Quantitative internal reference combination system in multiple amplification system, detection method and application
By designing internal reference genes with differential copy number gradients and screening internal reference genes with consistent GC content deviation and amplification efficiency, the problem of inaccurate quantification of pathogenic microorganisms in the multiplex amplification system was solved, and quantitative detection with high accuracy and consistency was achieved.
Patent Information
- Application Number
- CN202510612897.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-13
- Publication Date
- 2025-09-23
AI Technical Summary
The existing technology has quantitative inaccuracies and poor repeatability in multiplex amplification systems, and the existing technology cannot solve the linearity problem between different tubes.
By introducing differentiated primer binding regions into the multiple diffusion system, the primer binding region includes a primer sequence and/or primer binding sequence, designing internal reference genes with differential copy number gradients, screening internal reference genes with a GC content deviation of no more than 1% and a coefficient of variation of the CT value in the amplification efficiency evaluation test of no more than 5%, and using a highly specific fixed sequence, it is possible to achieve differentiation of an internal reference in one reaction tube through changes in the variable sequence, ensure consistent amplification efficiency, and establish a linear relationship for each reaction tube.
The accuracy and repeatability of quantitative detection of pathogenic microorganisms in a multiplex amplification system are achieved, overcoming the differences in amplification coefficients of different amplification systems and ensuring quantitative accuracy and consistency.
Smart Images

Figure CN120683233A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of molecular diagnosis, and in particular to a quantitative internal reference combination system, a detection method and an application in a multiplex amplification system. Background Art
[0002] Since its development in 2005, next-generation sequencing (NGS) technology has seen increasing application in clinical pathogen detection. Over the past decade, the continuous development of NGS technology and the advancement of domestic sequencers have led to the emergence of a large number of NGS-based molecular diagnostic products. Their rapid, comprehensive, and accurate nature has significantly aided the etiological diagnosis of clinically infected patients.
[0003] With increasing clinical demand, the application of mNGS and tNGS in pathogen diagnosis has become increasingly mature, and pathogen detection has evolved from qualitative detection to quantitative detection. In order to quickly and accurately quantify the content of specific pathogens in the sample to be tested, a large number of NGS-based technologies for pathogen quantification have been developed on the market.
[0004] Currently, most mNGS and tNGS quantitative products primarily rely on primer internal references to achieve pathogen quantification by analyzing the relationship between the sequence numbers detected by the internal reference and the pathogen sequence numbers. Some, such as Bingyuan, Jinchi, and Jieyi, use a single internal reference sequence for pathogen quantification. Others, such as Jinqirui, use multiple internal references for pathogen quantification. Their pathogen metagenomic quantification utilizes at least six sequences, establishing a quantitative relationship between these six sequences to achieve pathogen quantification.
[0005] For the current nucleic acid detection and quantification methods based on target sequence amplification, there are certain problems with the accuracy of quantification, and they are of little significance for clinical reference.
[0006] Chinese patent application CN108103174A (published on August 1, 2018) discloses a quantitative standard for accurately quantifying Illumina platform second-generation sequencing samples by qPCR and its replication method. The method discloses a quantitative standard that uses universal primers to quantify the library, but the method uses fluorescent quantitative PCR and is not suitable for high-throughput sequencing.
[0007] Chinese patent application CN116240297A (publication date June 9, 2023) discloses an internal standard molecule, kit and method for quantitative detection of pathogenic microorganism metagenomics. The method discloses the use of at least 6 sequences for metagenomic detection of pathogens, but the method is not suitable for targeted pathogen quantification.
[0008] Chinese patent application CN116732151A (published on September 12, 2023) discloses a semi-quantitative method for targeted detection using a multiplex PCR system. This method includes the steps of establishing an internal reference correction coefficient and an amplification variance coefficient. This semi-quantitative method can quantitatively analyze target pathogens, clearly indicating the copy number of pathogenic microorganisms in a test sample, and can simultaneously detect multiple target pathogens in a single sample. However, this method uses three internal references to establish a relationship between the internal reference correction coefficient and the amplification variance coefficient before performing quantification. However, amplification varies between different reaction tubes and batches, and subsequent quantification using this established coefficient relationship cannot address the issue of amplification variance between different tubes and batches. Chinese patent application CN118006828A (published on May 10, 2024) discloses a primer-probe combination, kit, and detection method for simultaneous detection of four Candida species using digital PCR. This method discloses a quantitative method using digital PCR, but it uses limiting dilution of nucleic acids using digital PCR and statistical quantification based on a Poisson distribution, making it unsuitable for targeted tNGS.
