Rice grain number-per-ear related protein GNP5 as well as coding gene and application thereof

Abstract

The invention discloses a rice grain number per spike related protein GNP5 as well as a coding gene and application thereof, belongs to the technical field of biology, and particularly discloses any one of the following applications of a protein, a substance for regulating and controlling the expression of the coding gene of the protein or a substance for regulating and controlling the activity or content of the protein. A1) application in improving the yield of the gramineous plants and / or application in preparing products for improving the yield of the gramineous plants; a2) application in improving the grain number per spike of the gramineous plant and / or application in preparing a product for improving the grain number per spike of the gramineous plant; and A3) application in improving the secondary branch number of the gramineous plant and / or application in preparing a product for improving the secondary branch number of the gramineous plant. The method can be used for breeding and experiments of yield and / or grain number per ear and / or secondary branch number.

Description

Technical Field

[0001] The present invention relates to a rice grain number per panicle related protein GNP5 and its encoding gene and application in the field of genetic engineering. Background Art

[0002] As a typical C3 plant in the grass family, rice (Rice) has always been a core topic in plant functional genomics and crop genetics breeding. Rice yield is a typical complex agronomic trait regulated by multiple genes, and its phenotypic realization depends on the synergistic effects of three core factors: grain number per panicle, number of effective panicles per unit area, and 1000-grain weight. Among them, grain number per panicle, as the most promising determinant of yield increases, is driven by both intrinsic genetic networks and significant interactions with external factors such as environmental stress and nutrient availability. Currently, conventional hybrid breeding approaches to increase grain number per panicle and effective panicle number have reached a genetic bottleneck, urgently requiring breakthroughs through cutting-edge technologies such as molecular design breeding. Given the multi-gene interaction nature of the developmental regulation of grain number per panicle, systematically identifying novel genes regulating grain number per panicle and elucidating their molecular modes of action and network regulatory mechanisms will not only contribute to the theoretical framework of crop yield formation but also provide innovative technical solutions for molecular breeding of high-yield rice. Summary of the Invention

[0003] The technical problem solved by the invention is to increase the yield, number of grains per ear and number of secondary branches of plants, especially rice.

[0004] In order to solve the above problems, the present invention provides a method for increasing plant yield and / or number of grains per ear and / or number of secondary branches.

[0005] The method comprises increasing the plant yield and / or the number of grains per ear and / or the number of secondary branches by upregulating or enhancing or increasing the expression of a gene encoding a protein in a plant, and / or the activity and / or content of the protein;

[0006] The protein is any of the following proteins:

[0007] B1) the amino acid sequence is the protein shown in SEQ ID No. 2;

[0008] B2) a protein obtained by substitution and / or deletion and / or addition of amino acid residues of the protein described in B1) and having an identity of 80% or more to the protein described in B1) and having the same function;

[0009] B3) A fusion protein obtained by linking the N-terminus and / or C-terminus of B1) or B2) to a protein tag.

[0010] In the present application, the plant may be rice. The rice may be Nipponbare.

[0011] In the above, the biomass yield can be the total amount of organic matter produced and accumulated by the plant during its lifetime, excluding the root system. The biomass yield can be the air-dried weight of a single plant above ground.

[0012] The economic yield is the product yield required for cultivation purposes. The economic yield can be the main stem ear weight of the grass plant.

[0013] In order to solve the above problems, the present invention also provides a method for cultivating plants with high yield and / or number of grains per ear and / or number of secondary branches.

[0014] The method comprises up-regulating, enhancing or increasing the expression level of the gene encoding the above-mentioned protein in the target plant, and / or the activity and / or content of the protein to obtain plants with high yield and / or number of grains per ear and / or number of secondary branches, wherein the yield and / or number of grains per ear and / or number of secondary branches of the plants with high yield and / or number of grains per ear and / or number of secondary branches are higher than those of the target plant.

[0015] In the above method, upregulating, enhancing or increasing the expression of the gene encoding the above protein in the plant comprises introducing the nucleic acid molecule described in B1), the expression cassette described in B2) or the recombinant vector described in B3) into the target plant.

[0016] In the above, the nucleic acid molecule may be the nucleic acid molecule described in SEQ ID No.1.

[0017] In order to solve the above problems, the present invention also provides the following applications.

[0018] Use of a protein, a substance that regulates the expression of a gene encoding the protein, or a substance that regulates the activity or content of the protein in any of the following:

[0019] A1) application in increasing the yield of gramineous plants and / or application in preparing products for increasing the yield of gramineous plants;

[0020] A2) application in increasing the number of grains per spike in grasses and / or application in preparing a product for increasing the number of grains per spike in grasses;

[0021] A3) application in increasing the number of secondary branches of gramineous plants and / or application in preparing a product for increasing the number of secondary branches of gramineous plants;

[0022] The protein is any of the following proteins:

[0023] F1) the amino acid sequence is the protein shown in SEQ ID No. 2;

[0024] F2) a protein obtained by substitution and / or deletion and / or addition of amino acid residues of the protein described in F1) and having an identity of 80% or more to the protein described in F1) and having the same function;

[0025] F3) A fusion protein obtained by linking the N-terminus and / or C-terminus of F1) or F2) to a protein tag;

[0026] The substance that regulates the expression of the gene encoding the protein or the substance that regulates the activity or content of the protein is any one of the following:

[0027] B1), a nucleic acid molecule encoding the protein according to claim 1 or 2;

[0028] B2), an expression cassette containing the nucleic acid molecule described in B1);

[0029] B3), a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);

[0030] B4), a recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3);

[0031] B5), a transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2), or a transgenic plant cell line containing the recombinant vector described in B3);

[0032] B6) transgenic plant tissue containing the nucleic acid molecule described in B1), or transgenic plant tissue containing the expression cassette described in B2), or transgenic plant tissue containing the recombinant vector described in B3);

[0033] B7) a transgenic plant organ containing the nucleic acid molecule described in B1), or a transgenic plant organ containing the expression cassette described in B2), or a transgenic plant organ containing the recombinant vector described in B3);

[0034] B8), a nucleic acid molecule that inhibits, reduces or down-regulates the expression of the gene encoding the protein of claim 1 or 2, or inhibits, reduces or down-regulates the activity or content of the protein;

