Application of corn ZmbHLH81 gene in regulation and control of plant drought resistance

Abstract

The invention provides an application of a corn ZmbHLH81 gene in regulating and controlling the drought resistance of plants. The ZmbHLH81 gene is overexpressed and knocked out through a genetic engineering means, drought resistance phenotype analysis is carried out, and the result shows that the ZmbHLH81 can positively regulate and control plant drought resistance, so that a new gene resource and a theoretical basis are provided for corn drought resistance breeding, and a feasible technical path is provided for cultivating new varieties of drought-resistant crops. Meanwhile, the theoretical basis of a plant drought-resistant molecular mechanism is enriched through analysis of a ZmbHLH81 gene regulation mechanism, and a reference is provided for subsequent in-depth study of a plant drought-resistant regulation network.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant molecular breeding, and particularly relates to the application of the maize ZmbHLH81 gene in regulating plant drought resistance. Background Art

[0002] As an important global crop for food, feed, and industrial feedstock, maize plays a key role in ensuring national food security. However, drought stress severely impacts maize growth, development, yield, and quality. With the intensification of global climate change, the frequency and intensity of droughts are increasing, making the development of drought-resistant maize varieties a pressing challenge in agriculture. Plant drought tolerance is a complex quantitative trait involving the coordinated regulation of numerous genes and the interaction of signaling pathways. At the molecular level, transcription factors play a central role in plant responses to drought stress by regulating the expression of downstream genes. The bHLH (basic Helix-Loop-Helix) transcription factor family is one of the largest transcription factor families in plants. Its members regulate gene expression by recognizing and binding to specific DNA cis-acting elements, participating in biological processes such as plant growth and development, hormone responses, and responses to adverse environmental stresses. Several bHLH transcription factors have been identified in plants as being involved in abiotic stress responses. However, compared with model plants such as rice and Arabidopsis, the functional understanding of maize bHLH transcription factors in drought tolerance remains relatively underdeveloped. Currently, only a limited number of bHLH transcription factors have been reported to be associated with drought resistance in maize, and their mechanisms of action are not yet fully understood. Therefore, further exploration of bHLH transcription factors with important functions in maize and analysis of their drought resistance regulatory mechanisms are of great theoretical significance and practical value for elucidating the molecular mechanisms of maize drought resistance and creating drought-resistant germplasm resources.

[0003] Currently, improving drought resistance in maize relies primarily on traditional hybrid breeding and limited genetic engineering techniques. Traditional hybrid breeding, which involves selecting germplasm with excellent drought resistance and then crossing them, is time-consuming and labor-intensive, and it is difficult to precisely identify key drought-resistance genes, resulting in low breeding efficiency. While genetic engineering methods can improve crop traits in a targeted manner, the currently applied maize drought-resistance genes are very limited, and research on their mechanisms of action is insufficient. Therefore, exploring maize drought-resistance gene resources, identifying more application-worthy drought-resistance genes, and elucidating the genetic and molecular mechanisms of maize drought resistance are key tasks for current scientific researchers and are also a pressing requirement for the innovation of drought-resistant maize germplasm and the breeding of new drought-resistant maize varieties. Summary of the Invention

[0004] This study, published in Nature Communications, discovered for the first time that the maize bHLH transcription factor gene, ZmbHLH81, can positively regulate drought resistance in maize. By constructing Arabidopsis overexpressing and maize knockout plants and characterizing the drought resistance of the transgenic plants, researchers found that transgenic Arabidopsis overexpressing ZmbHLH81 exhibited enhanced drought resistance compared to wild-type plants, while transgenic maize plants with ZmbHLH81 knockout were more sensitive to drought stress. In vitro water loss rates of leaves in ZmbHLH81 knockout and wild-type plants were also measured, demonstrating that the ZmbHLH81 knockout plants experienced a higher water loss rate than the wild-type plants. Further testing of superoxide dismutase (SOD) and peroxidase (POD) activities in the knockout and wild-type plants revealed lower SOD and POD activities, suggesting that ZmbHLH81 positively regulates maize drought resistance by regulating the scavenging of reactive oxygen species.

[0005] The present invention provides the use of the maize ZmbHLH81 gene in any of the following applications:

[0006] A1) Regulate plant drought resistance;

[0007] A2) Preparation of products for regulating plant drought resistance;

[0008] A3) Regulates the activities of superoxide dismutase and peroxidase in maize;

[0009] A4) Preparation of products for regulating the activity of superoxide dismutase and peroxidase in corn;

[0010] Among them, the amino acid sequence of ZmbHLH81 is shown in SEQ ID NO.2.

[0011] Furthermore, the plant is corn or Arabidopsis thaliana.

[0012] Furthermore, the nucleotide sequence of the ZmbHLH81 gene is shown in SEQ ID NO.1.