[0009] Chinese patent application CN117551795A (publication date February 13, 2024) discloses a reaction system that is compatible with a kit for detecting multiple pathogenic microorganisms. The method discloses a multiple amplification system and a multiple pathogen primer set, but the method cannot quantitatively detect pathogens. Summary of the Invention
[0010] Purpose of the invention: The purpose of the present invention is to provide a quantitative internal reference combination system in a multiplex amplification system; another purpose of the present invention is to provide a quantitative detection method in a multiplex amplification system; another purpose of the present invention is to provide the application of the quantitative internal reference combination system for quantitative detection of pathogenic microorganisms in a multiplex amplification system.
[0011] Technical solution: The quantitative internal reference combination system in a multiplex amplification system according to the present invention comprises a plurality of internal reference genes, each of which comprises at least:
[0012] The upstream primer binding region comprises at least a primer sequence and / or a primer binding sequence,
[0013] Variable sequence, which is a short base sequence of 2-30 bp in length,
[0014] A fixed sequence comprising a gene segment with low homology to pathogenic microorganisms and high specificity, and
[0015] a downstream primer binding region, which comprises at least a primer sequence and / or a primer binding sequence;
[0016] The multiple internal reference genes have a differential copy number gradient, and the variable sequence of each internal reference gene is different.
[0017] At least a portion of the upstream primer binding region or the downstream primer binding region described in the present invention is a single-stranded nucleic acid that is complementary to the internal reference sequence (template). When used in the tNGS multiplex amplification system, the primer binding region is used for multiple rounds of amplification to amplify the internal reference sequence.
[0018] The variable sequence of the present invention is used to identify differences between internal reference genes and is located between the upstream primer binding region and the fixed sequence. As a preferred embodiment of the present invention, the variable sequence is a base sequence with a length of 2-10 bp. As an optimal embodiment of the present invention, the variable sequence is a base sequence with a length of 3-8 bp. More preferably, in the variable sequence, the continuously repeated base sequence does not exceed 2 bp. The longer the variable sequence, the greater the impact on the GC content of the internal reference gene, the more complex the fragment, the greater the probability of dimer formation, and the greater the impact on amplification efficiency; the shorter the variable sequence, the lower the specificity of comparison with the human genome, nt library and pathogen database.
[0019] The fixed sequence described in the present invention is a gene fragment with a length of 100-300 bp and a GC content of 40%-60%, preferably a gene fragment with a GC content of 45%-55%. This is used to ensure consistency in the efficiency of internal reference amplification. The fixed sequence is a gene fragment obtained after screening with low homology to pathogenic microorganisms and high specificity. The alignment with the nt library is 0, which helps to avoid the occurrence of false positives. Based on the species source, the fixed sequence is selected from environmental microbial sequences, plant sequences, or artificial sequences with low homology to pathogenic microorganisms. As a further optimization of the present invention, the fixed sequence described in the present invention is 150-200 bp in length.
[0020] As a further optimization of the present invention, the fixed sequence does not contain microsatellite sequences, and the number of consecutively repeated base sequences does not exceed 8 bp. As the most preferred embodiment of the present invention, the number of consecutively repeated base sequences in the fixed sequence does not exceed 5 bp.
[0021] Existing tNGS multiplex PCR quantification methods based on internal references primarily rely on the amplification coefficient established between the internal reference copy number and the pathogen copy number for quantification. In these methods, the same amplification coefficient is used for different samples, and multiple amplifications in different reaction tubes, or even between replicates of the same reaction, can result in variability. Using the same amplification coefficient for pathogen quantification can lead to inaccurate and poor reproducibility. Furthermore, some existing techniques use multiple internal reference sequences, which can vary in amplification efficiency, leading to problems with linear relationships when quantifying multiple sequences. Unlike the existing art, the present invention proposes a quantitative internal reference combination system for the first time. Each reaction tube contains internal reference genes with varying copy concentrations and different nucleotide sequences (different variable sequences). These internal reference genes have consistent amplification efficiencies, enabling differentiation of a single internal reference gene within a single reaction tube by varying the variable sequence. This ensures highly consistent amplification efficiency and a linear relationship across each reaction tube. As a preferred embodiment of the present invention, the multiple internal reference genes have m concentration gradients. m can be a natural number of 2, 3, 4, 5, 6, 7, or greater. For tNGS multiplex systems, m = 3~6 is preferred.