[0035] B9), expressing the coding gene of the nucleic acid molecule described in B8);

[0036] B10), an expression cassette containing the gene described in B9);

[0037] B11), a recombinant vector containing the gene described in B9), or a recombinant vector containing the expression cassette described in B10);

[0038] B12), a recombinant microorganism containing the gene described in B9), or a recombinant microorganism containing the expression cassette described in B10), or a recombinant microorganism containing the recombinant vector described in B11);

[0039] B13), a transgenic plant cell line containing the gene described in B9), or a transgenic plant cell line containing the expression cassette described in B10), or a transgenic plant cell line containing the recombinant vector described in B11);

[0040] B14), transgenic plant tissue containing the gene described in B9), or transgenic plant tissue containing the expression cassette described in B10), or transgenic plant tissue containing the recombinant vector described in B11);

[0041] B15), a transgenic plant organ containing the gene described in B9), or a transgenic plant organ containing the expression cassette described in B10), or a transgenic plant organ containing the recombinant vector described in B11).

[0042] In the above proteins, the protein tag refers to a polypeptide or protein that is fused and expressed with the target protein using in vitro DNA recombination technology to facilitate the expression, detection, tracing, and / or purification of the target protein. The protein tag can be a Flag tag, His tag, MBP tag, HA tag, myc tag, GST tag, and / or SUMO tag, etc.

[0043] In the above-mentioned proteins, identity refers to amino acid sequence identity. Amino acid sequence identity can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, using Advanced BLAST 2.1, blastp can be used as the program, with the Expect value set to 10, all filters set to OFF, BLOSUM62 as the matrix, and the Gap existence cost, Per residue gap cost, and Lambda ratio set to 11, 1, and 0.85 (default values), respectively. The identity of a pair of amino acid sequences can be calculated and the identity value (%) can be obtained.

[0044] In the above proteins, the above 80% or greater identity may be at least 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 95%, 96%, 98%, 99% or 100% identity.

[0045] Among the above proteins, sequence 2 (SEQ ID No. 2) consists of 426 amino acid residues. It is named GNP5 protein and its encoding gene is GNP5 gene.

[0046] In the present application, the regulation may be overexpression, enhancement, or increase, and / or knockout, reduction, or decrease.

[0047] In the present application, the substance that overexpresses or enhances or increases the expression of the gene encoding the protein or the activity or content of the protein can increase the yield of grass plants and / or the number of grains per spike in grass plants and / or the number of secondary branches in grass plants. Knocking out or reducing or decreasing the substance that expresses the gene encoding the protein or the activity or content of the protein can reduce the yield of grass plants and / or the number of grains per spike in grass plants and / or the number of secondary branches in grass plants.

[0048] In the present application, the yield may be the yield per plant and / or the yield per unit area and / or the yield per mu.

[0049] In the above application, the protein is derived from rice.

[0050] In the above, the rice may be Nipponbare.

[0051] In the above, the substance that regulates gene expression may be a substance that performs at least one of the following six types of regulation: 1) regulation at the transcription level of the gene; 2) regulation after transcription of the gene (that is, regulation of the splicing or processing of the primary transcript of the gene); 3) regulation of RNA transport of the gene (that is, regulation of the transport of the mRNA of the gene from the cell nucleus to the cytoplasm); 4) regulation of the translation of the gene; 5) regulation of the degradation of the mRNA of the gene; 6) post-translational regulation of the gene (that is, regulation of the activity of the protein translated from the gene).

[0052] In the nucleic acid molecules described in B1) or B8), those skilled in the art can readily mutate the nucleotide sequence encoding the GNP5 protein of the present invention using known methods, such as directed evolution or point mutagenesis. Artificially modified nucleotide sequences that are 80% or more identical to the nucleotide sequence of the isolated GNP5 protein of the present invention are derived from and are equivalent to the nucleotide sequence of the present invention, as long as they encode the GNP5 protein and possess the function of the GNP5 protein.

[0053] The aforementioned 80% or more identity may be 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity.

[0054] As used herein, identity refers to the identity of an amino acid sequence or a nucleotide sequence. The identity of an amino acid sequence can be determined using a homology search site on the Internet, such as the BLAST page on the NCBI homepage. For example, the identity of an amino acid sequence can be calculated using Advanced BLAST 2.1 by using blastp as the program, setting the Expect value to 10, all filters to OFF, using BLOSUM62 as the matrix, and setting the Gap existence cost, Perresidue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values), respectively. The value (%) of identity can then be obtained.

[0055] Herein, the vector is well known to those skilled in the art, including but not limited to: plasmid, phage (such as lambda phage or M13 filamentous phage), cosmid (i.e., cosmid), Ti plasmid or viral vector. Specifically, it can be pROKII vector;

[0056] In the above biological materials, the expression cassette described in B2) or B9) refers to a DNA capable of expressing the gene in a host cell, and the DNA may include not only a promoter for initiating gene transcription, but also a terminator for terminating gene transcription. Furthermore, the expression cassette may also include an enhancer sequence. Promoters that can be used in the present invention include, but are not limited to, constitutive promoters, tissue-, organ- and development-specific promoters, and inducible promoters. Examples of promoters include, but are not limited to, the constitutive promoter 35S of cauliflower mosaic virus; a wound-inducible promoter from tomato, leucine aminopeptidase ("LAP", Chao et al. (1999) Plant Physiol 120:979-992); chemically inducible promoters from tobacco, pathogenesis-related (PR1) (induced by salicylic acid and BTH (benzothiadiazole-7-thiocarboxylic acid S-methyl ester)); tomato proteinase inhibitor II promoter (PIN2) or LAP promoter (both inducible by methyl jasmonate); heat shock promoters (U.S. Pat. No. 5,187,267); tetracycline-inducible promoters (U.S. Pat. No. 5,057,422); seed-specific promoters, such as millet seed-specific promoter pF128 (CN101063139B (Chinese Patent No. 200710099169.7)), promoters specific for seed storage proteins (e.g., promoters for phaseolin, napin, oleosin, and soybean beta-conglycin (Beachy et al. (1985) EMBO J. 4:3047-3053)). They can be used alone or in combination with other plant promoters.All references cited herein are incorporated in their entirety. Suitable transcription terminators include, but are not limited to, the Agrobacterium nopaline synthase terminator (NOS terminator), the cauliflower mosaic virus CaMV 35S terminator, the tml terminator, the pea rbcS E9 terminator, and the nopaline and octopine synthase terminators (see, e.g., Odell et al. (1985) Nature 313:810; Rosenberg et al. (1987) Gene, 56:125; Guerineau et al. (1991) Mol. Gen. Genet, 262:141; Proudfoot (1991) Cell, 64:671; Sanfacon et al. Genes Dev., 5:141; Mogen et al. (1990) Plant Cell, 2:1261; Munroe et al. (1990) Gene, 91:151; Ballad et al. (1989) Nucleic Acids Res. 17:7891; Joshi et al. (1987) Nucleic Acid Res., 15:9627).