[0013] The present invention also provides a method for enhancing plant drought resistance and improving plant superoxide dismutase and / or peroxidase activity, comprising: enhancing or improving the expression level of the ZmbHLH81 gene or the function or activity of its protein, wherein the amino acid sequence of the ZmbHLH81 is shown in SEQ ID NO.2.

[0014] Furthermore, the plant is corn and / or Arabidopsis thaliana.

[0015] Furthermore, the nucleotide sequence of the ZmbHLH81 gene is shown in SEQ ID NO.1.

[0016] The present invention also provides a method for cultivating drought-resistant corn or Arabidopsis germplasm, comprising: constructing a ZmbHLH81 gene overexpression vector, introducing the vector into corn or Arabidopsis recipient material by a transgenic method, and then obtaining drought-resistant plants. The amino acid sequence of the ZmbHLH81 is shown in SEQ ID NO.2.

[0017] Furthermore, the nucleotide sequence of the ZmbHLH81 gene is shown in SEQ ID NO.1.

[0018] Beneficial effects: The present invention systematically reveals the function and action pathway of the maize ZmbHLH81 gene in drought resistance regulation through functional verification, phenotypic analysis and mechanism analysis. The present invention clarifies for the first time the function of the maize ZmbHLH81 gene in regulating plant drought resistance, providing a new gene resource and theoretical basis for maize drought-resistant breeding. Overexpression of the ZmbHLH81 gene through genetic engineering can significantly enhance the drought resistance of plants, providing a practical and feasible technical path for breeding new varieties of drought-resistant crops, helping to improve the planting adaptability and yield of maize in arid areas and ensure food security. In addition, the analysis of the regulatory mechanism of the ZmbHLH81 gene enriches the theoretical basis of the molecular mechanism of plant drought resistance and provides a reference for subsequent in-depth research on the plant drought resistance regulatory network. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for use in the embodiments. It should be understood that the following drawings only illustrate certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other relevant drawings can be obtained based on these drawings without paying any creative work.

[0020] Figure 1 The ZmbHLH81 gene knockout homozygous mutant genotype in Example 3;

[0021] Figure 2 The drought resistance phenotype of the Arabidopsis plants overexpressing ZmbHLH81 in Example 4;

[0022] Figure 3 is the drought resistance phenotype of the ZmbHLH81 maize knockout line in Example 5;

[0023] Figure 4 This is the in vitro water loss rate test of leaves of the ZmbHLH81 maize knockout line in Example 5;

[0024] Figure 5 This is the detection of SOD and POD activities in the knockout line and wild type in Example 6. DETAILED DESCRIPTION

[0025] The following examples are only used to more clearly illustrate the technical scheme of the present invention, and are therefore only used as examples, and cannot limit the scope of protection of the present invention with this. It should be noted that, unless otherwise stated, the technical terms or scientific terms used in this application should be the usual meanings understood by those skilled in the art to which the present invention belongs. Unless otherwise stated, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art. Unless otherwise stated, the reagents and materials used in the following examples are commercially available.

[0026] Example 1: Amplification of the maize ZmbHLH81 gene CDS and construction of an overexpression vector

[0027] The total RNA of maize inbred line B73 was extracted from leaves and reverse transcribed into cDNA. The template amplification primer used for amplifying gene fragments was 1301-bHLH81-F: 5'-GGGACTCCGAGCTCGGTACC ATGAAAG AGGGCAGACCCGG -3',1301-bHLH81-R:5'-AGGTCGACTCTAGAGGATCC TCAGAAGAACTCCATCTTCA -3', where the underlined portion is the gene sequence, and the 5'-end adapter of the primer is a homology arm sequence designed based on the sequence near the vector restriction site. The CDS product of the target gene was obtained by PCR using the high-fidelity enzyme KOD FX and then gel-recovered and purified. The pCAMBIA1301 plasmid was extracted and digested with the restriction endonucleases Kpn I and BamH I. The vector and target gene were recombinantly ligated and transformed into DH5α competent cells. Amplification primers were used to detect positive single colonies, and the positive single colonies were sent for sequencing. The sequencing results were completely consistent with the reference gene sequence of ZmbHLH81, indicating that the overexpression vector OE-ZmbHLH81 was successfully constructed. The CDS sequence of the ZmbHLH81 gene is 1215 bp, as shown in SEQ ID NO.1; it encodes 404 amino acids, and the protein sequence is shown in SEQ ID NO.2.

[0028] Example 2: Obtaining Arabidopsis overexpression plants

[0029] The Arabidopsis thaliana plants used for genetic transformation were wild-type Arabidopsis thaliana (Col-0) maintained in the laboratory. They were cultured on 1 / 2 MS medium for one week before being transferred to a mixed soil (soil:vermiculite = 3:1). The growth chamber was set to a 10 / 14 hour light / dark cycle, a light intensity of 150 μmol·m⁻²·s⁻¹, and 70% humidity. After approximately one month of cultivation, the plants began to flower and were then infected with Agrobacterium at peak flowering.