[0022] Furthermore, the GC content deviation of the reference genes should not exceed 1%, preferably 0; and the coefficient of variation of the CT value in the amplification efficiency evaluation test should not exceed 5%. Specifically, excessive GC content deviation can lead to significant differences in the base composition of variable sequences, affecting the GC content of the fragments and amplification efficiency, thereby affecting quantitative accuracy.
[0023] Amplification efficiency, as used herein, refers to the probability of successful replication of a DNA molecule in each cycle. For absolute quantification, amplification efficiency evaluation is typically determined using a standard curve method; evaluation can be performed using methods including, but not limited to, qPCR and gel electrophoresis. Specifically, when the same amount or copy of internal reference genes with different variable sequences is added, the reference genes with different variable sequences in each reaction tube exhibit overlapping or nearly overlapping amplification curves relative to each other or to an internal reference gene without a variable sequence.
[0024] Furthermore, the primer binding region includes a primer binding sequence connected to at least one platform sequencing primer, and the platform sequencing primer is selected from sequencing primers of MGI or Illumina platforms.
[0025] Furthermore, the internal reference gene can be double-stranded or single-stranded DNA or RNA. As a preferred embodiment of the present invention, double-stranded DNA is used, as double-stranded DNA is more stable. If the system needs to be monitored starting from reverse transcription, the internal reference gene can also be selected from single-stranded RNA.
[0026] In the quantitative internal reference combination system of the present invention, the internal references of different variable sequences are mixed together according to a certain copy number concentration gradient. The internal reference gene has a copy number gradient of 2-1000 times, preferably a copy number gradient of 5-100 times, and more preferably a copy number gradient of 5-10 times. The total copy number concentration of the internal reference is 100-100000 copies / μl, preferably 1000-5000 copies / μl. Too high or too low a total copy number concentration of the internal reference is not conducive to pathogen detection. If the total copy number concentration of the internal reference is too high, it will occupy the amount of pathogen data. If the total copy number concentration of the internal reference is too low, the internal reference detection will be too low, affecting the determination of the amplification coefficient.
[0027] The present invention also provides a quantitative detection method in a multiplex amplification system, comprising the following steps:
[0028] S100: Design candidate internal reference genes, the candidate internal reference genes including:
[0029] The upstream primer binding region comprises at least a primer sequence and / or a primer binding sequence,
[0030] Variable sequence, which is a short base sequence of 2-30 bp in length,
[0031] A fixed sequence comprising a gene segment with low homology to pathogenic microorganisms and high specificity, and
[0032] a downstream primer binding region, which comprises at least a primer sequence and / or a primer binding sequence;
[0033] S200: Screening of candidate reference genes with a GC content deviation of no more than 1%;
[0034] S300: Screening of reference genes whose coefficient of variation of CT values does not exceed 5% in the amplification efficiency evaluation test;
[0035] S400: diluting the internal reference gene in a gradient manner according to the differential copy number to obtain a quantitative internal reference combination system;
[0036] S500: performing amplification of the multiplex amplification system to establish a linear relationship between the sequence number of different internal reference genes and the internal reference copy number;
[0037] S600: Determine the concentration of pathogenic microorganisms.
[0038] Furthermore, the fixed sequence is a gene fragment with a length of 100-300 bp and a GC content of 40%-60%.
[0039] Furthermore, the fixed sequence does not contain a microsatellite sequence, and the length of the continuously repeated base sequence does not exceed 8 bp.
[0040] Furthermore, the internal reference gene has a copy number gradient of 2-1000 times, and the total copy number concentration of the internal reference is 100-100000 copies / μl.
[0041] Furthermore, the multiplex amplification system is a tNGS quantitative detection system.
[0042] The present invention provides a quantitative internal reference combination system and a detection method in a multiplex amplification system for quantitatively detecting pathogenic microorganisms in a multiplex amplification system. The system has the dual functions of quantitative determination and monitoring the amplification system. By designing and screening the internal references, the amplification efficiency of different internal reference sequences is ensured to be consistent. The quantitative method has accurate quantitative determination, overcomes the differences in amplification coefficients among different amplification systems, and ensures quantitative accuracy.