[0057] In B3) or B11) above, the recombinant vector may be a recombinant expression vector containing the gene expression cassette constructed using a plant expression vector. The plant expression vector may be a Gateway system vector or a binary Agrobacterium vector, such as pGWB411, pGWB412, pGWB405, pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa, pMDC85, or pCAMBIA1391-Xb. When using GNP5 to construct a recombinant expression vector, any enhancing, constitutive, tissue-specific or inducible promoter can be added before its transcription start nucleotide, such as the cauliflower mosaic virus (CAMV) 35S promoter, the ubiquitin gene Ubiqutin promoter (pUbi), etc., which can be used alone or in combination with other plant promoters; in addition, when using the gene of the present invention to construct a plant expression vector, enhancers can also be used, including translation enhancers or transcription enhancers. These enhancer regions can be ATG start codons or adjacent region start codons, etc., but must be in the same reading frame as the coding sequence to ensure correct translation of the entire sequence. The sources of the translation control signals and start codons are wide-ranging and can be natural or synthetic. The translation initiation region can come from a transcription start region or a structural gene. As a specific embodiment, the present application uses the pCM1307 vector as an expression vector. As a specific embodiment, the present application uses the pHUE411 vector as a gene knockout vector.

[0058] As a specific embodiment, the microbial strain in the recombinant microorganism may be Agrobacterium EHA105.

[0059] In the above application, the nucleic acid molecule described in B1) is a DNA molecule having a nucleotide sequence as shown in Sequence 1.

[0060] In the above application, the nucleic acid molecule in B8) is a gRNA targeting the above protein-coding gene, and the target sequence of the gRNA is SEQ ID No. 8 or SEQ ID No. 9.

[0061] In order to solve the above problems, the present invention provides a method for cultivating plants with low yield and / or number of grains per ear and / or number of secondary branches.

[0062] The method comprises down-regulating, weakening or reducing the expression level of the gene encoding the above-mentioned protein in the target plant, and / or the activity and / or content of the protein to obtain a plant with low yield and / or number of grains per ear and / or number of secondary branches, wherein the yield and / or number of grains per ear and / or number of secondary branches of the plant with low yield and / or number of grains per ear and / or number of secondary branches is lower than that of the target plant.

[0063] In any of the above methods or applications, the plant is any of the following:

[0064] J1) Grasses;

[0065] J2) Oryza plants;

[0066] J3) Rice.

[0067] In the present application, the rice may be Nipponbare.

[0068] The above-mentioned protein or nucleic acid molecule.

[0069] Beneficial effects

[0070] bZIP (basic leucine zipper) transcription factors in rice are a class of DNA-binding proteins with conserved basic regions and leucine zipper structures that specifically recognize cis-acting elements within the ACGT core sequence. The rice genome contains approximately 89–100 bZIP genes, organized into 10 subfamilies and unevenly distributed across 12 chromosomes. These transcription factors play a central role in rice growth, development, and environmental adaptation by forming homo- or heterodimers and being regulated by post-translational modifications such as phosphorylation and ubiquitination. They participate not only in responses to abiotic stresses such as drought, high salt concentration, and low temperature but also in regulating pathogen defense, seed development, flowering time, and carbon and nitrogen metabolism. Furthermore, bZIP factors integrate hormonal signals such as abscisic acid and gibberellins, linking environmental stimuli with developmental programs, making them important targets for rice stress tolerance breeding and yield improvement.

[0071] The present invention discovered a gene associated with yield and / or number of grains per ear and / or number of secondary branches and stalks, and named it as GNP5 gene.

[0072] The rice grain number per panicle protein GNP5 involved in the present invention is an important bZIP transcription factor in rice, which may be involved in stress responses such as drought, high salt, and low temperature, and regulate stress resistance-related genes through the abscisic acid signaling pathway.

[0073] The present invention constructs a GNP5 gene overexpression vector and a GNP5 gene knockout vector, which are introduced into wild-type Nipponbare via Agrobacterium EH105 to obtain GNP5 gene overexpression plants GNP5-OE1 and GNP5-OE2, and GNP5 gene knockout plants gnp5-ko1 and gnp5-ko2.

[0074] Planting of Nipponbare, gnp5-ko1, gnp5-ko2, GNP5-OE1, and GNP5-OE2 revealed that the knockout plants (gnp5-ko1 and gnp5-ko2) had significantly lower secondary branch number, grain number per spike, and yield per plant than Nipponbare, while the overexpression plants (GNP5-OE1 and GNP5-OE2) had significantly higher secondary branch number, grain number per spike, and yield per plant than Nipponbare. BRIEF DESCRIPTION OF THE DRAWINGS

[0075] Figure 1 Genome-wide association analysis results;

[0076] Figure 2 Schematic diagram of expression levels and knockout sites of overexpression strains;

[0077] Figure 3 Phenotypes and statistical graphs of knockout transgenic lines;

[0078] Figure 4 Phenotypes and statistical graphs of overexpressing transgenic lines. DETAILED DESCRIPTION

[0079] The present invention provides a rice grain number per panicle protein, GNP5, and its encoding gene and applications. Those skilled in the art can refer to the contents herein and appropriately modify the process parameters to achieve the desired results. It is particularly important to note that all similar substitutions and modifications obvious to those skilled in the art are considered encompassed by the present invention. The methods and applications of the present invention have been described through preferred embodiments. It is apparent that those skilled in the art can modify, alter, and combine the methods and applications herein to implement and apply the technology of the present invention without departing from the content, spirit, and scope of the present invention.

