Application and method of cotton GhDRP3 gene in improvement of drought resistance character of cotton

Abstract

The invention belongs to the technical field of biology, and relates to research on drought resistance of cotton, in particular to application and a method of a cotton GhDRP3 gene in improvement of drought resistance of cotton. The GhDRP3 gene serves as a key gene for negatively regulating the drought resistance of cotton, and the drought resistance of plants can be remarkably improved through function inhibition of the GhDRP3 gene. Specifically, after the expression of the GhDRP3 is interfered by a VIGS technology, the survival rate of the plant under drought stress is obviously improved. In addition, a ghdrp3 gene editing mutant is also created by using a CRISPR / Cas9 system, and compared with a wild type material, the mutant shows better drought tolerance. The discoveries correspond to previous researches on cotton drought-resistant gene functions, and further verifies that targeted regulation of negative regulatory factors through a gene editing technology is an effective way for improving crop drought resistance. Therefore, the GhDRP3 has a huge potential value for cultivating a new drought-resistant cotton variety.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to the research on drought resistance of cotton. Background Art

[0002] Cotton is a global fiber and oilseed crop. With global warming and the shortage of irrigable water resources, cotton is increasingly susceptible to drought stress, resulting in a decline in cotton quality and yield. Therefore, studying the functions of genes involved in cotton's drought response is crucial for uncovering the molecular mechanisms of cotton's drought resistance and improving its ability to withstand it.

[0003] The U-box domain is a modified ring finger structure consisting of 75 amino acids. Many U-box-containing proteins function as E3 ubiquitin ligases, primarily involved in the ubiquitination process of proteins by recognizing and attaching ubiquitin molecules to substrate proteins (Cho et al., 2008). Ubiquitinated proteins can be recognized and degraded by the proteasome, thereby participating in physiological processes such as regulating plant growth and development (such as seed germination and flowering time regulation), hormone signaling (such as auxin and abscisic acid signaling pathways), and plant responses to biotic and abiotic stresses (such as pathogen infection, drought, and salinity) (Chen et al., 2021; Liu et al., 2011). Summary of the Invention

[0004] The present invention provides a cotton GhDRP3 The application and method of genes in improving the drought resistance of cotton have been discovered. GhDRP3 Gene, provides a method for regulating cotton drought resistance related genes GhDRP3 New breeding application strategies.

[0005] The technical solution of the present invention is achieved as follows: In the first aspect, the present application provides cotton GhDRP3 Application of genes in improving drought resistance traits in cotton.

[0006] Further, the application is to make cotton GhDRP3 Loss of gene function.

[0007] Specifically, the cotton GhDRP3 The nucleotide sequence of the gene is shown in SEQ ID No.1.

[0008] In a second aspect, the present application provides a method for improving drought resistance of cotton, the method being selected from any one of the following: (1) Constructing a gene silencing expression vector using VIGS technology to specifically silence the cotton plant to be improvedGhDRP3 Gene, get silent cotton GhDRP3 genetically modified cotton plants; (2) Using the CRISPR / Cas9 system to improve cotton plants GhDRP3 Gene editing to obtain GhDRP3 Cotton plants with a missing gene function.

[0009] Furthermore, the cotton GhDRP3 The nucleotide sequence of the gene is shown in SEQ ID No.1.

[0010] Preferably, the primers for the VIGS expression vector in the above method (1) are GhDRP3-VIGS-F with a sequence as shown in SEQ ID No. 1 and GhDRP3-VIGS-R with a sequence as shown in SEQ ID No. 2.

[0011] Preferably, the target sites for gene editing in the above method (2) are sgRNA1 having a sequence as shown in SEQ ID No. 3 and sgRNA2 having a sequence as shown in SEQ ID No. 4.

[0012] Preferably, the primer pair used to detect the target site sgRNA1 is GhDRP3-sgRNA1-F with a sequence as shown in SEQ ID No. 5 and GhDRP3-sgRNA1-R with a sequence as shown in SEQ ID No. 6; The primer pair used to detect the target site sgRNA2 is GhDRP3-sgRNA2-F as shown in SEQ ID No. 7 and GhDRP3-sgRNA2-R as shown in SEQ ID No. 8.