[0043] The present invention provides a quantitative internal reference consisting of a primer binding region, a variable sequence, and a fixed sequence. Different internal reference sequences differ only in the variable sequence, ensuring similar amplification efficiencies for the different internal references. Specific requirements are placed on the length and GC content of the variable sequence, and the references undergo qPCR amplification screening to ensure that all internal references have the same amplification efficiency. Furthermore, within the same tube amplification system, an amplification coefficient is determined by the relationship between the copy number and sequence number of different variable sequence internal references. Different tubes have different amplification coefficients, and each reaction corresponds to a single amplification coefficient, thus resolving the quantitative discrepancies caused by using the same amplification coefficient across different tubes and achieving higher quantitative accuracy. BRIEF DESCRIPTION OF THE DRAWINGS
[0044] Figure 1 is a flow chart of the method of embodiment 1 of the present invention;
[0045] Figure 2 This is a quantitative concentration consistency curve diagram of Example 2 of the present invention. DETAILED DESCRIPTION
[0046] In order to make the technical solution of the present invention clearer, the present invention is further described in detail below with reference to the accompanying drawings and specific embodiments.
[0047] Example 1
[0048] This embodiment provides a quantitative internal reference combination system in a multiplex amplification system, including several internal reference genes, each of which includes at least:
[0049] The upstream primer binding region comprises at least a primer sequence and / or a primer binding sequence,
[0050] Variable sequence, which is a short base sequence of 2-30 bp in length,
[0051] A fixed sequence comprising a gene segment with low homology to pathogenic microorganisms and high specificity, and
[0052] a downstream primer binding region, which comprises at least a primer sequence and / or a primer binding sequence;
[0053] Several reference genes had differential copy number gradients, and the variable sequences of each reference gene were different. The GC content of several reference genes had a deviation of no more than 1%, and the coefficient of variation of the CT value in the amplification efficiency evaluation test did not exceed 5%.
[0054] This embodiment also provides a quantitative detection method in a multiplex amplification system, such as Figure 1 As shown, the specific steps include:
[0055] S100: Design alternative internal reference genes, including:
[0056] The upstream primer binding region comprises at least a primer sequence and / or a primer binding sequence,
[0057] Variable sequence, which is a short base sequence of 2-30 bp in length,
[0058] A fixed sequence comprising a gene segment with low homology to pathogenic microorganisms and high specificity, and
[0059] a downstream primer binding region, which comprises at least a primer sequence and / or a primer binding sequence;
[0060] S200: Screening of candidate reference genes with a GC content deviation of no more than 1%;
[0061] S300: Screening of reference genes whose coefficient of variation of CT values does not exceed 5% in the amplification efficiency evaluation test;
[0062] S400: dilute the internal reference gene according to the differential copy number to obtain a quantitative internal reference combination system;
[0063] S500: performing amplification of the multiplex amplification system to establish a linear relationship between the sequence number of different internal reference genes and the internal reference copy number;
[0064] S600: Determine the concentration of pathogenic microorganisms.
[0065] Example 2
[0066] This embodiment also provides a quantitative detection method in a multiplex amplification system, which comprises the following steps:
[0067] S100: Design of alternative reference genes
[0068] S110: Internal reference sequence design
[0069] (1) Based on the Arabidopsis genome GCF_000001735.4, the fragments were randomly cut into 150 bp-200 bp lengths using a python script. Sequences with a GC content of 40%-60%, no microsatellite sites, and no continuous repeated bases of 8 bp or more were screened using the python script.
[0070] (2) Homology assessment: starting from the 5' end and using 50 bp, 75 bp, 100 bp, 150 bp, and 200 bp as windows, the sequences were compared with the human genome, pathogenic microorganism database, and nt library to screen out sequences that had no homology with the human genome, pathogenic microorganism database, and nt library;
[0071] The internal reference sequence (SEQ ID No: 1) is as follows:
[0072] AATCCAATCCCCATCTCTCCC ATACTTACAAATGCTCCTCAGCTCTTCTCGTCTGTCCTGTCCTTAACAAACCATTAACTATAATCGTGTGTGTATACTCATCCGCTTTCATTCCTCTCCGCTCTATCTCT CCTAACAAATCA TCGACCGCA .