[0080] The test materials used in the present invention are all commercially available. The following examples were processed using GraphPad Prism 8 statistical software. The experimental results are expressed as mean ± standard deviation. One-way ANOVA was used for multiple comparisons. Significant differences between letters were considered to be P < 0.05 (*). The present invention is further described below in conjunction with the examples.

[0081] Example 1: Verification of GNP5 gene function

[0082] Total RNA was extracted from young spikelets of Nipponbare and reverse transcribed into cDNA. The cDNA was used as a template to clone the CDS of GNP5 from Nipponbare using primers GNP5-OE-F / GNP5-OE-R, and a PCR product of GNP5-CDS with recombinant arms was obtained.

[0083] The primers used are as follows:

[0084] GNP5-OE-F:5'- ATCGATACCGTCGACGAGCTCTCTAGAACT ATGGAGGGTGAACCCTCACG-3' (the underlined part is the recombination arm sequence, sequence 4, SEQ ID No. 4);

[0085] GNP5-OE-R:5'- AGACTGGTGATTTTTGCGGAGTACCCGGGTACC TTATTGTGGCTGATTATGCT-3' (the underlined part is the recombination arm sequence, sequence 5, SEQ ID No. 5).

[0086] The PCR product of GNP5-CDS with recombination arms was connected to the plant expression vector pCM1307 by homologous recombination. The specific method is as follows:

[0087] The overexpression vector GNP5-OE is a recombinant vector obtained by replacing the fragment between the restriction endonuclease SpeI and KpnI recognition sites of the vector pCM1307 (pCM1307 is described in the following document: Gao et al.; RRS1 shapes robust root system to enhance drought resistance in rice. New Phytologist, 2023, 238: 1146–1162) with a DNA fragment of the CDS (sequence 1) of GNP5, while keeping the other sequences of the vector pCM1307 unchanged. The recombinant vector is named the overexpression vector GNP5-OE.

[0088] SEQ ID No. 1 (sequence 1) is as follows:

[0089]

[0090]

[0091] SEQ ID No. 1 encodes a protein with the amino acid sequence of SEQ ID No. 2 (Sequence 2). The nucleotide sequence of the gene GNP5 is SEQ ID No. 3, and the amino acid sequence of the protein it encodes is SEQ ID No. 2. This protein is named GNP5 protein; its CDS sequence is SEQ ID No. 1.

[0092] SEQ ID No. 2 (sequence 2) is as follows:

[0093]

[0094] SEQ ID No. 3 (sequence 3) is as follows:

[0095]

[0096]

[0097]

[0098]

[0099] 1. Construction of overexpression vector

[0100] Total RNA was extracted from young spikelets of Nipponbare and reverse transcribed into cDNA. Using this cDNA as a template, the CDS of GNP5 from Nipponbare was cloned using primers GNP5-OE-F / GNP5-OE-R. A PCR product of GNP5-CDS with recombinant arms was obtained. The primers used are as follows:

[0101] GNP5-OE-F:5'-ATCGATACCGTCGACGAGCTCTCTAGAACTATGGAGGGTGAACCCTCACG-3' (Sequence 6, SEQ ID No. 6)

[0102] GNP5-OE-R:5'-AGACTGGTGATTTTTGCGGAGTACCCGGGTACCTTATTGTGGCTGATTATGCT-3' (Sequence 7, SEQ ID No. 7)

[0103] The reaction system is shown in Table 1 below.

[0104] Table 1

[0105]

[0106]

[0107] The PCR procedure is as follows:

[0108] 94℃1min (98℃10s, 60℃15s, 68℃1-kb / min) 35cycles, 68℃10min, 20℃2min.

[0109] The vector pCM1307 (pCM1307 is described in the following literature: Gao et al.; RRS1 shapes robust root system to enhance drought resistance in rice. New Phytologist, 2023, 238: 1146–1162) was digested with restriction endonucleases SpeI and Kpn1 to obtain a linear vector.

[0110] The PCR product of GNP5-CDS with the recombination arm was ligated with the linear vector to obtain the overexpression vector GNP5-OE. The recombinase ligation system is as follows:

[0111]

[0112] The overexpression vector GNP5-OE is a recombinant vector obtained by replacing the fragment between the restriction endonuclease SpeI and kpnI recognition sites of the vector pCM1307 (pCM1307 is described in the following literature: Gao et al.; RRS1 shapes robust root system to enhance drought resistance in rice. New Phytologist, 2023, 238: 1146–1162) with a DNA fragment of the CDS (sequence 1) of GNP5, while keeping the other sequences of the vector pCM1307 unchanged. The recombinant vector is named overexpression vector GNP5-OE.

[0113] The above primers were all written in the 5' to 3' direction.

[0114] 2. Construction of knockout vector

[0115] (1) Log in to the website http: / / crispor.tefor.net / and screen the target site. It is best if the target site has an enzyme cleavage site [Cas9 cleavage site (3bp away from PAM / NGG) is located in the enzyme cleavage site]. You can also manually design the target site and then go to http: / / www.rgenome.net / cas-offinder / to evaluate the off-target situation. The target site editing efficiency can be predicted using the website http: / / www.crisprscan.org / ?page=sequence. The target site sequences designed in this study are 5'-CGGCCCCTATGCTAGAACT-3' (sequence 8, SEQ ID No. 8) and 5'-GCATCTGCCACGAAGTCAA-3' (sequence 9, SEQ ID No. 9).