[0030] The OE-ZmbHLH81 plasmid was extracted and transformed into Agrobacterium GV3101. Single colonies were picked and cultured in liquid LB medium containing kanamycin and rifampicin for 12 hours. Positive clones were identified using primers 1301-bHLH81-F / R and stored at -80°C until ready for use. A 100-mL Erlenmeyer flask was inoculated with 20 μL of the stored Agrobacterium culture medium in 50 mL of liquid LB medium containing kanamycin and rifampicin. The culture was incubated overnight at 28°C and 180 rpm in a shaker until the OD600 reached approximately 0.8, and the cells were harvested. An Arabidopsis infection solution (2.2 g / L 1 / 2MS, 20 g / L sucrose, and 310 μL / L Silwet L-77) was prepared and the Agrobacterium was diluted with the infection solution to an OD600 of approximately 0.6. Soak Arabidopsis inflorescences in this Agrobacterium infection solution for 1 minute. The infected Arabidopsis are then incubated in the dark, moisturized, and then cultured normally. After maturity, T0 seeds are harvested and kept cool and dry. The harvested T1 generation Arabidopsis seeds are disinfected, cleaned, and plated on 1 / 2 MS medium containing hygromycin (50 mg / L) for screening. Positive plants are transplanted to nutrient soil for continued growth to obtain T2 generation seeds. T2 generation seeds are further screened with hygromycin, and strains with a positive:negative ratio of approximately 3:1 are selected for harvesting T3 seedlings. All positive lines in the T3 seedling screen are considered single-copy homozygous lines and used in subsequent experiments.

[0031] Example 3: Construction of corn gene knockout material

[0032] sgRNA Design and Vector Construction: Using CRISPR-P 2.0 software, sgRNAs were designed for exon 1 (5'-GCTACTCCTCGTCTTCGAC-3') and exon 5 (5'-CAGGTTGCTCAGGTCCAGT-3') of the ZmbHLH81 gene, avoiding homology with other genes. The two target sequences were fused to the ends of the OsU3t-TaU3p promoter fragment through two rounds of PCR. The PCR products were then ligated into the pBUE411 vector using a digestion-ligation method using Bsa I restriction enzyme and T4 ligase. The products were transformed into competent Escherichia coli DH5α cells. After positive PCR results were confirmed by sequencing, the plasmids were extracted and transformed into Agrobacterium tumefaciens EHA105.

[0033] Identification of gene knockout plants: Genetic transformation of corn was completed by Wuhan Aidijing Biotechnology Co., Ltd. After obtaining transgenic T1 seeds, they were planted in the field and identified. Leaf DNA was extracted, and primers were designed according to the positions of the two knockout target sites to amplify DNA fragments covering the target sites and sequenced. A small number of positive single plants of the T1 generation were homozygous mutant genotypes, and most of the heterozygous mutant plants were harvested and continued to be planted for the T2 generation and further sequenced and identified. Finally, three types of homozygous mutations that caused protein coding sequence frameshifts were obtained, namely: KO-6 inserted 1 base T at the first target site and 1 base T at the second target site; KO-9 lacked a base C at the first target site and inserted a base C at the second target site; KO-11 deleted 8 bases at the first target site and 3 bases at the second target site ( Figure 1 These three homozygous mutant lines were used for subsequent experiments.

[0034] Example 4: Phenotypic Identification of Arabidopsis Overexpression Plants Under Drought Stress

[0035] Three homozygous overexpression lines (OE lines) and a previously constructed homozygous transgenic line transformed with the empty vector pCAMBIA1301 (EV line) were subjected to drought stress. Sterilized seeds were plated on 1 / 2 MS medium plates and cultured in a growth chamber for about one week. Afterwards, they were transferred to nutrient soil and cultured for about three to four weeks. Watering was stopped for drought stress treatment. After about half of the Arabidopsis plants had completely wilted, they were rehydrated. After seven days, the rehydrated survival rate was calculated. Figure 2 As shown in the figure, the results showed that the rehydration survival rates of the three overexpression lines were significantly higher than those of the control line, indicating that overexpression of ZmbHLH81 can significantly improve the drought resistance of plants.