[0073] The underlined part is the upstream primer sequence and the downstream primer binding region sequence in the internal reference, and the ununderlined part in the middle is the fixed sequence. The internal reference sequence can be a double-stranded or single-stranded DNA or RNA sequence, and those skilled in the art can choose according to their needs.
[0074] S120: internal reference primer sequence
[0075] This embodiment uses the MGI platform, and the MGI platform sequencing primer sequence is added before the primer binding region, such as the underlined sequence of the F-terminal primer and the underlined sequence of the R-terminal primer. This primer sequence is used for multiplex PCR amplification primers.
[0076] The primer sequences are as follows:
[0077] F-terminal primer (SEQ ID No: 2): CAACTCCTTGGCTCACAGAACGACATGGCTACGATCCGACTT AATCCAATCCCCATCTCTCCC;
[0078] R-terminal primer (SEQ ID No: 3): TTGTCTTCCTAAGACCGCTTGGCCTCCGACTT TGCGGTCGATGATTTGTTAGG.
[0079] S130: Insert variable sequence
[0080] A variable sequence is inserted after the primer binding region of the F-terminal primer. The internal reference is now divided into three parts: the primer binding region, the variable sequence, and the fixed sequence, from left to right. In this example, the inserted variable sequence is 3 bp long, with a total of 64 sequence combinations.
[0081] S200: Screening for candidate reference genes with GC content deviations not exceeding 1%
[0082] The GC content of 64 sequences was evaluated and grouped according to the GC content. Within each group, variable bases were avoided as much as possible from sequences with three or more consecutive identical bases. The junction between the variable sequence and the fixed sequence was avoided from five consecutive repeated bases to avoid the formation of secondary structures that would affect the amplification efficiency.
[0083]
[0084] The sequences were grouped according to GC content, and sequences with more than three consecutive repeated bases were removed to screen out the following combinations:
[0085] Combination 1 (GC content 42.9%):
[0086]
[0087] Combination 1 (GC content 43.6%):
[0088]
[0089] Combination 3 (GC content 44.2%):
[0090]
[0091] Combination 4 (GC content 44.9%):
[0092]
[0093] S300: Screening for reference genes whose coefficient of variation of CT values does not exceed 5% in amplification efficiency evaluation tests
[0094] Synthesize the sequence group of combination 2 in step S200, and use qPCR or gel electrophoresis to evaluate the amplification efficiency of different sequences in the same combination. Use qPCR evaluation, input the same copy number of template, perform qPCR amplification, compare the amplification curves or CT values, and select the combination whose amplification curve overlaps with the amplification curve of the internal reference without the variable sequence and whose CV value between the CT values is less than 5% as the quantitative internal reference.
[0095] The qPCR amplification system was as follows: 2 × Taq Pro Universal SYBR qPCR Master Mix, 10 μl, purchased from Norvegian, cat. no. P515; Primer 1 (10 μM) 0.4 μl; Primer 2 (10 μM) 0.4 μl (all primers were synthesized by Bio-Technology); template input 10 pg; total volume 20 μl.
[0096] Amplification program: 95°C, 30 s; (95°C, 10 s, 60°C, 10 s) × 40.
[0097] qPCR verification showed that the amplification differences of each sequence were small. In this embodiment, sequences with ct values of 27.1-27.2 were selected, thereby achieving five differentiations of one internal reference in one tube through different variable sequences. This not only ensured highly consistent amplification efficiency, but also achieved a linear relationship in each tube reaction.