[0116] (2) Design primers, the sequences are as follows:

[0117] GNP5-MT1-BsF: (SEQ ID No. 10)

[0118] 5'-ATATATGGTCTCTGGCGCGGCCCCTATGCTAGAACTGTT-3'

[0119] GNP5-MT1-F0: (SEQ ID No. 11)

[0120] 5'-TGCGGCCCCTATGCTAGAACTGTTTTAGAGCTAGAAATAGC-3'

[0121] GNP5-MT2-R0: (SEQ ID No. 12)

[0122] 5'-AACTTGACTTCGTGGCAGATGCCCGCTTCTTGGTGCC-3'

[0123] GNP5-MT2-BsR: (SEQ ID No. 13)

[0124] 5'-ATTATTGGTCTCTAAACTTGACTTCGTGGCAGATGCC-3'

[0125] (3) PCR amplification: Four-primer PCR amplification was performed using pCBC-MT1T2 (described in the following literature: Xing et al.; A CRISPR / Cas9 toolkit for multiplex genome editing in plants [J]. BMC Plant Biology, 2014, 14: 327.) diluted 100-fold based on the normal primer concentration as the template. GNP5-MT1-BsF / GNP5-MT2-BsR was the normal primer concentration; GNP5-MT1-F0 / GNP5-MT2-R0 was diluted 20-fold based on the normal primer concentration to obtain the PCR amplification product.

[0126] (4) Purification and recovery were performed to obtain the PCR fragments. The following enzyme digestion-ligation system was established (as shown in Table 2 below). After the reaction was completed, the ligation product was obtained:

[0127] Table 2

[0128]

[0129] Note 1: The pHUE411 vector is publicly available from China Agricultural University. The pHUE411 vector is described in the following literature: RRS1 shapes robust root system to enhance drought resistance in rice. New Phytologist (2023) 238: 1146–1162. The name in this literature is vector pHUE411.

[0130] (5) The ligation product was transformed into competent E. coli. Screening was performed on Kan plates. OsU3-FD3 + TaU3-RD = 831 bp was identified by colony PCR, and OsU3-FD3 and TaU3-FD2 were sequenced. The correct vector was named knockout vector GNP5-CR. Note 2: Colony PCR and sequencing primers: OU3-RD: 5'-TGGTCCCTGACTGCACATCTGATTC-3' (sequence 14, SEQ ID No. 14); OsU3-FD3: 5'-GACAGGCGTCTTCTACTGGTGCTAC-3' (sequence 15, SEQ ID No. 15); TaU3-RD: 5'-CTCACAAATTATCAGCACGCTAGTC-3' (sequence 16, SEQ ID No. 16); TaU3-FD2: 5'-TTGACTAGCGTGCTGATAATTTGTG-3' (sequence 17, SEQ ID No. 17).

[0131] The knockout vector GNP5-CR replaces the fragment between the two BsaI restriction sites of pHUE411 with the DNA fragment of the MT1T2 vector with the knockout target site.

[0132] Sequence 18, SEQ ID No. 18), the recombinant vector obtained by keeping other sequences of pHUE411 unchanged was named the knockout vector GNP5-CR.

[0133] 3. Obtaining genetically modified rice

[0134] (1) Recombinant bacteria

[0135] The overexpression vector GNP5-OE and knockout vector GNP5-CR prepared above were transformed into Agrobacterium tumefaciens EHA105 by freeze-thaw method, resulting in EHA105 / overexpression vector GNP5-OE and EHA105 / knockout vector GNP5-CR. EHA105 / overexpression vector GNP5-OE is an Agrobacterium tumefaciens EHA105 containing the overexpression vector GNP5-OE, while EHA105 / knockout vector GNP5-CR is an Agrobacterium tumefaciens EHA105 containing the knockout vector GNP5-CR. These were used to infect calli of the transgenic recipient variety (Nipponbare).

[0136] (2) Transgenic rice

[0137] The classic Agrobacterium-mediated callus infection method is adopted, and the specific steps are as follows:

[0138] a. Obtaining Embryogenic Callus: Mature Nipponbare seeds were shelled and disinfected with alcohol. Rinse once with sterile water and air-dry for 3 hours. Inoculate onto NB medium and culture in the dark at 28°C for 2 weeks. The embryonic callus was peeled and subcultured onto fresh NB medium for 2 weeks (two subcultures).

[0139] b. Prepare infection solution: Take the preserved EHA105 / overexpression vector GNP5-OE and EHA105 / knockout vector GNP5-CR, spread them on solid culture medium containing rifampicin and corresponding antibiotics, invert and culture in the dark at 28℃ for 2 days, scrape a small amount of Agrobacterium into AAM liquid culture medium, and the bacterial solution concentration OD 600 About 0.3.

[0140] c. Co-cultivation: Select naturally dispersed, bright yellow granular callus tissue with a diameter of about 3 to 5 mm and place it in a triangular flask. Add the prepared infection solution and infect for 10 minutes. Use sterile filter paper to absorb the excess infection solution and place it on the co-cultivation medium covered with a layer of filter paper. Co-cultivate at 20°C for 2 to 3 days.

[0141] d. Screening for Resistant Calli: Remove the co-cultured calli and wash them 5-6 times with sterile water by rapid shaking. Rinse again with sterile water containing cephalosporin and carbenicillin for 20 minutes. Finally, drain on sterile filter paper for 3 hours. Transfer the calli to delayed selection medium. After one week, transfer them to the first selection medium. After two weeks, transfer them to the second selection medium and continue culturing for two weeks.

[0142] e. Differentiation: The resistant callus obtained by screening was inoculated into a pre-differentiation medium and cultured in the dark at 28°C for 2 weeks. Then, the callus was transferred to a differentiation medium and cultured in the light for 2-3 weeks to obtain regenerated transgenic seedlings.

[0143] f. Transfer the seedlings to a seedling growth medium. After the seedlings have rooted and grown, remove the culture flask, wash the medium on the roots, and harden the seedlings for 1-2 weeks. Then, transplant them to the field and plant them until they mature. Using Nipponbare as a control, detect the overexpression plants using PCR identification primers for the overexpression line. After confirmation, obtain 20 T0-generation seedlings transformed with EHA105 / overexpression vector GNP5-OE and designate them as GNP5-OE1 to GNP5-OE20. Obtain 20 T0-generation seedlings transformed with EHA105 / knockout vector GNP5-CR and designate them as gnp5-ko1 to gnp5-ko20.

[0144] The culture medium formula used in the above transgenic process is shown in Table 3.

[0145] Table 3 Formulas of various culture media used in the transgenic process

[0146]

[0147] Note: The basic components of NB culture medium include N6 macroelements, B5 trace elements, B5 organic components, 150 mg / L inositol, 300 mg / L hydrolyzed casein, 500 mg / L glutamine, 600 mg / L proline, 30 g / L sucrose, and 3 g / L plant gelatin.