[0013] In a third aspect, the present application seeks to protect the use of the above method in preparing cotton plants with high drought resistance.

[0014] The present invention has the following beneficial effects: 1. The present invention successfully cloned a gene closely related to cotton drought resistance. GhDRP3 Gene. Constructed by virus-induced gene silencing (VIGS) technology GhDRP3 The study found that the survival rate of gene-silenced plants under drought stress was significantly improved, revealing the negative regulatory mechanism of this gene in cotton drought resistance. This study provides a key candidate gene for the innovation of upland cotton stress-resistant germplasm.

[0015] 2. This application GhDRP3 As a key gene that negatively regulates drought resistance in cotton, its functional inhibition can significantly improve the drought resistance of plants. Specifically, virus-induced gene silencing (VIGS) technology can be used to interfere with the drought resistance of cotton plants. GhDRP3After expression, the survival rate of plants under drought stress was significantly improved. In addition, the CRISPR / Cas9 system was used to create ghdrp3 Gene-edited mutants showed better drought tolerance than wild-type materials. These findings echo previous studies on the function of cotton drought-resistant genes and further verify that targeting negative regulatory factors through gene editing technology is an effective way to improve crop drought resistance. GhDRP3 It has great potential value in breeding new drought-resistant cotton varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0017] Figure 1 for GhDRP3 Gene expression patterns in leaves and roots of two cotton varieties, ZY007 (drought-tolerant) and ZY168 (sensitive), under normal and drought conditions; the gray violin plot on the left represents leaves and roots under normal conditions; the purple violin plot on the right represents leaves and roots under drought conditions.

[0018] Figure 2 for GhDRP3 Detection of interference efficiency; Figure (a) is the detection GhDRP3 Interference efficiency of RT-PCR agarose gel electrophoresis diagram; (b) Figure is TRV: GhDRP3 Agrobacterium detection nucleic acid gel electrophoresis diagram; (c) The figure is the interference efficiency detection QRT-PCR result bar graph ( TRV: 00 : The gray histogram on the left, TRV: GhDRP3 : purple bar graph on the right, ***: extremely significant difference).

[0019] Figure 3 Control plants TRV: 00 With silent plants TRV: GhDRP3 Growth conditions under different conditions; (a) is the control plant TRV: 00 With silent plants TRV: GhDRP3 Plant growth conditions under conditions of sufficient water, 10 days of drought, and 24 hours of rehydration; (b) is the positive control, TRV: CLA The intervention plant (CLA is a key enzyme in chlorophyll synthesis) showed albinism; (c) The control plant TRV: 00 With silent plants TRV: GhDRP3 Plant height ( TRV: 00 : Gray scatter plot on the left, TRV: GhDRP3: Purple scatter plot on the right. ns: no significant difference) and survival rate ( TRV: 00 : Grey violin plot on the left, TRV: GhDRP3 : Purple violin plot on the right. ***: Extremely significant difference) statistical result diagram.

[0020] Figure 4 WT and ghdrp3 Growth of mutant plants under different conditions; (a) shows the growth of the control plant WT and ghdrp3 The growth status of mutant plants under conditions of sufficient water, drought for 10 days and rewatering for 24 hours; (b) The figure shows the growth status of mutant plants WT and ghdrp3 The bar graph of the mutant plant survival rate and plant height statistics. (Plant height statistics WT: gray scatter plot on the left, ghdrp3 Purple scatter plot on the right. Survival statistics WT: gray box plot on the left, ghdrp3 Purple box plot on the right, ns: no significant difference; ***: extremely significant difference). DETAILED DESCRIPTION

[0021] The following will clearly and completely describe the technical solutions of the present invention in conjunction with the embodiments of the present invention. Obviously, the embodiments described are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0022] Unless otherwise specified, the experimental methods used in the following experimental examples are conventional methods; the materials and reagents used are commercially available reagents and materials unless otherwise specified.

[0023] Unless otherwise indicated, the practice of the present invention will utilize conventional botanical techniques, microbiology, tissue culture, molecular biology, chemistry, biochemistry, DNA recombination, and bioinformatics techniques readily apparent to those skilled in the art. These techniques are fully explained in the published literature. In addition, the methods employed in the present invention for DNA extraction, phylogenetic tree construction, gene editing methods, gene editing vector construction, and gene-edited plant production, in addition to the methods employed in the following examples, can all be accomplished using methods disclosed in the existing literature.

