠ, and after gel electrophoresis, the fragments were recovered from the gel for later use.
[0055] The pCAMBIA sup1300 empty vector was digested with Pst I / Kpn I to obtain the vector fragment, which was then recovered by gel cleavage. The target fragment was inserted into pCAMBIA sup1300 using the ClonExpress Ultra One-Step Cloning Kit. The reaction volume was 10 μL, with 4 μL of gel cleavage product containing the target fragment, 1 μL of pCAMBIA sup1300 (Pst I / Kpn I double-digested) vector, 1 μL of 10× buffer, 1 μL of homologous recombinase, and 3 μL of sterile double-distilled water. The reaction was mixed and allowed to react at room temperature for 2 hours. Competent E. coli cells were then transformed, cultured with medium, and plated onto LB plates containing 100 mg / L kanamycin for overnight growth. Plasmids were extracted and tested by PCR and restriction enzyme digestion to verify the successful construction of the overexpression vector containing the target gene fragment.
[0056] 2. Agrobacterium transformation
[0057] Remove the competent Agrobacterium cells from the -80°C freezer, place them on ice to thaw, and then add 4 μL of the recombinant expression vector pCAMBIA sup1300-LOX5; quick-freeze in liquid nitrogen for 1 minute, transfer to a 37°C water bath for 5 minutes, and then ice-bathe for 2 minutes. Add 1 mL of LB liquid medium to the mixture and incubate at 28°C and 220 rpm for 3-4 hours; spread the culture on LB solid medium containing 100 mg / L kanamycin and 25 mg / L rifampicin, and incubate inverted at 28°C for 2-3 days. Agrobacterium clones containing the target vector will be visible.
[0058] 3. Introducing overexpression vector into tobacco and cultivating transgenic plants
[0059] a. Pick an Agrobacterium clone containing the target vector and streak it onto an LB plate containing kanamycin and rifampicin. Incubate at 28°C for 2-3 days. Scrape the streaked plaque and inoculate it into MS medium containing spectinomycin and rifampicin. Incubate at 28°C with shaking at 220 rpm. Infect when the bacterial solution reaches an OD value of 0.5-0.8.
[0060] b. Place tobacco leaves in a 500 mL wide-mouth bottle, add an appropriate amount of 75% ethanol, and rinse for 1 minute; discard the ethanol, add 0.1% HgCl2 solution, and shake on a shaker at room temperature for 15-30 minutes; discard the solution and rinse with sterile water 6 times;
[0061] c. Remove tobacco (K326) leaves, wash off the surface liquid with sterile absorbent paper, cut the sterile leaves into 1 cm × 1 cm pieces with scissors, place the cut tobacco leaves into a sterile MS liquid culture medium suspension containing the target vector, and let it stand for 15 to 20 minutes; remove the tobacco leaves, absorb the excess bacterial liquid with sterile filter paper, and culture them in MS culture medium containing 6-BA (6-benzylaminopurine, 0.02 mg / L) and NAA (naphthaleneacetic acid, 2 mg / L) at 25°C in the dark for two days; transfer the tobacco leaves to differentiation medium with the incision contacting the culture medium, which is MS culture medium containing 6-BA (0.5 mg / L), NAA (0.1 mg / L), kanamycin (100 mg / L), and cephalosporin (500 mg / L), subculture once every 2 to 3 weeks, and gradually form callus tissue at the incision, and finally differentiate and sprout;
[0062] d. Cut off the buds that have grown to 3-5 cm and transfer them to MS medium for rooting induction. After rooting, remove the transgenic plants from the rooting medium, wash the medium with tap water, and transplant them into sterilized nutrient soil.
[0063] e. The transgenic plants were verified by PCR using LOX5 gene-specific primers to identify transgenic positive plants.
[0064] Example 3 Quantitative PCR analysis of tobacco plants overexpressing the LOX5 gene
[0065] Transgenic T1 line OE#LOX5 and control CT were grown in pots in the greenhouse. The middle leaves (leaves 9-12) were harvested and quantitative PCR was used to analyze the differential expression of key genes in the LOX metabolic pathway, including LOX5, HPL, ADH, and AAT.
[0066] 1. Total RNA Extraction
[0067] Total RNA was extracted from various tissues using the Polysaccharide and Polyphenol Plant Total RNA Extraction Kit.
[0068] 2. cDNA Synthesis
[0069] The extracted total RNA was reverse transcribed into cDNA using a reverse transcription kit.