[0148] 4. Screening of positive lines of each transgenic plant

[0149] The above-mentioned GNP5-OE1, GNP5-OE2, gnp5-ko1 and gnp5-ko2 were self-pollinated to obtain the T2 generation homozygous plant seeds of GNP5-OE1, GNP5-OE2, gnp5-ko1 and gnp5-ko2, namely, the T2 generation homozygous plant seeds of GNP5-OE1, the T2 generation homozygous plant seeds of GNP5-OE2, the T2 generation homozygous plant seeds of gnp5-ko1 and the T2 generation homozygous plant seeds of gnp5-ko2.

[0150] The results are as follows Figure 2 ( Figure 2 As described in the figure (Schematic diagram of expression level identification and knockout sites of overexpressing plants), Figure 2 (a) in the middle is the mutation region sequence of gnp5-ko1 to gnp5-ko2, and Nip is Nipponbare.

[0151] Compared with Nipponbare, the T2 generation homozygous plants of gnp5-ko1 had the following mutation in the GNP5 gene in one of the rice chromosomes: one nucleotide was inserted between positions 680 and 681 of the GNP5 gene (sequence 3), corresponding to one nucleotide insertion between positions 680 and 681 of the cDNA of the GNP5 gene (sequence 1), causing a frameshift and knocking out the GNP5 gene.

[0152] Compared with Nipponbare, the T2 generation homozygous plants of gnp5-ko2 had the following mutation in the GNP5 gene in one of the rice chromosomes: a 29-nucleotide deletion occurred at positions 657 to 686 of the GNP5 gene (sequence 3), and a 29-nucleotide deletion occurred at positions 657 to 686 of the cDNA of the GNP5 gene (sequence 1), resulting in a frameshift and knockout of the GNP5 gene.

[0153] The seeds of Nipponbare, the T2 generation homozygous plant seeds of GNP5-OE1, the T2 generation homozygous plant seeds of GNP5-OE2, the T2 generation homozygous plant seeds of gnp5-ko1 and the T2 generation homozygous plant seeds of gnp5-ko2 were identified:

[0154] The above seeds (Nipponbare seeds, T2 generation homozygous plant seeds of GNP5-OE1, T2 generation homozygous plant seeds of GNP5-OE2, T2 generation homozygous plant seeds of gnp5-ko1, and T2 generation homozygous plant seeds of gnp5-ko2) were planted. At the panicle stage, total RNA was extracted from the rice panicles and reverse transcribed into cDNA. The constitutively expressed OsActin1 gene was used as an internal reference (OsActin1-F: CACAGGTATTGTGTTGGACTCTG sequence 19, SEQ ID No. 19; OsActin1-R: AGTAACCACGCTCCGTCAGG sequence 20, SEQ ID No. 20) to normalize the cDNA concentration of the samples. Then, real-time fluorescence quantitative PCR (RT-qPCR) analysis was performed using the GNP5 gene specific primers GNP5-RT-F (5'-GTTGGGAGACGCTCTGACTT-3' sequence 21, SEQ ID No. 21) and GNP5-RT-R (5'-GAACCACTTGGCAGATTTGGA-3' sequence 22, SEQ ID No. 22). -△△CT Method (Livak KJ,SchmittgenTD.2001.Analysis of relative geneexpression data using real-time quantitative PCR and the2 -△△ CT The expression of GNP5 gene at RNA level was analyzed by RT-PCR. Each sample was repeated 3 times. The results are shown in Figure 2. Figure 2 As shown in (b and c), Nipponbare, GNP5-OE1 is the T2 generation homozygous plant of GNP5-OE1, GNP5-OE2 is the T2 generation homozygous plant of GNP5-OE2, gnp5-ko1 is the T2 generation homozygous plant seed of gnp5-ko1, and gnp5-ko2 is the T2 generation homozygous plant seed of gnp5-ko2.

[0155] Using Nipponbare as a control and the OsActin1 gene as an internal reference, the expression levels of GNP5-OE1 to GNP5-OE20 were detected using fluorescent quantitative primers for identifying the expression levels of overexpressed plants (the reaction system is shown in Table 4 below):

[0156] Table 4

[0157] SYBR Premix Ex Taq 5μl Primer (F+R) 0.4 μl Dye2 0.2 μl cDNA 1 μl <![CDATA[ddH2O]]> 3.4 μl

[0158] Real-time fluorescence quantitative PCR was performed on an Applied Biosystems 7500 Real Time PCR system (ABI, USA), with three replicates per experiment. -ΔΔCT Calculate the relative expression level.

[0159] ΔΔCT=(CT.Target-CT.OsActin1)Timex-(CT.Target-CT.OsActin1)Time0; Timex represents any time point, and Time 0 represents the target gene expression at 1-fold after correction by OsActin1.

[0160] The results are as follows Figure 2 , ( Figure 2 Schematic diagram of knockout sites, expression levels of gene knockout plants and expression levels of overexpression plants) are described. Figure 2 Middle (b), Nipponbare, gnp5-ko1 is the T2 generation homozygous plant of gnp5-ko1 and gnp5-ko2 is the T2 generation homozygous plant of gnp5-ko2. The vertical axis is the fluorescence quantitative detection result, indicating that the expression levels of these two knockout strains are significantly lower than Nipponbare and are used in the following experiments. Figure 2 Middle (c), Nipponbare, GNP5-OE1 is the T2 generation homozygous plant of GNP5-OE1 and GNP5-OE2 is the T2 generation homozygous plant of GNP5-OE2. The vertical axis is the fluorescence quantitative detection result, indicating that the expression levels of these two overexpression homozygous strains are significantly higher than Nipponbare, and the expression levels of the two gene knockout homozygous strains are significantly lower than Nipponbare, and are used in the following experiments.

[0161] 5. Identification of relevant traits of transgenic rice

[0162] The number of secondary branches, number of grains per panicle and yield per plant of each transgenic rice positive line and its corresponding recipient variety (Nipponbare) obtained in step 4 of the manual investigation were analyzed.