[0098]
[0099] S400: Dilute the reference gene according to the differential copy number to obtain a quantitative reference combination system
[0100] The following reference gene combinations were obtained through the above steps (variable sequences are underlined):
[0101] Sequence 1: AATCCAATCCCCATCTCTCCC ATC ATACTTACAAAATGCTCCTCAGCTCTTCTCGTCTGTCCTGTCCTTAACAAACCATTAACTATAATCGTGTGTGTATACTCATCCGCTTTCATTCCTCTCCGCTCTATCTCTCCTAACAAATCATCGACCGCA;
[0102] Sequence 2: AATCCAATCCCCATCTCTCCC AGT ATACTTACAAAATGCTCCTCAGCTCTTCTCGTCTGTCCTGTCCTTAACAAACCATTAACTATAATCGTGTGTGTATACTCATCCGCTTTCATTCCTCTCCGCTCTATCTCTCCTAACAAATCATCGACCGCA;
[0103] Sequence 3: AATCCAATCCCCATCTCTCCC TAGATACTTACAAAATGCTCCTCAGCTCTTCTCGTCTGTCCTGTCCTTAACAAACCATTAACTATAATCGTGTGTGTATACTCATCCGCTTTCATTCCTCTCCGCTCTATCTCTCCTAACAAATCATCGACCGCA;
[0104] Sequence 4: AATCCAATCCCCATCTCTCCC TCT ATACTTACAAAATGCTCCTCAGCTCTTCTCGTCTGTCCTGTCCTTAACAAACCATTAACTATAATCGTGTGTGTATACTCATCCGCTTTCATTCCTCTCCGCTCTATCTCTCCTAACAAATCATCGACCGCA;
[0105] Sequence 5: AATCCAATCCCCATCTCTCCC GAT ATACTTACAAAATGCTCCTCAGCTCTTCTCGTCTGTCCTGTCCTTAACAAACCATTAACTATAATCGTGTGTGTATACTCATCCGCTTTCATTCCTCTCCGCTCTATCTCTCCTAACAAATCATCGACCGCA.
[0106] Synthesize the above sequence combination, perform Qubit quantification on the above sequence, calculate the copy number by Qubit concentration, and dilute to 10,000 copies / µl;
[0107] For the diluted internal reference sequence, dilute the five sequences in the combination separately, with sequence 1 not diluted, sequence 2 diluted 10 times, sequence 3 diluted 100 times, sequence 4 diluted 1000 times, and sequence 5 diluted 10,000 times. Then take the same volume and mix them to complete the preparation of quantitative internal reference.
[0108] S500: Perform amplification of the multiplex amplification system to establish the relationship between the sequence number of different internal reference genes and the internal reference copy number Linear relationship
[0109] S510: Prepare mock samples using pathogenic nucleic acids of known copy number as listed in the table below. Dilute with ddH2O to concentrations of 5000 copies / ml, 1000 copies / ml, and 500 copies / ml, using 10 µl of sample for each concentration. Repeat three times for each concentration.
[0110]
[0111] S520: Add the corresponding pathogen PCR primers and the primer corresponding to the internal reference IC to samples of different known concentrations to prepare a round of multiplex PCR amplification system. The system is as follows:
[0112] Primer Panel Mix 5 µl, PCR enzyme 5 µl, H2O 4 µl, internal control combination 1 µl; a total of 25 µl amplification system.
[0113] S530: First round of PCR to enrich the target gene and internal reference sequence. Thoroughly mix the amplification system from step S520, briefly centrifuge, and place in a PCR instrument. Amplify according to the following PCR reaction protocol:
[0114]
[0115] S540: Purify the first round of amplification products to screen the target fragment and remove non-specific amplification such as dimers. After obtaining the target fragment in the first round of PCR, purify it using the Ampure XP Magnetic Bead Purification Kit or other equivalent kit to remove excess PCR primers and dimers, effectively enrich the target region fragment, and reduce the concentration of non-specific amplification. The specific steps are as follows:
[0116] 1) Add 20 µl of AMPure XP Beads to the PCR reaction mixture and pipette up and down to thoroughly mix the amplified product and AMPure XP Beads. Let stand at room temperature for 5 minutes.
[0117] 2) Place the beads on a magnetic stand until the solution becomes clear;
[0118] 3) Carefully aspirate the supernatant with a pipette and discard it;
[0119] 4) Add 200 µl of 80% ethanol to wash the magnetic beads and discard the supernatant;
[0120] 5) Repeat the previous steps;
[0121] 6) Leave at room temperature for 5 minutes until the ethanol evaporates completely;
[0122] 7) Add 25 µl of ddH2O, vortex evenly, and let stand at room temperature for 1-2 minutes;
[0123] 8) Pipette 20 µl of supernatant and proceed to the next step.
[0124] S550: Perform a second round of PCR on the recovered product and connect the sequencing adapters and barcodes. The second round PCR reaction system is as follows: PCR Mix 25 µl, Index Primer 5 µl. Run the PCR reaction program as follows:
[0125]
[0126] S560: Purify the second-round PCR amplification products.