[0036] Example 5: Phenotypic Identification of Maize Knockout Plants Under Drought Stress

[0037] Identification of drought resistance at the seedling stage: Select seeds of the homozygous mutant line with plump grains and uniform size, and plant them in seedling trays with wild-type B104 seeds for 3-4 days. After most of the corn seedlings emerge from the soil, select corn seedlings with similar growth potential and move them to planting barrels. In the planting barrels, plant knockout lines in half of the positions and wild-type B104 in the other half. Plant about 10 plants of each type, and repeat 5 barrels for each knockout line. Place them in a culture room with 16 hours of light, 8 hours of darkness, 25°C, and 60% humidity. Stop watering after 1 week of culture, and take pictures before the leaves begin to curl and wilt to record the phenotype before drought. When most of the plants of one genotype have completely lost water and wilted, rehydrate them, and record the survival of the corn seedlings 5 ​​days after rehydration. The results are as follows Figure 3 As shown, the results showed that the three knockout lines showed leaf wilting earlier during drought treatment, and their survival rates after rehydration were lower than those of the wild type, indicating that corn after ZmbHLH81 knockout was more sensitive to drought and had reduced drought resistance.

[0038] Further leaf water loss rate detection was conducted: homozygous knockout plants and wild-type B104 plants with the same growth were cultured to the three-leaf and one-heart stage, and leaves from the second leaf were taken. After weighing the initial weight, they were placed under 25°C and 60% humidity conditions. The weights were taken at 0, 2, 4, 6, 8, 10, and 12 hours, a total of 7 time points. The water loss rate at each time point was calculated as follows: water loss rate = (weight at xh - weight at 0 h) / weight at 0 h. The results are shown in the figure. Figure 4 As shown in the results, it was found that starting from 2 h, the water loss rate of the leaves of the three knockout lines was always higher than that of the B104 wild type, which indicated that the ability of corn leaves to retain water was reduced after the knockout of ZmbHLH81, which may be the reason for the reduced drought resistance of the knockout lines.

[0039] Example 6: Detection of Reactive Oxygen Scavenging Enzyme Activity in Corn Gene Knockout Plants

[0040] The leaves from the second leaf of the homozygous knockout line and the wild-type material B104 with consistent growth were selected. Leaves under drought treatment and normal watering conditions were taken, with 5 replicates each. The activities of superoxide dismutase (SOD) and peroxidase (POD) were determined using the Solebow kit microassay. The results are as follows: Figure 5 As shown, the results showed that the SOD and KOD activities of both the KO line and the wild type increased significantly after drought treatment, and the SOD activity and POD activity of the three KO lines were significantly lower than those of the WT, indicating that the knockout of the ZmbHLH81 gene led to a significant decrease in the activity of the antioxidant enzyme system, that is, the ZmbHLH81 gene achieved drought resistance by regulating the activity of superoxide dismutase (SOD) and peroxidase (POD) in corn.

[0041] In summary, the present invention verifies for the first time the function of the maize ZmbHLH81 gene in regulating plant drought resistance. By overexpressing the ZmbHLH81 gene, the drought resistance of plants can be significantly enhanced and the activity of SOD and POD can be increased. This provides a new genetic resource and theoretical basis for drought-resistant maize breeding, and has broad application prospects in the breeding of new drought-resistant crop varieties.

[0042] The above specific embodiments describe the implementation of the present invention in detail, but the present invention is not limited to the specific details of the above embodiments. Within the scope of the claims and technical concept of the present invention, various simple modifications and changes can be made to the technical solution of the present invention, and these simple modifications all fall within the scope of protection of the present invention.

Claims

1. Application of the maize ZmbHLH81 gene in any of the following: A1) Regulate plant drought resistance; A2) Preparation of products for regulating plant drought resistance; A3) Regulates the activities of superoxide dismutase and peroxidase in maize; A4) Preparation of products for regulating the activity of superoxide dismutase and peroxidase in corn; in, The amino acid sequence of ZmbHLH81 is shown in SEQ ID NO.

2.

2. The use according to claim 1, characterized in that The plant is corn or Arabidopsis thaliana.

3. The use according to any one of claims 1-2, characterized in that The nucleotide sequence of the ZmbHLH81 gene is shown in SEQ ID NO.

1.

4. A method for enhancing plant drought resistance and increasing plant superoxide dismutase and / or peroxidase activity, characterized in that: The method comprises: enhancing or improving the expression level of the ZmbHLH81 gene or the function or activity of its protein, wherein the amino acid sequence of the ZmbHLH81 is shown in SEQ ID NO.

2.

5. The method according to claim 4, characterized in that The plant is maize and / or Arabidopsis thaliana.

6. The method according to any one of claims 4-5, characterized in that: The nucleotide sequence of the ZmbHLH81 gene is shown in SEQ ID NO.

1.

7. A method for cultivating drought-tolerant germplasm of corn or Arabidopsis, characterized in that: The method comprises: constructing a ZmbHLH81 gene overexpression vector, introducing the vector into a maize or Arabidopsis receptor material through a transgenic method, and thereby obtaining drought-resistant plants. The amino acid sequence of the ZmbHLH81 is shown in SEQ ID NO.

2.

8. The method according to claim 7, characterized in that The nucleotide sequence of the ZmbHLH81 gene is shown in SEQ ID NO.1.

Images