[0163] Materials and Methods

[0164] Overview of the test site

[0165] Beijing has a warm temperate, semi-humid, semi-arid monsoon climate. The average annual temperature in the plains ranges from 11°C to 13°C, with annual maximum temperatures generally ranging from 35°C to 40°C. The annual minimum temperature generally ranges from -14°C to -20°C. Annual precipitation is unevenly distributed, with less than 500 mm in the northwest and deep mountainous areas of the north, and between 500 and 600 mm in the plains and some mountainous areas. Summer precipitation accounts for approximately three-quarters of annual precipitation. The experimental site is located east of Xinlitun Village, Shangzhuang Town, Haidian District, Beijing, at the China Agricultural University Experimental Station (coordinates: 116.192123, 40.143353). It is adjacent to the Xishan Mountains to the west and is a dryland cropping area requiring irrigation. The above-mentioned Nipponbare, T2 generation homozygous plant seeds of gnp5-ko1, T2 generation homozygous plant seeds of gnp5-ko2, T2 generation homozygous plant seeds of GNP5-OE1, and T2 generation homozygous plant seeds of GNP5-OE2 were planted as follows.

[0166] Experimental design

[0167] The experiment adopted a randomized block design with 3 replicates per cultivation area. The area of ​​each plot was 4m 2 (2m×2m).

[0168] Cultivated rice

[0169] Pre-processed land

[0170] On April 25, 2023, the land was deeply plowed, the soil was loosened and weeds were removed, and the land was irrigated.

[0171] Sowing and raising seedlings

[0172] The seeds in this example were sown on May 3, 2023, and the sowing in all the test areas of this example was completed within one day.

[0173] Pulling out rice seedlings and transplanting them

[0174] On June 2, 2023, rice seedlings were transplanted in the flat cultivation area of ​​the irrigated and leveled experimental plot, with a row spacing of 23.3 cm and a plant spacing of 13.3 cm.

[0175] Field management

[0176] Irrigation was carried out regularly; weed control was carried out regularly by manual removal, and no fertilizer was applied during the entire experimental period.

[0177] Index detection

[0178] When the above plants (Nipponbare, T2 generation homozygous plants of gnp5-ko1, T2 generation homozygous plants of gnp5-ko2, T2 generation homozygous plants of GNP5-OE1 and T2 generation homozygous plants of GNP5-OE1) grew to the yellow maturity stage of the grains (the specific date in this embodiment is October 201, 2023), the planting conditions, phenotypes and number of branches of each of the above plants were photographed and recorded, and the ear length, number of primary branches, number of secondary branches, number of grains per ear, and yield per plant were tested.

[0179] Ear length: The length from the branch node to the top of the kernel. Ten individual plants were tested for each line, and three ears were tested for each individual plant.

[0180] Primary stalk number: All secondary branches on the main stalk are the primary stalk number. Ten individual plants were tested for each line, and three ears were tested for each individual plant.

[0181] Secondary branch number test: The number of secondary branches with at least two kernels on a primary branch is considered the secondary branch number. Ten individual plants were tested for each line, and three ears were tested for each individual plant.

[0182] Grain number per ear: The total number of grains on a single ear is the grain number per ear. Ten individual plants were tested for each line, and three ears were tested for each individual plant.

[0183] Yield per plant: The weight of all the grains on a single plant is the yield per plant, in grams. Ten plants were tested for each line.

[0184] The results showed that the number of secondary branches, number of grains per ear and yield per plant of the overexpression plants (GNP5-OE1 and GNP5-OE2) were significantly higher than those of Nipponbare.

[0185] Data processing

[0186] Data were preliminarily analyzed using Excel, and significance analysis was performed using the ANOVA model in GraphPad Prism 8 software. Results are expressed as mean ± standard error. Graphs were drawn using GraphPad Prism 8 software.

[0187] Results and Analysis

[0188] The results of the secondary branch number, grain number per ear and yield per plant of the T2 generation homozygous plants of GNP5-OE1 and GNP5-OE2 are as follows: Figure 4 shown. Figure 4Sunny day in the middle of Japan, GNP5-OE1 is the T2 generation homozygous plant of GNP5-OE1, and GNP5-OE2 is the T2 generation homozygous plant of GNP5-OE2; (a) is the plant type diagram of the overexpression line, (b) is the ear type diagram of the overexpression line after harvest, (c) is the ear length, (d) is the number of primary stalks, (e) is the number of grains per ear per primary stalk, (f) is the number of secondary stalks, (g) is the number of grains per ear per secondary stalk, (h) is the number of grains per ear, and (i) is the yield per plant.

[0189] The results showed that the number of secondary branches, number of grains per ear and yield per plant of the overexpression plants (T2 homozygous plants of GNP5-OE1 and T2 homozygous plants of GNP5-OE2) were significantly higher than those of Nipponbare.

[0190] The process of obtaining GNP5 is as follows:

[0191] To identify more genes associated with grain number per panicle, 496 cultivated rice accessions were grown in Nanning, Guangxi Zhuang Autonomous Region, a warmer region in China, and Yuxi, Yunnan Province, a cooler region. Genome-wide association analysis was performed on grain number per panicle, ranging from 37.6 to 409.7 in Nanning and from 38.5 to 461.8 in Yuxi. A compressed mixed linear model revealed 19 quantitative trait loci associated with grain number per panicle. This study focused on a novel QTL, qGNP4a, located on chromosome 4. Within a 500 kb region, a 450.246 kb interval was associated with the highest signal. Further analysis revealed that, according to RGAP annotation (http: / / rice.plantbiology.msu.edu / ), this interval contains 67 genes, but only seven of these contain significant SNPs (log10(poObserved)>4.65). Two of these genes encode expressed proteins. Total RNA was extracted from rice panicles and reverse-transcribed into cDNA. Fluorescence quantitative analysis of the expression levels of five other genes in rice panicles revealed that LOC_Os04g10260 was expressed at the highest level in panicles, suggesting that it may play an important role in inflorescence development. These results prompted further investigation into LOC_Os04g10260. LOC_Os04g10260 is a bZIP-type transcription factor gene involved in abiotic stress responses (such as drought and salt stress) and growth and development regulation in rice. It was named GRAINNUMBER PER PANICLE5 (GNP5).