[0024] As used herein, the terms "nucleic acid," "nucleic acid sequence," "nucleotide," "nucleic acid molecule," or "polynucleotide" are meant to include isolated DNA molecules (e.g., cDNA or genomic DNA), RNA molecules (e.g., messenger RNA), natural types, mutant types, synthetic DNA or RNA molecules, DNA or RNA molecules composed of nucleotide analogs, single-stranded or double-stranded structures. These nucleic acids or polynucleotides include, but are not limited to, gene coding sequences, antisense sequences, and regulatory sequences in non-coding regions. These terms include a gene. "Gene" or "gene sequence" is widely used to refer to a functional DNA nucleic acid sequence. Thus, a gene may include introns and exons in a genomic sequence, and / or include coding sequences in a cDNA, and / or include cDNA and its regulatory sequences. In specific embodiments, such as with respect to isolated nucleic acid sequences, it is preferably assumed to be cDNA.

[0025] In the early stage of this application, the present invention used two cotton varieties, ZY007 (drought-tolerant) and ZY168 (sensitive), to screen out genes that were downregulated under drought treatment conditions. GhDRP3 like Figure 1 As shown, GhDRP3 The cDNA sequence of the gene is shown in SEQ ID No. 1, and the protein sequence encoded by the gene is shown in SEQ ID No. 2.

[0026] Example 1: Construction of TRV:GhDRP3 viral interference vector and Agrobacterium-mediated transformation 1. Construction of VIGS expression vector GhDRP3 The following primers were designed based on the nucleotide sequence of the primers. The primer sequences are shown below: GhDRP3-VIGS-F: (5'- CATACGCCACGATGCTGTTG -3'); GhDRP3-VIGS-R: (5'- CCTCACTGCCCTCTCGCTTAC -3'); Phanta high-fidelity enzyme was used for PCR amplification of gene fragments, and after amplification, agarose gel electrophoresis was used to detect and PCR products were purified and recovered. Bam HІ and KpnThe pTRV2 plasmid was double-digested with β-lactamase inhibitors (purchased from NEB, China) and purified. The PCR product was ligated with the digested pTRV2 plasmid fragment using homologous recombination and transformed into Escherichia coli DH5α (Tiangen Biotechnology). Colony PCR was performed using primers GhDRP3-VIGS-F / R. Positive colonies were screened and sequenced. After sequence alignment confirmed the correctness of the vector, positive strains were expanded and the recombinant plasmid was extracted. The plasmid was then introduced into Agrobacterium tumefaciens GV3101 (Tiangen Biotechnology) by electroporation. Positive strains were screened on resistance plates and stored in aliquots at -80°C.

[0027] 2. Add 100 μL of the stored pTRV1, pTRV2, and pTRV2:GhDRP3 Agrobacterium to 10 mL of LB liquid medium, and culture overnight at 28°C and 220 rpm / min until the OD 600 The bacterial cells were collected by centrifugation and the bacterial concentration was adjusted to OD 0. 600 The pTRV1 suspension was mixed with the pTRV2 suspension and the pTRV2:GhDRP3 suspension at a 1:1 volume ratio. The suspension was allowed to stand at room temperature for 2 hours before injection into 7-day-old TM-1 seedlings. The injected seedlings were incubated in the dark for 12 hours before returning to light (25°C; 70% relative humidity; 16 h light / 8 h dark).