[0127] The obtained product is purified using the Ampure XP Magnetic Bead Purification Kit or other kits with equivalent functions. The purification steps are as follows:
[0128] 1) Add 50 µl of AMPure XP Beads to the PCR product and pipette up and down to thoroughly mix the recovered product and AMPure XP Beads. Incubate at room temperature for 5 minutes.
[0129] 2) Place the beads on a magnetic stand for 2 minutes until the solution becomes clear.
[0130] 3) Carefully aspirate the supernatant with a pipette, discard the supernatant, and retain the magnetic beads;
[0131] 4) Add 200 µl of 80% ethanol to wash the magnetic beads and discard the supernatant;
[0132] 5) Repeat the previous steps;
[0133] 6) Leave at room temperature for 5 minutes until the ethanol evaporates completely;
[0134] 7) Add 25 µl of ddH2O, vortex evenly, and let stand at room temperature for 1-2 minutes;
[0135] 8) Pipette 20 µl of the supernatant into a new 1.5 ml centrifuge tube. The product can be used directly for subsequent experiments or stored at -20°C. The remaining library in the PCR tube can be used for electrophoresis quality control.
[0136] S570: Library quality control
[0137] 1) Library electrophoresis: Dilute a portion of the library to 1 ng / µl and perform a size check on the library fragments using Qsep. The average size of the correct library fragments is 300 bp.
[0138] 2) Library quantification: Take 1 μl of the library elution product, add 199 μl of Qubit dye (diluted to the working concentration), mix thoroughly, incubate in the dark for 2 min, and then quantify using a Qubit instrument.
[0139] S580: On-machine sequencing and data-based filtering analysis
[0140] According to the quantitative results, all libraries were mixed at a mass ratio of 1:1. The sequencing platform was BGI MGIseq200, and the sequencing kit was MGISEQ-200RS High-Throughput Sequencing Reagent Set (FCL SE50).
[0141] The sequencing mode is SE50, and the data volume is 2M.
[0142] Cutadapt software was used to remove sequencing adapters, reads with Q20 less than 85%, and reads containing a large number of N in the offline data reads. Primers were then used to match the reads, and the reads non-specifically amplified by the primers were removed based on the matching results.
[0143] Based on the designed primers, the amplified product sequence of the simulated PCR was constructed into a reference fasta file for multiple target genes. The sequencing reads were aligned with the reference fasta file using bwa software, and reads with mismatches of no more than 10% of the total length were considered to be aligned with the target gene. After the alignment was completed, the number of reads aligned with each pathogen and the number of reads with different variable sequence internal references were directly counted, and a linear relationship between the number of reads and the number of copies of the variable sequence internal reference was established, requiring R 2 ≥0.99, the pathogen copy number concentration was estimated based on the linear relationship between the internal reference copy number and the number of reads and the number of pathogen reads.
[0144] S590: Test results
[0145] 1) Relationship between the number of internal reference detected sequences and the theoretical copy number of the internal reference
[0146] Based on the number of internal reference sequences detected by sequencing, a linear relationship between the number of sequences of different variable sequence internal references and the theoretical concentration of the internal reference was established, as shown in the table below.
[0147]
[0148] Note: y represents the number of detected sequences (Species_reads_RPM), and x represents the copy number concentration (copies / ml)
[0149] A linear relationship is established in each reaction tube using an internal reference, avoiding the difference in linear relationships between different tubes, thereby achieving quantitative accuracy.
[0150] 2) Calculation of pathogen quantitative concentration
[0151] The pathogen concentration was calculated based on the linear relationship between the standardized sequence number of pathogen detection at different concentrations and the corresponding reaction tube, and the average value of three replicates was taken, as shown in the following table:
[0152]
[0153] S600: Determine the concentration of pathogenic microorganisms
[0154] The linear relationship between the copy number concentration and the quantitative concentration of different pathogens was statistically analyzed. The copy number concentration was used as the horizontal axis and the quantitative concentration was used as the vertical axis to establish a linear relationship between the two groups of concentration values. The higher the linear relationship, that is, the higher the consistency rate, the higher the quantitative accuracy. The quantitative accuracy was evaluated by the consistency rate between the quantitative concentration and the copy number concentration. The quantitative method had high accuracy and the linear relationship R 2 >0.99, such as Figure 2 shown.
[0155] The above-described embodiments merely illustrate several implementations of the present invention, and while their descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, all of which fall within the scope of protection of the present invention. Therefore, the scope of protection of the present invention shall be determined by the appended claims.