[0192] Using cDNA from the rice variety Nipponbare as a template and primers 5'-ATGGAGGGTGAACCCTCACG-3' (SEQ ID No. 23) and 5'-TTATTGTGGCTGATTATGCT-3' (SEQ ID No. 24), the candidate gene GNP5 was amplified by PCR and named GNP5.

[0193] After sequencing, the nucleotide sequence of the candidate gene GNP5 is SEQ ID No.3, and the amino acid sequence of the protein it encodes is SEQ ID No.2. It is named GNP5 protein; its CDS sequence is SEQ ID No.1, Figure 1 The results of genome-wide association analysis.

[0194] The above are only preferred embodiments of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A method for increasing plant yield and / or number of grains per ear and / or number of secondary branches, characterized in that: The invention relates to increasing plant yield and / or the number of grains per ear and / or the number of secondary branches by up-regulating, enhancing or increasing the expression of a gene encoding a protein in a plant, and / or the activity and / or content of the protein; The protein is any of the following proteins: B1) the amino acid sequence is the protein shown in SEQ ID No. 2; B2) a protein obtained by substitution and / or deletion and / or addition of amino acid residues of the protein described in B1) and having an identity of 80% or more to the protein described in B1) and having the same function; B3) A fusion protein obtained by linking the N-terminus and / or C-terminus of B1) or B2) to a protein tag.

2. A method for cultivating plants with high yield and / or number of grains per ear and / or number of secondary branches, characterized in that: The method comprises up-regulating, enhancing or increasing the expression level of the gene encoding the protein described in claim 1 in the target plant, and / or the activity and / or content of the protein to obtain plants with high yield and / or number of grains per ear and / or number of secondary branches, wherein the yield and / or number of grains per ear and / or number of secondary branches of the plants with high yield and / or number of grains per ear and / or number of secondary branches are higher than those of the target plant.

3. The method according to claim 1 or 2, wherein: The upregulation, enhancement or improvement of the expression of the gene encoding the protein of claim 1 or 2 in the plant comprises introducing the nucleic acid molecule described in B1) of claim 4, the expression cassette described in B2) of claim 4 or the recombinant vector described in B3) of claim 4 into the target plant.

4. Use of a protein, a substance that regulates the expression of a gene encoding the protein, or a substance that regulates the activity or content of the protein in any of the following: A1) application in increasing the yield of gramineous plants and / or application in preparing products for increasing the yield of gramineous plants; A2) application in increasing the number of grains per spike in grasses and / or application in preparing a product for increasing the number of grains per spike in grasses; A3) application in increasing the number of secondary branches of gramineous plants and / or application in preparing a product for increasing the number of secondary branches of gramineous plants; The protein is any of the following proteins: F1) the amino acid sequence is the protein shown in SEQ ID No. 2; F2) a protein obtained by substitution and / or deletion and / or addition of amino acid residues of the protein described in F1) and having an identity of 80% or more to the protein described in F1) and having the same function; F3) A fusion protein obtained by linking the N-terminus and / or C-terminus of F1) or F2) to a protein tag; The substance that regulates the expression of the gene encoding the protein or the substance that regulates the activity or content of the protein is any one of the following: B1), a nucleic acid molecule encoding the protein according to claim 1 or 2; B2), an expression cassette containing the nucleic acid molecule described in B1); B3), a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4), a recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3); B5), a transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2), or a transgenic plant cell line containing the recombinant vector described in B3); B6) transgenic plant tissue containing the nucleic acid molecule described in B1), or transgenic plant tissue containing the expression cassette described in B2), or transgenic plant tissue containing the recombinant vector described in B3); B7) a transgenic plant organ containing the nucleic acid molecule described in B1), or a transgenic plant organ containing the expression cassette described in B2), or a transgenic plant organ containing the recombinant vector described in B3); B8), a nucleic acid molecule that inhibits, reduces or down-regulates the expression of the gene encoding the protein of claim 1 or 2, or inhibits, reduces or down-regulates the activity or content of the protein; B9), expressing the coding gene of the nucleic acid molecule described in B8); B10), an expression cassette containing the gene described in B9); B11), a recombinant vector containing the gene described in B9), or a recombinant vector containing the expression cassette described in B10); B12), a recombinant microorganism containing the gene described in B9), or a recombinant microorganism containing the expression cassette described in B10), or a recombinant microorganism containing the recombinant vector described in B11); B13), a transgenic plant cell line containing the gene described in B9), or a transgenic plant cell line containing the expression cassette described in B10), or a transgenic plant cell line containing the recombinant vector described in B11); B14), transgenic plant tissue containing the gene described in B9), or transgenic plant tissue containing the expression cassette described in B10), or transgenic plant tissue containing the recombinant vector described in B11); B15), a transgenic plant organ containing the gene described in B9), or a transgenic plant organ containing the expression cassette described in B10), or a transgenic plant organ containing the recombinant vector described in B11).

5. The use according to claim 4, characterized in that The protein is derived from rice.

6. The use according to claim 4 or 5, characterized in that The nucleic acid molecule described in B1) is a DNA molecule whose nucleotide sequence is shown in SEQ ID No.

1.

7. The use according to claim 4 or 5, characterized in that B8) The nucleic acid molecule is a gRNA targeting the protein-coding gene of claim 1, and the target sequence of the gRNA is SEQ ID No. 8 or SEQ ID No.

9.

8. A method for cultivating plants with low yield and / or number of grains per ear and / or number of secondary branches, characterized in that: The method comprises down-regulating, weakening or reducing the expression level of the gene encoding the protein described in claim 1 in the target plant, and / or the activity and / or content of the protein to obtain a plant with low yield and / or number of grains per ear and / or number of secondary branches, wherein the yield and / or number of grains per ear and / or number of secondary branches of the plant with low yield and / or number of grains per ear and / or number of secondary branches is lower than that of the target plant.

9. The method according to any one of claims 1 to 3 or 8 or the use according to any one of claims 4 to 7, characterized in that: The plant is any one of the following: J1) Grasses; J2) Oryza plants; J3) Rice.

10. The protein or nucleic acid molecule according to claim 4.

Images