[0028] Example 2: TRV: GhDRP3 interference efficiency detection According to the gene sequence of TRV:GhDRP3 vector, the primers for fluorescence quantification were designed as follows: GhDRP3-QRT-F: (5'- CTCGCAACAAGCCTCCAAG -3'); GhDRP3-QRT-R: (5'- CAAAACAACCATCGCCAGC -3'); In terms of experimental material selection, true leaf samples of cotton seedlings from TRV: 00 (empty vector control) and TRV: GhDRP3 (gene interference group) at the two-leaf-one-heart development stage were selected, and three independent biological replicates were set up for each group for subsequent analysis. RNA extraction was performed according to the Tiangen Biotechnology DP441 Polysaccharide and Polyphenol Plant Total RNA Extraction Kit. After the total RNA obtained passed the quality inspection, it was reverse transcribed and synthesized into a cDNA template using the Toyobo ReverTra Ace qPCR RT Kit. The obtained cDNA product was diluted 50 times as a template and usedGhUBQ7 The gene was double-validated as an internal reference: the amplified product was verified by conventional RT-PCR (1.2% agarose gel electrophoresis, Figure 2 Middle a, Figure 2 b) and quantitative RT-PCR (Roche LightCycler96 fluorescence quantitative system) analysis. Quantitative experiments were performed using triplicate wells. ^-ΔCt Algorithmic calculation GhDRP3 Relative gene expression. Figure 2 As shown in c, the leaves of the intervention group GhDRP3 The transcription level was significantly reduced to 25% of the control group, confirming that the VIGS system successfully achieved effective silencing of the target gene.

[0029] Example 3: Determination of Drought Resistance of TRV:GhDRP3 Interference Materials At the two-leaf, one-heart stage of cotton, the plant height of the TRV: 00 control plants and the TRV: GhDRP3 intervention plants was compared, and the results showed no significant difference between the two. When the soil moisture content was 80%, the TRV: 00 control plants and the TRV: GhDRP3 intervention plants were subjected to drought treatment. After 10 days of drought culture, the phenotype of the plants was observed. It was found that the degree of leaf wilting in the control TRV: 00 plants was significantly more severe than that in the TRV: GhDRP3 intervention plants ( Figure 3 After 24 hours of rehydration of drought-treated plants, the survival rate of TRV:GhDRP3-interference plants was about twice that of the control TRV:00 plants (see Figure 3 The above results show that TRV:GhDRP3 plants show stronger drought tolerance than the control TRV:00 plants, so it is inferred that GhDRP3 It plays a negative regulatory role in the drought resistance of cotton.

[0030] Example 4: [[ID= Creation of genetic CRISPR / Cas9 materials First, design ​ The target site of the gene-specific sequence is sgRNA: sgRNA1(SEQ ID No.3): GGGAAATCGGACAAAGAAAA sgRNA2(SEQ ID No.4): GATCCTGTTACCATCTCAAC Primers: GhDRP3-sgRNA1-F (SEQ ID No.5): GGAAATCGGACAAAGAAAAGTTTTAGAGCTAGAAAT; GhDRP3-sgRNA1-R (SEQ ID No.6): TTTTCTTTGTCCGATTTCCCAATCTCTTAGTCGACT; GhDRP3-sgRNA2-F (SEQ ID No.7): GATCCTGTTACCATCTCAACGTTTTAGAGCTAGAAAT; GhDRP3-sgRNA2-R (SEQ ID No.8): GTTGAGATGGTAACAGGATCTGACCAATGTTGCTCC; UF: CTCCGTTTTACCTGTGGAATCG; gR-R: CGGAGGAAAATTCCATCCAC.

[0031] The amplification program was as follows: 98°C for 10 s; 68°C for 5 s; 42 cycles; and 12°C for 10 min. Gene products containing the pYLgRNA-AtU3b and pYLgRNA-AtU6-29 promoters and sgRNA fragments were cloned and verified by 1% agarose gel electrophoresis. A second-round PCR amplification was performed using the first-round PCR product as a template: a 20 μL reaction system containing 10 μL of 2× KOD Buffer, 20-50 ng of the first-round PCR product mix, and primers Pps-GGL / Pgs-GG2 at 30 / 30 mM and Pps-GG2 / Pgs-GGR at 30 / 30 mM. The mixture was filled to 20 μL with ddH2O and gently mixed. The primer sequences involved are: Pps-GGL: TTCAGAggtctcTctcgACTAGTATGGAATCGGGCAGCAAAGG; Pgs-GG2: AGCGTGggtctcGtcagggTCCATCCACTCCAAGCTC; Pps-GG2: TTCAGAggtctcTctgacacTGGAATCGGCAGCAAAGG; Pgs-GGR: AGCGTGggtctcGaccgACGCGTATCCATCCACTCCAAGCTC.