[0070] 3. Fluorescence quantitative PCR
[0071] a. qRT-PCR primers were designed using Primer 6 software and synthesized by Beijing Liuhe BGI Genomics Co., Ltd. The primer sequences are as follows:
[0072] NnLOX5-qF: 5'-CAAGAGGCAATGAACCAATGGA-3' (shown in SEQ ID NO. 6);
[0073] NnLOX5-qR: 5'-TTAGCGTGGCATCGTCCTT-3' (shown in SEQ ID NO. 7);
[0074] NnHPL-qF: 5'-TCCACATCTTCTGCCACTTCTA-3' (shown in SEQ ID NO. 8);
[0075] NnHPL-qR: 5'-CGTCTGTGCCGAGGTTGTA-3' (shown in SEQ ID NO. 9);
[0076] NnADH-qF: 5'-GGAGCCAGAGCAAGACAAGA-3' (shown in SEQ ID NO. 10);
[0077] NnADH-qR: 5'-CAACAACACAGCGTCCAGAA-3' (shown in SEQ ID NO. 11);
[0078] NnAAT-qF: 5'-AGTGGATTGTAATGGAGAAGGT-3' (shown in SEQ ID NO. 12);
[0079] NnAAT-qR: 5'-CCGCAGCCGAGATTTGTTA-3' (shown in SEQ ID NO. 13);
[0080] 26S rRNA-qF: 5'-GAAGAAGGTCCCAAGGGTTC-3' (shown in SEQ ID NO. 14);
[0081] 26S rRNA-qR: 5′-TCTCCCTTTAACACCAACGG-3′ (shown in SEQ ID NO. 15).
[0082] b. qRT-PCR was performed using the Roche Light Cycle 96 real-time fluorescence quantitative PCR instrument (Roche) with 26s rRNA gene as the internal reference. Three biological replicates were set for each sample, using 2 -ΔΔct Methods The relative expression levels of genes in different tissues were calculated.
[0083] The results are as follows Figures 1 to 4 As shown in the figure, compared with the control plants, the expression levels of LOX5, HPL, ADH and AAT genes in the transgenic lines were significantly increased, indicating that overexpression of the LOX5 gene can activate the expression of downstream HPL, ADH and AAT genes.
[0084] Example 4 Detection of Metabolite Content in Tobacco Plants Overexpressing the LOX5 Gene
[0085] Transgenic T1 line OE#LOX5 and control CT were grown in pots in the greenhouse. The middle leaves (leaves 9-12) were collected and the cis-3-hexenal and cis-3-hexenol contents were determined by gas chromatography.
[0086] a. HS-SPME extraction conditions:
[0087] The sample was shaken at 60°C for 5 minutes, and a 120μm DVB / CWR / PDMS extraction tip was inserted into the sample headspace vial for 15 minutes of headspace extraction. The extraction tip was then desorbed at 250°C for 5 minutes, followed by GC-MS separation and identification. Before sampling, the tip was conditioned at 250°C for 5 minutes in a FiberConditioningStation. Note: New tips are conditioned in the FiberConditioningStation for 2 hours before extraction. The SPME Arrow fiber was used, which offers up to 10 times the sensitivity of traditional SPME fibers.
[0088] b. Chromatographic conditions:
[0089] A DB-5MS capillary column (30 m × 0.25 mm × 0.25 μm, Agilent J&W Scientific, Folsom, CA, USA) was used. The carrier gas was high-purity helium (99.999% purity or higher). The injection port temperature was 250°C, and splitless injection was used with a solvent delay of 3.5 min. The temperature program was as follows: 40°C for 3.5 min, then increased to 100°C at 10°C / min, then to 180°C at 7°C / min, and finally to 280°C at 25°C / min and held for 5 min.
[0090] c. Mass spectrometry conditions:
[0091] The electron impact ion source (EI) was used with a source temperature of 230°C, a quadrupole temperature of 150°C, an mass spectrometer interface temperature of 280°C, an electron energy of 70 eV, and a scan mode of selected ion detection (SIM) with precise qualitative and quantitative ion scanning (GB 23200.8-2016).
[0092] The results are as follows Figure 5 and Figure 6 As shown in the figure, the cis-3-hexenal content of the transgenic line was increased by 36.19% compared with the control, and the cis-3-hexenol content was increased by 31.95% compared with the control, indicating that tobacco with increased cis-3-hexenal and cis-3-hexenol contents in tobacco leaves can be obtained by overexpressing the LOX5 gene.
[0093] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the above embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the above embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.
Claims
1. An application of the LOX5 gene in tobacco variety improvement, characterized by: The nucleotide sequence of the LOX5 gene is shown in SEQ ID NO. 1; the variety improvement is to obtain a tobacco variety with increased cis-3-hexenal and cis-3-hexenol content.
2. The use of the LOX5 gene in tobacco variety improvement according to claim 1, characterized in that: The method for obtaining a tobacco variety with increased cis-3-hexenal and cis-3-hexenol content comprises the following steps: constructing a LOX5 gene overexpression vector, introducing the vector into tobacco, screening and identifying the vector, and obtaining the tobacco variety.
3. The use of the LOX5 gene in tobacco variety improvement according to claim 2, characterized in that: The overexpression vector is constructed by a method comprising the following steps: obtaining a LOX5 gene fragment by PCR amplification, inserting the fragment into a starting vector, and then screening and identifying the fragment.
4. The use of the LOX5 gene in tobacco variety improvement according to claim 3, characterized in that: The primers for the PCR amplification are as follows: LOX5-F: ATGGAACATTCAAGGATAATTGA (shown in SEQ ID NO. 2); LOX5-R: CATGGATATGCTATTAGGTA (shown in SEQ ID NO. 3).
5. The use of the LOX5 gene in tobacco variety improvement according to claim 3, characterized in that: The starting vector is pCAMBIA sup1300.
6. Use of the LOX5 gene in tobacco variety improvement according to any one of claims 1 to 5, characterized in that: The tobacco is K326.