Claims
1. A quantitative internal reference combination system in a multiplex amplification system, characterized in that: The system includes several internal reference genes, each of which includes at least: The upstream primer binding region comprises at least a primer sequence and / or a primer binding sequence, Variable sequence, which is a short base sequence of 2-30 bp in length, A fixed sequence comprising a gene segment with low homology to pathogenic microorganisms and high specificity, and a downstream primer binding region, which comprises at least a primer sequence and / or a primer binding sequence; The multiple internal reference genes have a differential copy number gradient, and the variable sequence of each internal reference gene is different.
2. The quantitative internal reference combination system in a multiplex amplification system according to claim 1, characterized in that: The GC content deviation of the several reference genes does not exceed 1%, and The coefficient of variation of the CT value in the amplification efficiency evaluation test did not exceed 5%.
3. The quantitative internal reference combination system in a multiplex amplification system according to claim 2, characterized in that: The fixed sequence is a gene fragment with a length of 100-300 bp and a GC content of 40%-60%.
4. The quantitative internal reference combination system in a multiplex amplification system according to claim 3, characterized in that: The fixed sequence does not contain a microsatellite sequence, and the continuously repeated base sequence does not exceed 8 bp.
5. The quantitative internal reference combination system in a multiplex amplification system according to claim 1, characterized in that: The primer binding region includes a primer binding sequence connected to at least one platform sequencing primer, and the platform sequencing primer is selected from the sequencing primers of the MGI or Illumina platform.
6. The quantitative internal reference combination system in a multiplex amplification system according to any one of claims 1 to 5, characterized in that: The internal reference gene has a copy number gradient of 2-1000 times, and the total copy number concentration of the internal reference is 100-100000 copies / μl.
7. A quantitative detection method in a multiplex amplification system, characterized in that The steps include: S100: Design candidate internal reference genes, the candidate internal reference genes including: The upstream primer binding region comprises at least a primer sequence and / or a primer binding sequence, Variable sequence, which is a short base sequence of 2-30 bp in length, A fixed sequence comprising a gene segment with low homology to pathogenic microorganisms and high specificity, and a downstream primer binding region, which comprises at least a primer sequence and / or a primer binding sequence; S200: Screening of candidate reference genes with a GC content deviation of no more than 1%; S300: Screening of reference genes whose coefficient of variation of CT values does not exceed 5% in the amplification efficiency evaluation test; S400: diluting the internal reference gene in a gradient manner according to the differential copy number to obtain a quantitative internal reference combination system; S500: performing amplification of the multiplex amplification system to establish a linear relationship between the sequence number of different internal reference genes and the internal reference copy number; S600: Determine the concentration of pathogenic microorganisms.
8. The quantitative detection method in a multiplex amplification system according to claim 7, characterized in that: The fixed sequence is a gene fragment with a length of 100-300 bp and a GC content of 40%-60%.
9. The quantitative detection method in a multiplex amplification system according to claim 8, characterized in that: The fixed sequence does not contain a microsatellite sequence, and the continuously repeated base sequence does not exceed 8 bp.
10. The quantitative detection method in a multiplex amplification system according to any one of claims 7 to 9, characterized in that: The internal reference gene has a copy number gradient of 2-1000 times, and the total copy number concentration of the internal reference is 100-100000 copies / μl.
11. The quantitative detection method in a multiplex amplification system according to claim 10, characterized in that: The multiplex amplification system is a tNGS quantitative detection system.
12. Use of the quantitative internal reference combination system according to any one of claims 1 to 6 for quantitative detection of pathogenic microorganisms in a multiplex amplification system.
Citation Information
Patent Citations
Quantitative standard substance applied to qPCR (quantitative Polymerase Chain Reaction) accurate quantification of Illumina platform next generation sequencing sample and duplication method thereof
CN108103174A
Internal standard molecule, kit and method for quantitative detection of pathogenic microorganism metagenome
CN116240297A
Targeted detection semi-quantitative method of multiple PCR (Polymerase Chain Reaction) system
CN116732151A
Reaction system matched with kit for detecting various pathogenic microorganisms
CN117551795A
Primer probe combination, kit and detection method for simultaneously detecting four kinds of candida through digital PCR (Polymerase Chain Reaction)
CN118006828A