[0032] First, the sgRNA1 / 2 expression cassette was cloned using a 42-cycle amplification program at 98°C for 10 s and 68°C for 5 s, and then stored at 4°C for 10 min to obtain the complete sgRNA1 / 2 expression cassette. After cloning, the product was purified and recovered. ​ The gene and the purified sgRNA1 / 2 expression cassette were assembled in tandem into the modified cotton CRISPR / Cas9 vector. The reaction was performed in a 15 μL system containing 10× CutSmart Buffer 1.5 μL, 10 mM ATP 1.5 μL, ​ 80-150 ng of gene editing vector, 20-50 ng of sgRNA expression cassette mixture, ​ Ⅰ-HF 0.5 μL (10 U) and T4 DNA Ligase 0.2 μL (80 U). The recombinant vector was introduced into competent Escherichia coli DH5α cells using heat shock transformation, followed by primary screening using a selective medium containing kanamycin. Single colonies obtained were verified by colony PCR amplification. After confirming the integrity of the vector sequence by sequencing, the recombinant plasmid was extracted and transformed into competent Agrobacterium tumefaciens LBA4404 cells by electroporation. Subsequently, using the Agrobacterium-mediated genetic transformation system, the engineered bacterial solution carrying the target gene was inoculated into pretreated hypocotyl segments of etiolated cotton seedlings. Through a complex process involving cell dedifferentiation, redifferentiation, and plant regeneration, gene-edited plants were successfully obtained.

[0033] Example 5: ​ Drought resistance test of mutant materials When wild-type WT and ​ When the mutant cotton plants grew to the two-leaf and one-heart stage, they were subjected to drought treatment. ​ As shown in the figure, there was no significant difference in plant height between the two plants in the initial stage. However, after 10 days of water shortage, the growth status of the two plants showed obvious differences: the leaves of the wild-type plants showed severe wilting, while the ​ The mutant plant's true leaves showed no obvious wilting. After 24 hours of rehydration, the survival rate of the two plants was statistically analyzed. ​ The survival rate of mutant plants is about twice that of wild-type plants. ​ The gene plays a negative regulatory role in cotton drought resistance.

[0034] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. Cotton GhDRP3 Application of genes in improving drought resistance traits in cotton.

2. The use according to claim 1, characterized in that: The application is achieved by making cotton GhDRP3 Loss of gene function.

3. The use according to claim 1 or 2, characterized in that: The cotton GhDRP3 The nucleotide sequence of the gene is shown in SEQ ID No.

1.

4. A method for improving drought resistance of cotton, characterized in that: The method is selected from any one of the following: (1) Constructing a gene silencing expression vector using VIGS technology to specifically silence the cotton plant to be improved GhDRP3 Gene, get silent cotton GhDRP3 genetically modified cotton plants; (2) Using the CRISPR / Cas9 system to improve cotton plants GhDRP3 Gene editing to obtain GhDRP3 Cotton plants with a missing gene function.

5. The method for improving drought resistance of cotton according to claim 4, wherein: The cotton GhDRP3 The nucleotide sequence of the gene is shown in SEQ ID No.

1.

6. The method for improving drought resistance of cotton according to claim 5, wherein: The primers for the VIGS expression vector in the method (1) are GhDRP3-VIGS-F with a sequence as shown in SEQ ID No. 1 and GhDRP3-VIGS-R with a sequence as shown in SEQ ID No.

2.

7. The method for improving drought resistance of cotton according to claim 5, wherein: The target sites for gene editing in the method (2) are sgRNA1 having a sequence as shown in SEQ ID No. 3 and sgRNA2 having a sequence as shown in SEQ ID No.

4.

8. The method for improving drought resistance of cotton according to claim 7, wherein: The primer pair used to detect the target site sgRNA1 is GhDRP3-sgRNA1-F as shown in SEQ ID No. 5 and GhDRP3-sgRNA1-R as shown in SEQ ID No.

6.

9. The method for improving drought resistance of cotton according to claim 7, wherein: The primer pair used to detect the target site sgRNA2 is GhDRP3-sgRNA2-F as shown in SEQ ID No. 7 and GhDRP3-sgRNA2-R as shown in SEQ ID No.

8.

10. Use of the method according to any one of claims 4 to 9 in preparing cotton plants with high drought resistance.

Images